CN114058561B

CN114058561B - N-acetylglucosamine production strain and application thereof

Info

Publication number: CN114058561B
Application number: CN202111211220.5A
Authority: CN
Inventors: 吴杰群; 吴广利; 朱进妹; 王亚楠
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2021-10-18
Filing date: 2021-10-18
Publication date: 2024-02-20
Anticipated expiration: 2041-10-18
Also published as: CN114058561A

Abstract

The invention relates to a glucosamine production strain and a construction method thereof, the technical proposal firstly carries out transformation of chassis cells of gluconobacter oxydans, knocks out membrane-bound glucose dehydrogenase gene mGDH, and selects 800bp and pOJ260 about mGDH to recombine to obtain knocked out plasmid pOJ260 _△ mGDH, transferring the carrier into Gluconobacter oxydans, screening to obtain mGDH knockout bacterium of Gluconobacter oxydans, named Gluconobacter oxydans _△ mGDH. Then the Glms, GNA1 genes and pOJ260 containing the T7 strong promoter were used _△ mGDH-T7 recombination to obtain plasmid Poj260 for intensified expression _△ mGDH-T7-Glms-GNA1, the vector was transferred to Gluconobacter oxydans _△ In the mGDH bacteria, the construction of glucosamine-producing bacteria is completed, and the scheme adopted by the invention for solving the technical problems provides an improved bacteria of Gluconobacter oxydans, which is named as Gluconobacter oxydans GlmsGNA1 and has the preservation number (CGMCC No. 23399). The fermentation result shows that the constructed Gluconobacter oxydans GlmsGNA1 can produce N-acetylglucosamine by taking glucose as a substrate.

Description

N-acetylglucosamine production strain and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an N-acetylglucosamine production strain and a construction method thereof.

Background

N-acetylglucosamine (GlcNAc) is a very important functional monosaccharide, a compound formed by substituting the 2-hydroxyl group of a glucose molecule with an N-acetamido group, and is an important component of mucopolysaccharide and chitin, and is widely distributed in nature. GlcNAc, an important functional monosaccharide, is a component of glycosaminoglycans (e.g., hyaluronic acid and chondroitin sulfate) in the human body and has long been used as a drug for treating osteoarthritis and maintaining cartilage and joint health.

The current methods for producing GlcNAc are chitin hydrolysis and microbial fermentation. Chitin hydrolysis method: warp H ₂ SO ₄ Hydrolysis of HCl yields N-acetamido glucose. Although the method has the advantages of rich raw materials, high yield and the like, the method has more problems in the aspects of environmental protection, product safety and the like, such as complex pretreatment of raw materials, severe reaction conditions and difficult treatment of acid-base waste, and the obtained GlcNAc is not suitable for shellfish allergy, people strictly following the Uygur eating habits and the like. The microbial fermentation method mainly utilizes engineering escherichia coli and bacillus subtilis to produce N-acetylglucosamine by taking glucose as a substrate through in-vivo metabolism through genetic engineering modification, but endotoxin existing in the escherichia coli makes the product have potential safety hazard.

The gluconobacter oxydans can efficiently utilize glucose, has higher enzyme activity per unit biomass, does not generate endotoxin, has the safety grade of 1, and is widely applied to industrial production. Glucose metabolism pathways exist in the body of the gluconobacter oxydans, but N-acetylglucosamine cannot be directly obtained, so that the gluconobacter oxydans needs to be modified to construct an N-acetylglucosamine production pathway.

Disclosure of Invention

The invention aims to provide a construction method of a strain for producing N-acetylglucosamine, which is used for obtaining a safe strain for producing N-acetylglucosamine.

The invention also aims at providing a construction method of the recombinant plasmid containing the metabolic genes.

The third object of the invention is also to provide the application of the plasmid in genetic engineering of N-acetylglucosamine-producing bacteria.

According to the invention, an N-acetylglucosamine production pathway is constructed in the gluconobacter oxydans, firstly, a bypass gene mGDH in the glucose metabolism pathway is knocked out, a T7 promoter system with high-efficiency expression is introduced, and Glms and GNA1 genes are integrated on the genome of the gluconobacter oxydans through joint transfer, so that the gluconobacter oxydans GlmsGNA1 for producing the N-acetylglucosamine is obtained.

The technical scheme adopted by the invention is as follows:

gluconobacter oxydans (Gluconobacter oxydans) GlmsGNA1 for producing N-acetylglucosamine is preserved in China general microbiological culture Collection center (CGMCC) No.23399, a preservation date 2021.09.26 and a preservation address of Beijing Chaoyang area North Chen West Lu No.1 and 3.

The invention takes Gluconobacter oxydans (preferably CGMCC 1.565) as chassis strain, knocks out membrane-bound glucose dehydrogenase mGDH gene, uses T7 promoter to control and express transaminase gene Glms gene and acetyl transferase gene GNA1 gene, the nucleotide sequence of the membrane-bound glucose dehydrogenase mGDH gene is shown as SEQ ID NO.1, the nucleotide sequence of the Glms gene is shown as SEQ ID NO.2, the nucleotide sequence of the GNA1 gene is shown as SEQ ID NO.3, and the nucleotide sequence of T7 promoter RNA Poly gene is shown as SEQ ID NO. 4.

Further, the construction method of the gluconobacter oxydans for producing the N-acetylglucosamine comprises the following steps: taking Gluconobacter oxydans as an initial strain, knocking out mGDH genes, transferring genes Glms and GNA1 and a promoter T7, and specifically comprising the following steps:

(1) According to the membrane-bound glucose dehydrogenase mGDH gene shown in SEQ ID NO.1, obtaining 800bp homologous arm gene fragments on the left and right sides of the gene, cloning the gene fragments on a vector pOJ260, and obtaining a recombinant plasmid of pOJ260 delta mGDH;

(2) Transferring the recombinant plasmid of pOJ260 delta mGDH into Gluconobacter oxydans by a conjugation transfer method, screening to obtain a zygote, carrying out second homologous recombination by no anti-transmission, and screening to obtain a recombinant strain Gluconobacter oxydans delta mGDH of Gluconobacter oxydans with mGDH gene knocked out;

(3) Cloning the T7 RNA Poly gene on a recombinant plasmid pOJ260 delta mGDH to obtain a recombinant plasmid pOJ260 delta mGDH-T7 containing a T7 promoter;

(4) Cloning transaminase genes Glms and acetyl transferase genes GNA1 on a recombinant plasmid pOJ260 delta mGDH-T7 to obtain a recombinant plasmid pOJ260 delta mGDH-T7-Glms-GNA1 containing Glms and GNA1 genes;

(5) Transferring the recombinant plasmid pOJ260 delta mGDH-T7-Glms-GNA1 in the step (4) into the Gluconobacter oxydans Gluconobacter oxydans delta mGDH in the step (2) by a conjugal transfer method, and screening to obtain the Gluconobacter oxydans GlmsGNA1.

The invention also provides an application of the Gluconobacter oxydans GlmsGNA1 in fermentation production of N-acetylglucosamine.

Specifically, the application method comprises the following steps: streaking a Gluconobacter oxydans GlmsGNA1 strain onto a sorbitol solid culture medium flat plate containing 50 mug/mL of cefoxitin Ding Hean pristinamycin, culturing at 30 ℃ for 30 hours, picking single colonies, inoculating into a sorbitol liquid culture medium containing 50 mug/mL of cefoxitin Ding Hean pristinamycin, culturing at 30 ℃ for 18 hours, then inoculating into a fermentation culture medium containing 50 mug/mL of cefoxitin Ding Hean pristinamycin according to 10% of the inoculum size, adding IPTG (isopropyl-beta-D-thiogalactopyranoside) with a final concentration of 0.2mM when shaking culture is carried out at 220rpm at 30 ℃ until OD600 = 0.7, culturing at 30 ℃ for 24 hours, obtaining a fermentation liquid containing N-acetylglucosamine, and separating and purifying to obtain N-acetylglucosamine;

sorbitol liquid medium composition: 20g/L sorbitol, 3g/L yeast powder, 10g/L peptone, 1g/L K ₂ HPO ₄ ，0.2g/L MgSO ₄ The solvent is deionized water; the sorbitol solid culture medium is prepared by adding 20g/L agar into sorbitol liquid culture medium;

fermentation medium composition: 100mM glucose, 20g/L sorbitol, 3g/L yeast powder, 10g/L peptone, 1g/L K ₂ HPO ₄ ，0.2g/L MgSO ₄ 2g/L glutamine, and deionized water as solvent.

Further, it is preferable that the fermentation medium: weighing 20g of sorbitol, 3g of yeast powder and 10g of eggsWhite peptone, 1g K ₂ HPO ₄ ，0.2g MgSO ₄ 2g of glutamine is dissolved in 950mL of deionized water, and finally the volume is fixed to 1L, the packaging is carried out, and the sterilization is carried out for 30min at 115 ℃; 1M glucose was prepared and sterilized alone at 115℃and the final concentration at fermentation was 100mM.

The invention has the advantages that the Gluconobacter oxydans with high safety is used as chassis cells, a T7 strong promoter expression system is introduced, and a production path of N-acetylglucosamine is constructed, so that the Gluconobacter oxydans strain which can produce the N-acetylglucosamine and is cultivated by genetic engineering is obtained. Compared with the prior art, the method for producing the N-acetylglucosamine by fermenting the gluconobacter oxydans has the advantages of industrial production safety and high enzyme activity in a unit concentration range, and lays a foundation for developing safe and efficient industrial production bacteria.

Drawings

FIG. 1 is a plasmid map of recombinant plasmid pOJ 260. Delta. MGDH.

FIG. 2 is a plasmid map of recombinant plasmid pOJ 260. Delta. MGDH-T7-Glms-GNA1.

FIG. 3 is a diagram showing pOJ 260. Delta. MGDH plasmid verification. Wherein lane 1 is control group, lanes 2-12 are experimental group, and M is Marker.

FIG. 4 is a diagram of T7 RNA Poly gel electrophoresis.

FIG. 5 shows gel electrophoresis of extracted Glms gene and GNA1 gene, lanes 1-6 are Glms gene, lanes 7-9 are GNA1 gene, and M is Marker.

FIG. 6 is a schematic diagram of homologous recombination double crossover knockout mGDH gene.

FIG. 7 is a graph of Gluconobacter oxydans GlmsGNA showing a single exchange verification, lanes 1-4 showing the correct single exchange band, 5 showing the negative control Gluconobacter oxydans band, and M showing the Marker.

FIG. 8 is a graph of HPLC detection results of Gluconobacter oxydans pOJ 260.DELTA.mGDH-T7-Glms-GNA 1 fermentation broth.

Detailed Description

The technical scheme of the invention is described in detail by examples. The scope of the invention is not limited in this respect.

Example 1: construction of recombinant plasmid pOJ 260. Delta. MGDH containing mGDH gene homology arm:

(1) Primer design was performed with primer 5.0 based on the mGDH gene (GenBank: CP000009.1, nucleotide sequence shown in SEQ ID NO. 1) of membrane-bound glucose dehydrogenase in NCBI database, with the cross-line portion being the cloned homology arm sequence:

mGDH-L-S：

ACGGCCAGTGCCAAGCTTATGAGCACAACATCCCGGCCAGGGCT

mGDH-L-A：

CTTCGGACGCAGGGTTGACGCCACGGCAGGTCAGATGCTG

mGDH-R-S：

CCTGCCGTGGCGTCAACCCTGCGTCCGAAGAACCCGCTGA

mGDH-R-A：

CTAGAGTCGACCTGCAGCCCTCATTTCTGATCGGGCAGGGCGTAG

extracting total DNA of Gluconobacter oxydans (preservation number CGMCC 1.565) according to molecular cloning guidelines, using mGDH-L-S/mGDH-L-A as a primer to amplify a left 800bp homologous arm gene, using mGDH-R-S/mGDH-R-A as a primer to amplify a right 800bp homologous arm gene.

Reaction system for PCR amplification: q5 super Fidelity DNA polymerase (Q5 Hot Start High-Fidelity 2X Master Mix) 12.5. Mu.L, DNA template 1-2. Mu.L, 10mM upstream and downstream primers 1. Mu.L each, and water to 25. Mu.L;

the PCR reaction procedure was: predenaturation at 98 ℃ for 30s, cycling procedure: denaturation at 98 ℃ for 5-10 s, annealing temperature 62-65 ℃, annealing time 10-30 s, extension time at 72 ℃ for 20-30 s/kb, cycle number for 30-35 times, extension procedure: fully extending at 72 ℃ for 2min, cooling procedure: the system was cooled and maintained at 4 ℃.

(2) The pOJ260 plasmid was extracted from E.coli DH 5. Alpha. Strain using a SanPerp column type plasmid DNA miniprep kit according to the kit instructions. The resulting plasmid DNA solution was stored at-20℃or used for subsequent experiments.

The plasmid pOJ260 was digested with restriction enzymes HindIII and BamHI, subjected to DNA agarose gel electrophoresis after digestion, and recovered from the digested plasmid pOJ260 by using a SanPerp column type DNA gel recovery kit according to the procedure described in the specification, and stored at-20℃or used in the subsequent experiments.

(3) And (3) recombining the homologous arm genes at the left side and the homologous arm genes at the right side in the step (1) with the pOJ260 plasmid after enzyme digestion and recovery by adopting a recombination kit to obtain a cloning recombination product. The recombinant plasmid pOJ260 delta mGDH containing the homologous arm on the left side and the homologous arm on the right side of the mGDH gene is prepared, the plasmid map is shown in figure 1, mGDH-L is the left arm of the membrane-bound glucose dehydrogenase, and mGDH-R is the right arm of the membrane-bound glucose dehydrogenase. The recombinant plasmid pOJ260 delta mGDH has the size of 5078bp and An Pula resistance gene, and can be screened in escherichia coli and gluconobacter oxydans.

The recombination kit is Trelief ^TM SoSoo Cloning Kit Ver.2, 10. Mu.l reaction system: 0.03pmol of carrier, 0.03-0.3pmol of fragment, 5 mu L of sososooII, the residual volume is complemented by distilled water, and the recombination reaction condition is 50 ℃ for 0.5-1h.

(4) Coli ET12567 (pUZ 8002) competent cells 100. Mu.L in a 1.5mL EP tube was taken, 10. Mu.L of the recombinant plasmid pOJ 260. DELTA. MGDH of step (3) above was added, gently swirled to mix the contents, and placed in ice for 30min. The EP tube was placed in a circulating water bath preheated to 42℃for 90s. The EP tube was quickly transferred to a water bath and the cells were allowed to cool for 1-2min. 800. Mu.l of LB medium preheated at 37℃was added to each tube, followed by transfer to a 37℃water bath for 45min, to obtain a culture broth. The appropriate volume of transformed competent cells was transferred to LB solid medium containing 50. Mu.g/mL An Pula resistance, and colonies appeared after inversion culture at 37℃for 12-16 h. The colony is picked up to extract plasmid DNA for enzyme digestion verification, and the successful colony is taken for preservation and sequencing verification, so that the escherichia coli ET12567 containing the recombinant plasmid pOJ260 delta mGDH is obtained and is marked as escherichia coli ET12567 (pOJ 260 delta mGDH).

LB medium formula: 10g of tryptone, 10g of yeast extract, 10g of NaCl and 1000mL of deionized water are added to the mixture, ph 7.0. Sterilizing at 121deg.C for 30min, and culturing Escherichia coli. The solid culture medium is added with 20g/L of agar powder.

Example 2: transfer of the recombinant plasmid of example 1 into Gluconobacter oxydans by inter-genus junction:

coli ET12567 (pOJ 260. DELTA. MGDH) containing recombinant plasmid pOJ 260. DELTA. MGDH of example 1 was subjected to conjugation transfer with Gluconobacter oxydans CGMCC 1.565, and a zygote containing pOJ 260. DELTA. MGDH plasmid was obtained by screening with An Pula mycin and cefoxitin, while a vector into which empty vector pOJ260 was introduced was used as a control.

A method for indirect transfer between escherichia coli and gluconobacter oxydans:

coli ET12567 (pOJ 260. DELTA. MGDH) was inoculated into LB (50. Mu.g/mL containing kanamycin/An Pula mycin, 25. Mu.g/mL of chloramphenicol) medium and cultured overnight at 37℃in a shaker at 220 rpm. According to the volume ratio of 1:100 were transferred to fresh LB medium (50. Mu.g/mL each containing kanamycin/ampicillin, 25. Mu.g/mL each containing chloramphenicol) at a rate of ET12567 (pOJ 260. DELTA. MGDH) and incubated in a shaker at 220rpm at 37℃until an OD600 of 0.3-0.4 was reached. 1.5mL of the bacterial liquid was centrifuged at 9000g for 1min, the supernatant was discarded, and the supernatant was discarded as donor bacteria after washing twice with physiological saline.

The gluconobacter oxydans (with the preservation number of CGMCC 1.565) is streaked on a sorbitol solid culture medium flat plate containing cefoxitin 50 mug/mL, cultured for 30 hours at the temperature of 30 ℃, bacterial colonies are picked up and inoculated into a 5mL test tube containing cefoxitin Ding Kang sex sorbitol liquid culture medium of 50 mug/mL, and shake culture is carried out at the temperature of 30 ℃ until the OD600 reaches 0.4-0.6. 1.5mL of the culture medium was centrifuged at 9000g for 1min, the supernatant was discarded, and the supernatant was discarded after washing twice with physiological saline as the recipient strain.

1.5mL of the donor strain obtained from the bacterial solution and 1.5mL of the acceptor strain obtained from the culture solution are added into 500 mu L of sorbitol liquid culture medium to suspend, and then transferred to sorbitol solid culture medium without antibiotics, evenly coated and cultured overnight at 30 ℃. The overnight cultured conjugal transfer bacteria were washed from sorbitol solid medium plates with sterile double distilled water, spread on sorbitol solid medium plates containing cefoxitin Ding Hean placomycin resistance of 50. Mu.g/mL each, cultured at 30℃for 2-3 days, and the conjugants were screened and verified to give a single exchange product. The screened zygote is inoculated on a sorbitol solid culture medium plate without resistance for passage, strains which do not grow on the sorbitol solid culture medium plate with the resistance of An Pula to the mildew of 50 mug/mL are screened after 3-5 passages, verification is carried out, and the strains which are knocked out successfully are obtained and marked as Gluconobacter oxydans delta mGDH.

Sorbitol liquid medium formula:

weighing 20g of sorbitol, 3g of yeast powder, 10g of peptone, 1g K ₂ HPO ₄ ，0.2g MgSO ₄ Dissolving in 950mL deionized water, fixing volume to 1L, and packaging for later use, wherein the solid culture medium is prepared by adding 20g/L agar powder into liquid culture medium. Sterilizing at 115 deg.C for 30min. Is used for culturing Gluconobacter oxydans.

The knockdown strain was verified using polymerase chain reaction, and the verification primers were as follows:

and (3) checking-S: TCCCGGCCAGGGCTCTGG

Test-a: TGATCGGGCAGGGCGTAG

Extracting total DNA of Gluconobacter oxydans delta mGDH strain as template by using test-S and test-A as primer to make polymerase chain reaction, reaction system: q5Hot Start High-Fidelity 2X Master Mix 12.5. Mu.L, DNA template 1-2. Mu.L, 10mM upstream and downstream primer 1. Mu.L each, and water to 25. Mu.L; the experimental group is Gluconobacter oxydans delta mGDH strain, and the control group is Gluconobacter oxydans CGMCC 1.565. The PCR products were subjected to gel electrophoresis and the results are shown in FIG. 3.

FIG. 3 is a diagram of knockdown strain verification. Wherein lane 1 is a control group, lanes 2-12 are experimental groups (lanes 2-12 are parallel experimental groups, wherein 7-12 are no bands due to template extraction and temperature gradient differences, which are normal conditions), and M is Marker.

As can be seen in FIG. 3, the wild-type band length of lane 1 is about 3000bp, whereas the knockdown bands of lanes 2-6 are about 2000 bp, and the gene fragment knocked down in the experiment is about 800bp, so that FIG. 3 can prove that the gene knockdown was successful, and the subsequent gene sequencing also proves that the knockdown was successful again.

Example 3: construction of recombinant plasmid pOJ260 delta mGDH-T7-Glms-GNA1 containing Glms and GNA1 genes

(1) Glms gene

Primer design was performed using primer 5.0 according to the Glms gene (GenBank: CP 082129.1), with the horizontal line portion being the cloned homology arm sequence:

Glms-S：

GGACAGCAAATGGGTCGCATGTGTGGAATTGTTGGCGCGATCG

Glms-A：

ATTATTTCTAGAATTACTCAACCGTAACCGATTTTGCCAGG

the total DNA of the escherichia coli BL21 (DE 3) is extracted by adopting an Ezup column type bacterial genome DNA extraction kit of a biological engineering company as a template, and a gene Glms (the nucleotide sequence is shown as SEQ ID NO. 2) is obtained by PCR polymerase chain reaction amplification through primers Glms-S and Glms-A.

Reaction system for PCR amplification: q5Hot Start High-Fidelity 2X Master Mix 12.5. Mu.L, DNA template 1-2. Mu.L, 10mM upstream and downstream primer 1. Mu.L each, and water to 25. Mu.L;

the reaction procedure for PCR amplification was: predenaturation at 98 ℃ for 30s, cycling procedure: denaturation at 98 ℃ for 5-10 s, annealing temperature 62-65 ℃, annealing time 10-30 s, extension time at 72 ℃ for 20-30 s/kb, cycle number for 30-35 times, extension procedure: fully extending at 72 ℃ for 2min, cooling procedure: the system was cooled and maintained at 4 ℃.

The PCR products were subjected to electrophoresis, and the results are shown in FIG. 5.

(2) GNA1 gene

According to the GNA1 gene (Sequence ID: NP 116637.1), primers GNA1-S and GNA1-A are designed, the horizontal line part is a cloned homologous arm Sequence, a vector pET28a (synthesized by Kirschner biosystems) containing the GNA1 gene is used as a template, and PCR amplification is carried out through the primers GNA1-S and GNA1-A to obtain a gene GNA1 (the nucleotide Sequence of which is shown as SEQ ID NO. 3):

GNA1-S：GTTACGGTTGAGTAATTCTAGAAATAATTTTGTTTAACTT

GNA1-A：CGGAGCTCGAATTCGGATCCCTATTTGCGAATCTGCATTTCCACG

the PCR amplification system and the reaction procedure are the same as in step (1).

The PCR products were electrophoretically detected, and the results are shown in FIG. 5, lanes 1-6 are Glms genes, and lanes 7-9 are GNA1 genes.

(3) Insertion of T7 promoter into pOJ 260. Delta. MGDH

T7-S and T7-A are used as primers, total DNA of E.coli BL21 is used as a template, and a target gene T7 RNA Poly is obtained through polymerase chain reaction, and the nucleotide sequence is shown as SEQ ID NO. 4.

T7-S：ACCTGCCGTGGCGTCATTTGCCTGGTTTCCGGCACCAGAAG

T7-A：TATGACATGATTACGAATTCGAGTTGGTGATTTATGCGAAATGA

The PCR products were subjected to electrophoresis, and the results are shown in FIG. 4.

The obtained T7 RNA Poly gene fragment and pOJ260 delta mGDH (wherein the right arm of mGDH is excised) fragment recovered by cleavage with PstI and EcoRI are subjected to cloning recombination reaction to obtain recombinant plasmid pOJ260 delta mGDH-T7.

The recombination kit is Trelief ^TM SoSoo Cloning Kit Ver.2, reaction system: 0.03pmol of carrier, 0.03-0.3pmol of fragment, 5 mu L of sososooII, the residual volume is complemented by distilled water, and the recombination reaction condition is 50 ℃ for 0.5-1h.

(4) Recombinant plasmid pOJ260 delta mGDH-T7-Glms-GNA1

Cloning and recombining the Glms gene obtained in the step (1), the GNA1 gene fragment obtained in the step (2) and the pOJ260 delta mGDH-T7 fragment recovered by EcoRI digestion, and recombining a reaction system: the recombination kit is Trelief ^TM SoSoo Cloning Kit Ver.2, reaction system: 0.03pmol of carrier, 0.03-0.3pmol of fragment, 5 mu L of sososooII, the residual volume is complemented by distilled water, and the recombination reaction condition is 50 ℃ for 0.5-1h.

The recombinant plasmid pOJ260 delta mGDH-T7-Glms-GNA1 was obtained. The plasmid map is shown in FIG. 2, the size of the recombinant plasmid pOJ260 delta mGDH-T7-Glms-GNA1 is 10162bp, the recombinant plasmid has An Pula resistance genes, the recombinant plasmid can be screened in escherichia coli and gluconobacter oxydans, mGDH-L is a homologous arm gene, T7 RNA poly is a T7 RNA polymerase gene, T7 primer is a T7 promoter region, T7 terminator is a T7 terminator region, glms is a transaminase gene, and GNA1 is an acetyl transferase gene.

100. Mu.L of competent cells of E.coli ET12567 (pUZ 8002) was taken, added with the above recombinant plasmid pOJ 260. Delta. MGDH-T7-Glms-GNA1, gently swirled to mix the contents, and placed in ice for 30min. The tube was placed in a circulating water bath preheated to 42℃for 90s. The tube was quickly transferred to a water bath and the cells were allowed to cool for 1-2min. 800. Mu.l of LB medium preheated at 37℃was added to each tube, followed by transfer to a 37℃water bath for 45min, to obtain a culture broth. The appropriate volume of transformed competent cells was transferred to LB solid medium containing 50. Mu.g/mL An Pula resistance, and colonies appeared after inversion culture at 37℃for 12-16 h. The colony is picked up to extract plasmid DNA for polymerase chain reaction verification, and the successful colony is taken for preservation and sequencing verification, so that the escherichia coli ET12567 containing the recombinant plasmid pOJ260 delta mGDH-T7-Glms-GNA1 is obtained and is marked as escherichia coli ET12567 (pOJ 260 delta mGDH-T7-Glms-GNA 1).

Example 4: transfer of the recombinant plasmid of example 3 into Gluconobacter oxydans by inter-genus junction:

coli ET12567 constructed in example 3 and containing recombinant plasmid pOJ 260. DELTA. MGDH-T7-Glms-GNA1 was subjected to conjugation transfer with strain Gluconobacter oxydans. DELTA. MGDH in example 2 by the method of example 2, and a Gluconobacter oxydans zygote containing pOJ 260. DELTA. MGDH-T7-Glms-GNA1 plasmid was obtained by screening with An Pula of the antibiotic and cefoxitin, and designated as Gluconobacter oxydans (Gluconobacter oxydans) GlmsGNA1, and the genotype was verified by polymerase chain reaction.

And (3) carrying out polymerase chain reaction by taking the obtained total DNA of the binder as a template by taking the primers YZ-S and YZ-A as primers, wherein the YZ-S is on a plasmid vector, and the YZ-A is on the total DNA of the gluconobacter oxydans.

YZ-S：GCAAGCAGCAGATTACGCGCAGAAA

YZ-A：GACGACCTTGTTGGTCTTCAGGTC

Under the same conditions, the gluconobacter oxydans CGMCC 1.565 is used as a negative control, and the electrophoresis chart of the PCR reaction product is shown in figure 7.

FIG. 7 is a graph of Gluconobacter oxydans GlmsGNA showing a single exchange verification, lanes 1-4 showing the correct single exchange band, 5 showing the wild-type control band of Gluconobacter oxydans, and M showing the Marker.

Example 5: gluconobacter oxydans (Gluconobacter oxydans) GlmsGNA1 fermentation Process in example 4:

the Gluconobacter oxydans GlmsGNA1 strain constructed in example 4 was streaked onto a sorbitol solid medium plate containing 50. Mu.g/mL of each of cefazelastin Ding Hean, cultured at 30℃for 30 hours, single colonies were picked up and inoculated into 5mL tubes of liquid sorbitol liquid medium (50. Mu.g/mL of each of cefazelastin Ding Hean) for 18 hours, then inoculated into 250mL shake flasks containing 50. Mu.g/mL of each of cefazelastin Ding Hean in an inoculum size of 10% by volume, 40. Mu.L of 1M IPTG was added when shaking (220 rpm/min) was carried out until OD600 = 0.7, sampled after 24 hours of culture at 30℃and centrifuged at 12000rpm for 10 minutes, and the N-acetylglucosamine content was measured by HPLC after passing through a 0.22 μm filter membrane.

Fermentation medium: weighing 20g of sorbitol, 3g of yeast powder, 10g of peptone, 1g K ₂ HPO ₄ ，0.2g MgSO ₄ 2g of glutamine is dissolved in 950mL of deionized water, finally the volume is fixed to 1L, the packaging is carried out, and the sterilization is carried out for 30min at 115 ℃. 1M glucose was prepared and sterilized alone at 115℃and the final concentration at fermentation was 100mM.

Chromatographic conditions: detection was performed using a Shimadzu LC-2030 high performance liquid chromatograph under the following liquid conditions: chromatographic column: xtime Suger-H (7.8X300 mm,8 μm); column temperature: 40 ℃; mobile phase: 5mm H ₂ SO ₄ The method comprises the steps of carrying out a first treatment on the surface of the Flow rate: 0.6mL/min; detection wavelength: 198nm; sample injection amount: 10 mu L. As a result, as shown in FIG. 8, G oxydans GlmsGNA in FIG. 8 represents a fermentation broth sample fermented by the strain, and G oxydans refers to an untreated fermentation broth sample fermented by Gluconobacter oxydans, and the standard is N-acetylglucosamine. As can be seen from FIG. 8, N-acetylglucosamine product was produced from the fermented product of the G oxydans GlmsGNA strain 1. Compared with the prior art, the production of the N-acetylglucosamine by the fermentation of the gluconobacter oxydans has the safety of industrial production and high enzyme activity in a unit concentration range.

Sequence listing

<110> Zhejiang university of industry

<120> an N-acetylglucosamine-producing strain and use thereof

<140> 2021112112205

<141> 2021-10-18

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2427

<212> DNA

<213> Gluconobacter oxydans (Gluconobacter oxydans)

<400> 1

atgagcacaa catcccggcc agggctctgg gccctgatta cggccgcggt attcgcgctt 60

tgcggcgcga tccttaccgt tggcggcgca tgggtcgctg ccatcggcgg ccctctctat 120

tatgtcatcc ttggcctggc acttctcgcc acggctttcc tctcattcag gcgcaacccg 180

gctgccctct acctgttcgc agtcgtcgtc ttcggaacgg tcatctggga actcaccgtt 240

gtcggtctcg acatctgggc cctgatcccg cgctcggaca tcgtcatcat cctcggcatc 300

tggctgctgt tgccgttcgt ctcccgccag atcggcggca cgcggacgac cgtcctgccg 360

ctcgccggtg ccgttggcgt tgcggttctg gcgctgttcg ccagcctctt caccgacccg 420

catgacatca gtggcgacct gccgacgcag atcgcaaacg cctcccccgc cgacccggac 480

aacgtcccgg ccagcgagtg gcacgcctat ggtcgtacgc aggccggtga ccgctggtcc 540

ccgctgaacc agatcaacgc gtccaacgtc agcaacctca aggtcgcatg gcatatccac 600

accaaggata tgatgaactc caacgacccg ggcgaagcga cgaacgaagc gaccccgatc 660

gagttcaaca acacgcttta tatgtgctcg ctgcaccaga agctgtttgc ggttgatggt 720

gccaccggta acgtcaagtg ggtctacgat ccgaagctcc agatcaaccc tggcttccag 780

catctgacct gccgtggcgt cagcttccac gaaacgccgg ccaatgccac ggattccgat 840

ggcaatcctg ctccgacgga ctgcgccaag cgcatcatcc tgccggtcaa tgatggccgt 900

ctggttgaag tcgatgccga cacgggcaag acctgctccg gcttcggcaa caatggcgag 960

atcgatctgc gcgttccgaa ccagccttac acgacgcccg gccagtacga gccgacgtcc 1020

ccgccggtca tcacggacaa gctgatcatc gccaacagcg ccatcaccga taacggttcg 1080

gtcaagcagg cttcgggcgc cacgcaggca ttcgacgtct acaccggcaa gcgtgtctgg 1140

gtgttcgatg cgtccaaccc ggacccgaac cagcttccgg atgacagcca ccctgtcttc 1200

cacccgaact ccccgaactc ctggatcgtg tcgtcttacg acaggaacct gaacctcgtg 1260

tacatcccga tgggcgtggg tactcccgat cagtggggcg gtgaccgcac gaaggattcc 1320

gagcgtttcg ctccgggtat cgttgctctg aacgcagaca cgggcaagct cgcctggttc 1380

taccagaccg ttcatcacga tctgtgggac atggacgttc cgtcacagcc gagcctcgtg 1440

gacgtaacgc agaaggacgg cacgcttgtt ccggccatct acgctccgac caagaccggc 1500

gacatcttcg tcctcgaccg tcgtaccggc aaggaaatcg tcccggctcc ggaaaccccg 1560

gttccccagg gcgccgctcc gggcgatcac accagcccga cccagccgat gtcgcagctg 1620

accctgcgtc cgaagaaccc gctgaacgac tccgatatct ggggcggcac gatcttcgac 1680

cagatgttct gcagcatcta tttccacacc ctgcgctacg aaggcccctt cacgccgccg 1740

tcgctcaagg gctcgctcat cttcccgggc gatctgggaa tgttcgagtg gggtggtctg 1800

gccgtcgatc cgcagcgtca ggtggctttc gccaacccga tctccctgcc gttcgtctcc 1860

cagcttgttc cccgtggacc gggcaacccg ctctggcctg aaaaggacgc caagggtacg 1920

ggtggtgaaa ccggcctgca gcacaactat ggcattccgt atgccgtcaa cctgcatccg 1980

ttcctggatc cggtgctgct gccgttcggc atcaagatgc cctgccgtac gccgccctgg 2040

ggctatgtcg ccggtattga cctgaagacc aacaaggtcg tctggcagca ccgcaacggc 2100

accctgcgtg actcgatgta tggcagctcc ctgccgatcc cgctgccgcc gatcaagatc 2160

ggtgtcccga gcctcggtgg cccgctctcc acggctggca acctcggctt cctgacggcg 2220

tccatggatt actacatccg tgcgtacaac ctgacgacgg gcaaggtgct gtggcaggac 2280

cgtctgccgg ctggcgccca ggcaacgccg atcacctatg ccatcaacgg caagcagtac 2340

atcgtgacct atgcaggcgg acacaactcg ttcccgaccc gcatgggcga cgacatcatc 2400

gcctacgccc tgcccgatca gaaatga 2427

<210> 2

<211> 1830

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 2

atgtgtggaa ttgttggcgc gatcgcgcaa cgtgatgtag cagaaatcct tcttgaaggt 60

ttacgtcgtc tggaataccg cggatatgac tctgccggtc tggccgttgt tgatgcagaa 120

ggtcatatga cccgcctgcg tcgcctcggt aaagtccaga tgctggcaca ggcagcggaa 180

gaacatcctc tgcatggcgg cactggtatt gctcacactc gctgggcgac ccacggtgaa 240

ccttcagaag tgaatgcgca tccgcatgtt tctgaacaca ttgtggtggt gcataacggc 300

atcatcgaaa accatgaacc gctgcgtgaa gagctaaaag cgcgtggcta taccttcgtt 360

tctgaaaccg acaccgaagt gattgcccat ctggtgaact gggagctgaa acaaggcggg 420

actctgcgtg aggccgttct gcgtgctatc ccgcagctgc gtggtgcgta cggtacagtg 480

atcatggact cccgtcaccc ggataccctg ctggcggcac gttctggtag tccgctggtg 540

attggcctgg ggatgggcga aaactttatc gcttctgacc agctggcgct gttgccggtg 600

acccgtcgct ttatcttcct tgaagagggc gatattgcgg aaatcactcg ccgttcggta 660

aacatcttcg ataaaactgg cgcggaagta aaacgtcagg atatcgaatc caatctgcaa 720

tatgacgcgg gcgataaagg catttaccgt cactacatgc agaaagagat ctacgaacag 780

ccgaacgcga tcaaaaacac ccttaccgga cgcatcagcc acggtcaggt tgatttaagc 840

gagctgggac cgaacgccga cgaactgctg tcgaaggttg agcatattca gatcctcgcc 900

tgtggtactt cttataactc cggtatggtt tcccgctact ggtttgaatc gctagcaggt 960

attccgtgcg acgtcgaaat cgcctctgaa ttccgctatc gcaaatctgc cgtgcgtcgt 1020

aacagcctga tgatcacctt gtcacagtct ggcgaaaccg cggataccct ggctggcctg 1080

cgtctgtcga aagagctggg ttaccttggt tcactggcaa tctgtaacgt tccgggttct 1140

tctctggtgc gcgaatccga tctggcgcta atgaccaacg cgggtacaga aatcggcgtg 1200

gcatccacta aagcattcac cactcagtta actgtgctgt tgatgctggt ggcgaagctg 1260

tctcgcctga aaggtctgga tgcctccatt gaacatgaca tcgtgcatgg tctgcaggcg 1320

ctgccgagcc gtattgagca gatgctgtct caggacaaac gcattgaagc gctggcagaa 1380

gatttctctg acaaacatca cgcgctgttc ctgggccgtg gcgatcagta cccaatcgcg 1440

ctggaaggcg cattgaagtt gaaagagatc tcttacattc acgctgaagc ctacgctgct 1500

ggcgaactga aacacggtcc gctggcgcta attgatgccg atatgccggt tattgttgtt 1560

gcaccgaaca acgaattgct ggaaaaactg aaatccaaca ttgaagaagt tcgcgcgcgt 1620

ggcggtcagt tgtatgtctt cgccgatcag gatgcgggtt ttgtaagtag cgataacatg 1680

cacatcatcg agatgccgca tgtggaagag gtgattgcac cgatcttcta caccgttccg 1740

ctgcagctgc tggcttacca tgtcgcgctg atcaaaggca ccgacgttga ccagccgcgt 1800

aacctggcaa aatcggttac ggttgagtaa 1830

<210> 3

<211> 480

<212> DNA

<213> Unknown (Unknown)

<400> 3

atgagcctgc cggatggctt ttatattcgc cgcatggaag aaggcgatct ggaacaggtg 60

accgaaaccc tgaaagtgct gaccaccgtg ggcaccatta ccccggagag ctttagcaaa 120

ctgattaaat attggaacga agcgaccgtg tggaacgata acgaagataa aaaaattatg 180

cagtataacc cgatggtgat tgtggataaa cgcaccgaaa ccgtggcggc gaccggcaac 240

attattattg aacgcaaaat tattcatgaa ctgggcctgt gcggccatat tgaagatatt 300

gcggtgaaca gcaaatatca gggccagggc ctgggcaaac tgctgattga tcagctggtg 360

accattggct ttgattatgg ctgctataaa attattctgg attgcgatga aaaaaacgtg 420

aaattttatg aaaaatgcgg ctttagcaac gcgggcgtgg aaatgcagat tcgcaaatag 480

<210> 4

<211> 3249

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 4

tttgcctggt ttccggcacc agaagcggtg ccggaaagct ggctggagtg cgatcttcct 60

gaggccgata ctgtcgtcgt cccctcaaac tggcagatgc acggttacga tgcgcccatc 120

tacaccaacg tgacctatcc cattacggtc aatccgccgt ttgttcccac ggagaatccg 180

acgggttgtt actcgctcac atttaatgtt gatgaaagct ggctacagga aggccagacg 240

cgaattattt ttgatggcgt cgggatctga tccggattta ctaactggaa gaggcactaa 300

atgaacacga ttaacatcgc taagaacgac ttctctgaca tcgaactggc tgctatcccg 360

ttcaacactc tggctgacca ttacggtgag cgtttagctc gcgaacagtt ggcccttgag 420

catgagtctt acgagatggg tgaagcacgc ttccgcaaga tgtttgagcg tcaacttaaa 480

gctggtgagg ttgcggataa cgctgccgcc aagcctctca tcactaccct actccctaag 540

atgattgcac gcatcaacga ctggtttgag gaagtgaaag ctaagcgcgg caagcgcccg 600

acagccttcc agttcctgca agaaatcaag ccggaagccg tagcgtacat caccattaag 660

accactctgg cttgcctaac cagtgctgac aatacaaccg ttcaggctgt agcaagcgca 720

atcggtcggg ccattgagga cgaggctcgc ttcggtcgta tccgtgacct tgaagctaag 780

cacttcaaga aaaacgttga ggaacaactc aacaagcgcg tagggcacgt ctacaagaaa 840

gcatttatgc aagttgtcga ggctgacatg ctctctaagg gtctactcgg tggcgaggcg 900

tggtcttcgt ggcataagga agactctatt catgtaggag tacgctgcat cgagatgctc 960

attgagtcaa ccggaatggt tagcttacac cgccaaaatg ctggcgtagt aggtcaagac 1020

tctgagacta tcgaactcgc acctgaatac gctgaggcta tcgcaacccg tgcaggtgcg 1080

ctggctggca tctctccgat gttccaacct tgcgtagttc ctcctaagcc gtggactggc 1140

attactggtg gtggctattg ggctaacggt cgtcgtcctc tggcgctggt gcgtactcac 1200

agtaagaaag cactgatgcg ctacgaagac gtttacatgc ctgaggtgta caaagcgatt 1260

aacattgcgc aaaacaccgc atggaaaatc aacaagaaag tcctagcggt cgccaacgta 1320

atcaccaagt ggaagcattg tccggtcgag gacatccctg cgattgagcg tgaagaactc 1380

ccgatgaaac cggaagacat cgacatgaat cctgaggctc tcaccgcgtg gaaacgtgct 1440

gccgctgctg tgtaccgcaa ggacaaggct cgcaagtctc gccgtatcag ccttgagttc 1500

atgcttgagc aagccaataa gtttgctaac cataaggcca tctggttccc ttacaacatg 1560

gactggcgcg gtcgtgttta cgctgtgtca atgttcaacc cgcaaggtaa cgatatgacc 1620

aaaggactgc ttacgctggc gaaaggtaaa ccaatcggta aggaaggtta ctactggctg 1680

aaaatccacg gtgcaaactg tgcgggtgtc gataaggttc cgttccctga gcgcatcaag 1740

ttcattgagg aaaaccacga gaacatcatg gcttgcgcta agtctccact ggagaacact 1800

tggtgggctg agcaagattc tccgttctgc ttccttgcgt tctgctttga gtacgctggg 1860

gtacagcacc acggcctgag ctataactgc tcccttccgc tggcgtttga cgggtcttgc 1920

tctggcatcc agcacttctc cgcgatgctc cgagatgagg taggtggtcg cgcggttaac 1980

ttgcttccta gtgaaaccgt tcaggacatc tacgggattg ttgctaagaa agtcaacgag 2040

attctacaag cagacgcaat caatgggacc gataacgaag tagttaccgt gaccgatgag 2100

aacactggtg aaatctctga gaaagtcaag ctgggcacta aggcactggc tggtcaatgg 2160

ctggcttacg gtgttactcg cagtgtgact aagcgttcag tcatgacgct ggcttacggg 2220

tccaaagagt tcggcttccg tcaacaagtg ctggaagata ccattcagcc agctattgat 2280

tccggcaagg gtctgatgtt cactcagccg aatcaggctg ctggatacat ggctaagctg 2340

atttgggaat ctgtgagcgt gacggtggta gctgcggttg aagcaatgaa ctggcttaag 2400

tctgctgcta agctgctggc tgctgaggtc aaagataaga agactggaga gattcttcgc 2460

aagcgttgcg ctgtgcattg ggtaactcct gatggtttcc ctgtgtggca ggaatacaag 2520

aagcctattc agacgcgctt gaacctgatg ttcctcggtc agttccgctt acagcctacc 2580

attaacacca acaaagatag cgagattgat gcacacaaac aggagtctgg tatcgctcct 2640

aactttgtac acagccaaga cggtagccac cttcgtaaga ctgtagtgtg ggcacacgag 2700

aagtacggaa tcgaatcttt tgcactgatt cacgactcct tcggtaccat tccggctgac 2760

gctgcgaacc tgttcaaagc agtgcgcgaa actatggttg acacatatga gtcttgtgat 2820

gtactggctg atttctacga ccagttcgct gaccagttgc acgagtctca attggacaaa 2880

atgccagcac ttccggctaa aggtaacttg aacctccgtg acatcttaga gtcggacttc 2940

gcgttcgcgt aacgccaaat caatacgact ccggatcccc ttcgaaggaa agacctgatg 3000

cttttcgtgc gcgcataaaa taccttgata ctgtgccgga tgaaagcggt tcgcgacgag 3060

tagatgcaat tatggtttct ccgccaagaa tctctttgca tttatcaagt gtttccttca 3120

ttgatattcc gagagcatca atatgcaatg ctgttgggat ggcaattttt acgcctgttt 3180

tgctttgctc gacataaaga tatccatcta cgatatcaga ccacttcatt tcgcataaat 3240

caccaactc 3249

Claims

1. The construction method of the Gluconobacter oxydans GlmsGNA1 for producing N-acetylglucosamine is characterized in that the Gluconobacter oxydans GlmsGNA1 takes Gluconobacter oxydans as an initial strain, and is constructed by knocking out a membrane-bound glucose dehydrogenase mGDH gene and transferring transaminase genes Glms, acetyltransferase genes GNA1 and T7 promoter genes; the nucleotide sequence of the aminotransferase gene Glms is shown in SEQ ID NO. 2;

the nucleotide sequence of the acetyl transferase gene GNA1 is shown in SEQ ID NO. 3.

2. The method according to claim 1, characterized in that the method comprises the steps of:

(1) According to the membrane-bound glucose dehydrogenase mGDH gene shown in SEQ ID NO.1, obtaining homologous arms of 800bp gene fragments on the left and right sides of the mGDH gene, cloning the homologous arms on a vector pOJ260, and obtaining pOJ260 delta mGDH recombinant plasmid;

(2) Transferring pOJ260 delta mGDH recombinant plasmid into Gluconobacter oxydans by a conjugation transfer method, screening to obtain a zygote, carrying out second homologous recombination by no anti-transmission generation, and screening to obtain a recombinant strain Gluconobacter oxydans delta mGDH of the Gluconobacter oxydans with mGDH gene knocked out;

(3) Cloning a T7 promoter RNA Poly gene on a recombinant plasmid pOJ260 delta mGDH to obtain a recombinant plasmid pOJ260 delta mGDH-T7 containing a T7 promoter;

3. The method for constructing Gluconobacter oxydans GlmsGNA1 according to claim 1, wherein:

the nucleotide sequence of the T7 promoter gene is shown as SEQ ID NO. 4.

4. A bacillus gluconate oxide GlmsGNA1 constructed by the method of any one of claims 1-3.

5. Use of the gluconobacter oxydans GlmsGNA1 of claim 4 for the fermentative production of N-acetylglucosamine.

6. The application according to claim 5, wherein the method of application is: streaking a Gluconobacter oxydans GlmsGNA1 strain onto a sorbitol solid culture medium flat plate containing 50 mug/mL of cefoxitin Ding Hean pristinamycin, culturing at 30 ℃ for 30 hours, picking single bacterial colony, inoculating into a sorbitol liquid culture medium containing 50 mug/mL of cefoxitin Ding Hean pristinamycin, culturing at 30 ℃ for 18 hours, inoculating into a fermentation culture medium containing 50 mug/mL of cefoxitin Ding Hean pristinamycin according to 10% of the inoculum size, adding IPTG with the final concentration of 0.2mM when shaking and culturing at 220rpm until OD600 = 0.7, culturing at 30 ℃ for 24 hours, obtaining a fermentation liquid containing N-acetylglucosamine, and separating and purifying to obtain N-acetylglucosamine;

sorbitol liquid medium composition: 20g/L sorbitol, 3g/L yeast powder, 10g/L peptone, 1g/LK ₂ HPO ₄ ，0.2g/LMgSO ₄ The solvent is deionized water; sorbitol solid mediumIs prepared by adding 20g/L agar into sorbitol liquid culture medium;

fermentation medium composition: 100mM glucose, 20g/L sorbitol, 3g/L yeast powder, 10g/L peptone, 1g/L K ₂ HPO ₄ ，0.2g/LMgSO ₄ 2g/L glutamine, and deionized water as solvent.