CN117660277A

CN117660277A - Metabolic engineering modified escherichia coli and application thereof in fermentation preparation of salidroside

Info

Publication number: CN117660277A
Application number: CN202311560803.8A
Authority: CN
Inventors: 柳志强; 赵嫚; 刘科端; 郑裕国
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2023-11-22
Filing date: 2023-11-22
Publication date: 2024-03-08

Abstract

The invention discloses a metabolic engineering modified escherichia coli and application thereof in preparing salidroside by fermentation, wherein escherichia coli WTY8 is taken as a chassis cell, and a tyrosol-producing escherichia coli WY5 strain is obtained by metabolic modification. The WSA1 strain is obtained by expressing an aromatic aldehyde synthase gene derived from carvacrol and a glycosyltransferase gene derived from Arabidopsis thaliana in the WY5 strain, so that the salidroside can be synthesized from the head by taking glucose as a substrate in escherichia coli, the cost is low, and the industrial production is facilitated.

Description

Metabolic engineering modified escherichia coli and application thereof in fermentation preparation of salidroside

Technical Field

The invention relates to a method for preparing salidroside by fermenting metabolic engineering escherichia coli, belonging to the technical field of biology.

Background

Salidroside (Salidroside) has chemical structural formula of tyrosol 8-O-beta-D-glucoside (C) ₁₄ H ₂₀ O ₇ ) Is prepared from Tyrosol (4-hydroxy phenethyl alcohol, tyrosol, C ₈ H ₁₀ O ₂ ) Is the alcoholic hydroxyl group of aglycone and uridine diphosphate glucose (Uridine diphosphateglucose, UDP-glucose, C) ₁₅ H ₂₄ N ₂ O ₁₇ P ₂ ) Glycoside formed after dehydration of hemiacetal hydroxyl group. The salidroside has rich pharmacological actions and important application values of resisting radiation, resisting tumors, enhancing physical endurance, improving immunity, improving memory and the like. Originally, people rely on wild rhodiola plants to extract salidroside, but the extraction yield and quality are difficult to meet the market demand; later, the techniques of tissue culture, cell suspension culture and the like are utilized to overcome the defects of wild resources, and the problems of long production period, low yield and the like can still exist; the microorganism method for synthesizing the salidroside has the characteristics of short period, easy regulation and control and the like.

Disclosure of Invention

The invention aims to provide a genetically engineered bacterium capable of producing salidroside, which is obtained by obtaining a high-yield tyrosol strain through metabolic modification and recombining exogenous genes based on the strain. The genetically engineered bacterium can produce salidroside.

The first object of the invention is to provide a recombinant escherichia coli for producing tyrosol, which takes patent ' in metabolic engineering of escherichia coli and application of the recombinant escherichia coli in preparation of tyrosol by fermentation ' CN116218752A high-yield tyrosine escherichia coli WTY8 ' as chassis bacteria, and obtains the escherichia coli WY5 strain for producing tyrosol through metabolic engineering. And then, using the escherichia coli WY5 as a host bacterium to express an aromatic aldehyde synthase (PcAAS) gene derived from celery on the recombinant plasmid pTrc99a so as to obtain the escherichia coli WAY5 strain with high tyrosol yield. Finally, taking escherichia coli WY5 as host bacteria, and inserting an expressible glycosyltransferase (UGT 85A 1) gene derived from arabidopsis thaliana into a recombinant plasmid which expresses an aromatic aldehyde synthase (PcAAS) gene derived from carvacrol, so as to obtain a salidroside production strain WSA1.

The second object of the invention is to provide a method for producing salidroside by fermenting a recombinant strain for producing salidroside. In order to achieve the above purpose, the technical scheme of the invention is as follows:

in a first aspect, the invention provides a metabolically engineered E.coli constructed according to the following method:

(1) Carrying out genetic engineering transformation on the genetic engineering bacteria WTY8 to obtain genetic engineering bacteria WY5;

the genetically engineered bacterium WTY8 is obtained by modifying escherichia coli W3110 as follows: knocking out tyrR gene, pykF gene, trpD gene and pheA gene; the promoter of galP gene, the promoter of glk gene, the promoter of ppsA gene and the promoter of tyrA gene are replaced with trc promoters, respectively; will be

Mutant tyrA gene into tyrA coding for amino acid sequence shown as SEQ ID NO. 7 ^fbr A gene;

the genetic engineering includes: knocking out ptsG gene; the promoter of the tktA gene, the promoter of the adhE gene, the promoter of the pgm gene and the promoter of the galU gene are replaced with trc promoters, respectively; inserting AR010 (phenylpyruvate decarboxylase) gene into the site of the knocked-out pykF gene and the site of the knocked-out pheA gene, respectively; replacement of aroG Gene with aroG ^fbr An expression cassette for a gene; the feaB gene, the pabA gene and the ushA gene are respectively replaced by ARO10 genes;

the aroG ^fbr The expression cassette of the gene codes an amino acid sequence shown as SEQ ID NO. 6;

(2) Inserting an aromatic aldehyde synthase gene and a glycosyltransferase gene into an expression vector to obtain a recombinant plasmid; the amino acid sequence of the aromatic aldehyde synthase gene codes is shown in SEQ ID NO:2 is shown in the figure; the amino acid sequence of the glycosyltransferase gene is shown as SEQ ID NO:4 is shown in the figure;

(3) Transferring the recombinant plasmid in the step (2) into the genetically engineered bacterium WY5 in the step (1) to obtain the metabolically engineered escherichia coli.

In the examples of the present invention, the inserted genes were derived from WTY8 genomic DNA, and were obtained from E.coli W3110. Mutating aroG gene encoding the amino acid sequence shown as SEQ ID NO. 5 into aroG encoding the amino acid sequence shown as SEQ ID NO. 6 ^fbr And (3) a gene. (i.e., mutation of the 436 th base of aroG gene from G to A (i.e., mutation of the 146 th amino acid from Asp to Asn) to obtain aroG ^fbr And (3) a gene, and connecting the gene with a trc promoter for overexpression.

Further, the genetic engineering in step (1) uses CRISPR/Cas9 technology for gene editing.

In one embodiment of the present invention, the aroG in step (1) ^fbr The promoter in the expression cassette of the gene is the trc promoter.

In one embodiment of the present invention, the nucleotide sequence of the aromatic aldehyde synthase gene in step (2) is as set forth in SEQ ID NO:1 is shown in the specification; the nucleotide sequence of the glycosyltransferase gene is shown in SEQ ID NO:3 is shown in the figure; further, the expression vector in step (2) may be a conventional vector suitable for use in E.coli expression systems in the art, and in one embodiment of the present invention is pTrc99a vector.

Specifically, the recombinant plasmid in the step (2) is constructed according to the following method:

s1, SEQ ID NO:1 is inserted between restriction enzyme cleavage sites EcoRI and Eco53 kI of the pTrc99A vector to obtain a recombinant plasmid Ptrc99A-PcAAS; setting SEQ ID NO:3 is inserted between the restriction enzyme cleavage sites Eco53 kI and SacI of the pTrc99A vector to obtain a recombinant plasmid Ptrc99A-UGT85A1;

s2: performing PCR amplification by using the recombinant plasmid Ptrc99A-PcAAS described in the step S1 as a template and using primers pTrc99A-F and pTrc99A-R to obtain a linearization vector; performing PCR (polymerase chain reaction) amplification by using the recombinant plasmid Ptrc99A-UGT85A1 in the step S1 as a template and using primers F-UGT and R-UGT to obtain a target fragment UGT85A1;

s3: and (3) carrying out one-step cloning connection on the linearization vector in the step (S2) and the target fragment UGT85A1 to obtain the recombinant plasmid.

In a second aspect, the invention also provides an application of the metabolic engineering escherichia coli in preparing salidroside by fermentation.

Can be produced in laboratory shake flasks or in factories by using fermentation tanks.

In one embodiment of the invention, the application is:

inoculating the metabolic engineering escherichia coli into an LB liquid culture medium, and culturing at 37 ℃ and 180rpm for 12 hours to obtain a first-stage seed liquid; inoculating 1% of the first-stage seed liquid into a fresh LB liquid culture medium, and culturing at 37 ℃ and 180rpm for 12 hours to obtain a second-stage seed liquid; inoculating the second stage seed solution into fermentation medium of fermenter at 10% of the volume inoculation amount, and culturing at 37deg.C under conditions of aeration ratio of 1VVM, dissolved oxygen of 40% and pH=7.0 to OD ₆₀₀ Adding IPTG with final concentration of 0.1mM to 10-11, inducing and culturing at 20deg.C for 16 hr, heating to 30deg.C, and fermenting for 100 hr to obtain fermentation broth containing salidroside.

Further, the pH at the time of the culture was controlled by feeding 5M aqueous ammonia. Furthermore, in the induction culture process, the final concentration of glucose is controlled to be 5-10g/L by feeding glucose; the glucose feed consists of the following components in final concentration: glucose 600g/L, yeast extract 50g/L.

The fermentation medium consists of the following components in final concentration: tryptone 15g/L, yeast extract 5g/L, na ₂ HPO ₄ ·12H ₂ O 15.12g/L，KH ₂ PO ₄ 3g/L，MgSO ₄ ·7H ₂ O 0.5g/L，CaCl ₂ 0.011g/L，NH ₄ Cl 1g/L, water as solvent and natural pH.

Compared with the prior art, the invention has the beneficial effects that: the invention takes the escherichia coli WTY8 as a chassis cell, and obtains the tyrosol-producing escherichia coli WY5 strain through metabolic transformation. The expression of the aromatic aldehyde synthase (PcAAS) gene from carvacrol and the glycosyltransferase (UGT 85A 1) gene from Arabidopsis thaliana in the WY5 strain realizes that salidroside can be synthesized from head by taking glucose as a substrate in escherichia coli, has low cost and is beneficial to industrialized production.

Drawings

FIG. 1 is a diagram of plasmids required in an experiment

FIG. 2 E.coli strain WAY1-WAY5 tyrosol production

FIG. 3 rhodiola rosea glycoside yield in E.coli WSA1 strain fermenter

Detailed Description

The foregoing description is only an overview of the present invention, and is presented in terms of preferred embodiments of the present invention and the following detailed description of the invention in conjunction with the accompanying drawings.

The present invention will be further described with reference to the accompanying drawings and specific examples, which are not intended to be limiting, so that those skilled in the art will better understand the invention and practice it. The following examples relate to the following media:

LB liquid medium formula: 5g/L yeast powder, 10g/L peptone, 10g/L NaCl and 1.5% -2.0% agar powder are added into the solid culture medium.

Shake flask fermentation medium: glucose 20g/L, yeast extract 2g/L, KH ₂ PO ₄ 1g/L，MgSO ₄ ·7H ₂ O 0.5g/L，(NH ₄ ) ₂ SO ₄ 16g/L，CaCO ₃ 5g/L，MnSO ₄ 0.01g/L，FeSO ₄ 0.01g/L。

Fermentation medium in a fermentation tank: tryptone 15g/L, yeast extract 5g/L, na ₂ HPO ₄ ·12H ₂ O 15.12g/L，KH ₂ PO ₄ 3g/L，MgSO ₄ ·7H ₂ O 0.5g/L，CaCl ₂ 0.011g/L，NH ₄ Cl 1g/L. Fermentation tank glucoseAnd (3) material supplementing: glucose 600g/L, yeast extract 50g/L.

The detection method of tyrosol and salidroside adopts High Performance Liquid Chromatography (HPLC) detection.

The detection conditions of the tyrosol chromatography are specifically as follows: welch C18 chromatographic column C18 column (250 mm×4.6mm,5 μm), mobile phase component is acetonitrile, methanol, water, glacial acetic acid=36:6:57.98:0.02, mixing after configuration, and removing air bubbles by ultrasound. The flow rate was set at 1mL/min, the detection wavelength was 205nm, the sample injection amount was 10. Mu.L, and the column temperature was 30 ℃.

The chromatographic detection conditions of the salidroside are specifically as follows: liquid chromatography: chromatographic column: welch C18 column (4.6X1250 mm, pore size 5 μm); the mobile phase is: methanol: water = 15:85, column temperature: 40 ℃, ultraviolet detector detection wavelength: 275nm, sample injection amount: 10ul, flow rate: 1ml/min.

The invention will be further described with reference to specific examples.

The invention obtains the strain producing tyrosol through gene editing, and the detailed process is as follows: taking the high-yield tyrosine escherichia coli WTY8 obtained in the patent 'escherichia coli modified in metabolic engineering and application thereof in preparing tyrosol by fermentation' CN116218752A as an initial strain, carrying out the following gene editing on the escherichia coli WTY8 by CRISPR/Cas9 technology, and knocking out ptsG genes; replacing the promoter of the tktA gene with a trc promoter; mutating aroG gene encoding the amino acid sequence shown as SEQ ID NO. 5 into aroG encoding the amino acid sequence shown as SEQ ID NO. 6 ^fbr And (3) a gene. (i.e., mutation of the 436 th base of aroG gene from G to A, i.e., mutation of the 146 th amino acid from Asp to Asn), thereby obtaining aroG ^fbr A gene, and connecting the gene with a trc promoter for overexpression; then, the promoter of the adhE gene, the promoter of the pgm gene and the promoter of the galU gene are replaced with trc promoters, respectively; then editing the gene of phenylpyruvate decarboxylase (AR 010) at the site of knocked-out of pykF and pheA (knocked-out in WTY 8) to obtain WY1 and WY2 strains, and sequentially replacing the feaB gene, the pabA gene and the ushA gene with the gene of phenylpyruvate decarboxylase (AR 010) to obtain WY3, WY4 and WY5 strains respectively. Ptrc99A-PcAAs recombination based on WY5 StrainThe plasmid is transferred into genetic engineering bacteria WY5 to obtain the high-yield tyrosol escherichia coli WAY5.

Example 1: CRISPR/Cas9 knockout operations are exemplified by ptsG gene.

(1) Preparation of E.coli WTY8/pCas conversion competence

50ng of pCas plasmid was transformed into competent cells of E.coli WTY8/pCas by heat shock at 42℃for 90sec, plated on a solid LB medium (100 mg/L kana) and cultured overnight at 30℃in an incubator to obtain E.coli WTY8/pCas strain, single colonies were picked up, inoculated on 5mL of LB tube medium (100 mg/Lkana), and 50. Mu.L of 1M L-arabinose (L-Ara) solution was added thereto and cultured overnight at 30℃at 180rpm to obtain a seed solution. Inoculating 500 μl of seed solution into 50mL LB medium (100 mg/L kana), adding 500 μl of 1M L-Ara solution, culturing at 30deg.C and 180rpm to OD 600=0.4-0.6, ice-bathing for 5min, pouring the bacterial solution into 50mL sterile centrifuge tube at 8deg.C, centrifuging at 5000rpm for 10min, discarding supernatant, adding 20mL pre-cooled 100mM CaCl at ultra clean bench ₂ Resuspension of the cells, ice bath for 30min, ice bath termination, centrifugation at 5000rpm at 8deg.C for 10min, aseptic processing to remove supernatant, adding 0.5mL of pre-chilled 100mM CaCl ₂ The solution and 60% glycerol were resuspended and 50. Mu.L each was dispensed into sterile 1.5mL EP tubes and stored at-80 ℃.

(2) Donor DNA preparation

Obtaining an upstream homology arm fragment and an amplification system: as a template, E.coli WTY8 genomic DNA (the template is used for amplification of the subsequent homology arm, target gene, etc., if unlimited) was used at a concentration of 50 ng/. Mu.L, 10. Mu.M primers F1-ptsG and R1-ptsG (Table 1) were each 1. Mu.L, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃ for 1min; for a total of 30 cycles, the termination temperature was 4 ℃. After the PCR amplification is completed, the correct PCR product is verified by 1% agarose gel electrophoresis, and the PCR product is utilizedPCR Purification Kit purification to obtain the upstream homology arm fragment.

The downstream homology arm fragment was obtained by referring to the upstream homology arm fragment, and the primers were F2-ptsG/R2-ptsG (Table 1).

Using the overlay PCR, the donardna was obtained, amplification system: 50 ng/. Mu.L of each of the upstream and downstream homology arm fragments was used as a template, and 10. Mu.M of each of the primers F1-ptsG and R2-ptsG was used as a template in 1. Mu.L, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O21. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃ for 1min; for a total of 30 cycles, the termination temperature was 4 ℃.

(3) SgRNA preparation

According to CRISPR/Cas9 gene editing principle, a site-directed mutation primer is designed to mutate the original SgRNA into a specific guide SgRNA sequence. Amplified system: mu.L of 50 ng/. Mu.L of PTarget-F Plasmid DNA (Addgene Plasmid # 62226) as template, 10. Mu.M concentration of primer pTar (ptsG) -F and primer pTar (ptsG) -R) 1. Mu.L each, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃ for 2min; for a total of 30 cycles, the termination temperature was 4 ℃. After the PCR is finished, the correct PCR product is verified by 1% agarose gel electrophoresis, and the PCR product is usedPCR Purification Kit the PCR system was recovered and purified to 30. Mu.L, and the purified fragment was digested with the template DNA using the Dpn I cleavage system: quickCut Dpn I1. Mu.L, 10 Xbuffer 3. Mu.L, reaction at 37℃for 2.5h, and use +.>PCR Purification Kit was purified and recovered to 20. Mu.L. mu.L of purified product was transformed into competent cells of E.coli DH5a, screened using LB plates (50 mg/L spectinomycin hydrochloride (SD)) and verified by sequencing. The correctly mutated strain was inoculated in 10mL LB liquid medium (50 mg/LSD), cultured at 37℃and 180rpm for 12 hours to obtain a bacterial liquid, and the extracted plasmid was designated as pTarget-ptsG and stored at-20 ℃.

(4) Gene editing operations

Amplifying by taking pTarget-ptsG plasmid as template to obtain linearization fragment with successful SgRNA mutation, and amplifying system: mu.L of 50 ng/. Mu.L of pTarget-ptsG plasmid as template, 1. Mu.L of primer F-pTD (ptsG) and 1. Mu.L of primer R-pTD (ptsG) at a concentration of 10. Mu.M, 2X PrimeSTAR MAX Premix. Mu.L, ddH, respectively ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 ℃,2min, then entering a temperature cycle at 98 ℃ for 10sec;58 ℃,15sec;72 ℃ for 2min; for a total of 30 cycles, the termination temperature was 4 ℃. After the PCR is finished, the correct PCR product is verified by 1% agarose gel electrophoresis, and the PCR product is usedPCR Purification Kit the PCR system was recovered and purified to 30. Mu.L, and the purified fragment was digested with the template DNA using the Dpn I cleavage system: quickCut Dpn I1. Mu.L, 10 Xbuffer 3. Mu.L, reaction at 37℃for 2.5h, and use +.>PCR Purification Kit purification was performed to 20. Mu.L, and pTarget-ptsG (M) fragment was obtained. Competent cells carrying pCas plasmid were taken from-80℃and allowed to stand in ice for 2min, 500ng of Donor DNA and 50ng of pTarget-ptsG (M) were added, and the mixture was gently mixed on ice and allowed to stand for 30min. After the standing is finished, the ice bath is kept stand for 2min after the heat shock is carried out at 42 ℃ for 90 seconds, 1mL (ice bath) of LB culture medium is added into the competence after the standing is finished, and the mixture is placed on a shaking table at 30 ℃ and incubated for 2h at 180 rpm. 100. Mu.L of the culture medium was plated on LB solid medium (50 mg/L SD+100mg/L kana) after completion of the incubation, and cultured overnight at 30℃where the Donor DNA and pTarget-ptsG (M) were automatically ligated to construct a plasmid, which was pTarget (ptsG).

Several monoclonal clones were picked as templates on LB solid medium (50 mg/L SD+100mg/L kana) transformation plates as described above, colony PCR was verified using ptsG-TF/ptsG-TR as primers, and positive clones were used to further eliminate pTarget (ptsG) plasmid.

(5) pTarget (ptsG) plasmid elimination

Positive clones were inoculated into 5mL of LB liquid medium (100 mg/L kana), the pTas plasmid was induced to eliminate pTarget (ptsG) plasmid by adding IPTG at a final concentration of 0.1mM, and cultured at 30℃at 180rpm for 16 hours, followed by streaking on LB solid medium (100 mg/L kana) and culturing overnight at 30 ℃. Single colonies (only half the size of the single colony is picked here) are picked up and numbered, and inoculated on a corresponding numbered area on LB solid medium (50 mg/L SD) according to the number, and cultured at 30 ℃ overnight. Single colonies incapable of growing in the corresponding area of LB solid medium (50 mg/L SD) were strains successfully eliminated by pTarget (ptsG). (6) The successfully eliminated pTarget (ptsG) strain was again prepared as a transduce competent cell carrying the pCas plasmid if the next round of gene editing was performed.

pCas plasmid elimination

And (3) eliminating pCas plasmids after all genes are edited, and completing strain construction so as to carry out subsequent fermentation culture and other experiments.

3. Single colonies successfully eliminated by pTarget-ptsG were inoculated into 5mL of LB medium and cultured at 37℃for 16h at 180 rpm. mu.L of the cultured bacterial liquid was streaked on LB solid medium and cultured overnight at 37 ℃. After the completion of the culture, streaked single colonies were numbered, and the single colonies with the number (only half the size of the single colony was selected here) were inoculated onto the corresponding area on the LB solid medium (100 mg/L kana), cultured overnight at 30℃and the single colonies which could not grow on the corresponding area on the LB solid medium (100 mg/L kana) were strains which were successfully eliminated by pCas. The pCas-eliminated strain was used as an engineering strain for completion of editing, which was inoculated in LB liquid medium at 37℃and shaking-cultured overnight at 180rpm, and the strain was preserved at-80℃for the subsequent experimental operation.

CRISPR-Cas 9 replaces the manipulation of gene promoters, exemplified by the tktA gene.

the tktA protopromoter replacement belongs to gene replacement, and compared with ptsG gene knockout, the difference is that in the step of constructing DonorDNA, pTrc99a plasmid is taken as a template to amplify trc promoter fragments, F2-tktA/R2-tktA (table 1) is taken as a primer, and the amplification system is that: 1. Mu.L of 50 ng/. Mu.L of pTrc99a plasmid as template, 1. Mu.L of primer F2-tktA and 2X PrimeSTAR MAX Premix. Mu.L of primer R2-tktA each at a concentration of 10. Mu.M, ddH ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃ for 1min; for a total of 30 cycles, the termination temperature was 4 ℃. Obtaining upper and lower homologous arm fragments, and respectively amplifying by using F1-tktA/R1-tktA and F3-tktA/R3-tktA (table 1) as primers and using escherichia coli WTY8 genome DNA as a template; construction of Donor DNA at 50ng/. Mu.L of each of the upstream and downstream homology arms and trc promoter fragment was used as a template, 10. Mu. M F1-tktA and R3-tktA were used as primers, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O21. Mu.L, the three fragments were fused to the desired DonorDNA by overlay PCR, the PCR program referencing the ptsG gene.

An alternative to ARO10 is crispr-Cas 9, exemplified by the feaB gene.

Replacement of feaB with ARO10 belongs to gene replacement, and compared with replacement of tktA gene promoter, the difference is that in the step of constructing DonorDNA, the trc-ARO10 fragment needs to be amplified by taking pTrc99a-trc-ARO10 plasmid as a template, and the amplification system is as follows: mu.L of 50 ng/. Mu.L of pTrc99a-trc-ARO10 plasmid as template, primer F2-feaB and primer R2-feaB at a concentration of 10. Mu.M were each 1. Mu.L, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃ for 3min;72 ℃ for 1min; 30 cycles total, with a termination temperature of 4 ℃; obtaining upper and downstream homologous arm fragments, and respectively amplifying by using F1-feaB/R1-feaB and F3-feaB/R3-feaB (table 1) as primers and using escherichia coli WTY8 genome DNA as a template; construction of Donor DNA, 1. Mu.L of each of 50 ng/. Mu.L of the upstream and downstream homology arms and trc-ARO10 fragment was used as a template, 1. Mu.L of each of 10. Mu. M F1-feaB and R3-feaB was used as a primer, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O21. Mu.L, the three fragments were fused to the desired DonorDNA by overlay PCR, the PCR program referencing the ptsG gene.

crispr-Cas 9 manipulation of aroG gene point mutations and replacement promoters.

The aroG anti-feedback inhibition point mutation and substitution promoter belongs to gene substitution, firstly, the anti-feedback inhibition target gene aroG ^fbr I.e., the amino acid 146 of aroG sequence is mutated from aspartic acid to asparagine. The specific process comprises the following steps: first, aroG1 fragment was amplified, amplification system: e.coli WTY8 genomic DNA at a concentration of 50 ng/. Mu.L was used as a template, and primers F2-aroG and R2-aroG (Table 1) at 10. Mu.M were each 1. Mu.L, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃ for 1min; for a total of 30 cycles, the termination temperature was 4 ℃.After the PCR amplification is completed, the correct PCR product is verified by 1% agarose gel electrophoresis, and the PCR product is utilizedPCR Purification Kit the aroG1 fragment was obtained by purification. The aroG2 fragment was obtained by referring to aroG1 fragment, and the primers were F3-aroG/R3-aroG. Thereafter, aroG was obtained using the overlay PCR with primers F2-aroG and R3-aroG ^fbr Fragments. Secondly, trc promoter fragment is obtained, and the amplification system is as follows: 1. Mu.L of pTrc99a vector with trc promoter at a concentration of 50 ng/. Mu.L was used as a template, 10. Mu.M of primers F5-aroG and R5-aroG (Table 1) were each 1. Mu.L, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃,30sec; for a total of 30 cycles, the termination temperature was 4 ℃. After the PCR amplification was completed, the correct PCR product was confirmed by 1% agarose gel electrophoresis using +.>PCR Purification Kit purification to obtain trc fragment. Then using an overlay PCR with trc promoter fragment and aroG ^fbr The fragment was used as template to obtain trc-aroG using primers F5-aroG and R3-aroG ^fbr Fragments. The upstream and downstream homology arm fragments are obtained by amplifying F1-aroG and R1-aroG, F4-aroG and R4-aroG respectively as primers and E.coli WTY8 genome DNA as a template. Amplification system: e.coli WTY8 genomic DNA at a concentration of 50 ng/. Mu.L was used as a template, and 10. Mu.M primers F1-aroG (F4-aroG) and R1-aroG (R4-aroG) were each 1. Mu.L, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O21. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 10sec;57 ℃,15sec;72 ℃ for 1min; for a total of 30 cycles, the termination temperature was 4 ℃. The correct PCR product was verified by 1% agarose gel electrophoresis, using +.>PCR Purification Kit the upstream and downstream homology arm fragments are obtained by purification. Then with the gene of interest trc-aroG ^fbr The fragments of the homology arms with the upstream and downstream were used as templates, and the F1-aroG/R4-aroG (Table 1) was used as primers, and three were used by using Overlap PCRThe fragments were fused to the desired Donor DNA, the remaining steps being referenced to aroG gene knockout.

Table 1: gene editing primer

/>

4. Construction of rhodiola rosea glycoside producing strain

The target gene of PcAAS (GenBank: AAA 33860.1) is synthesized after optimization by Beijing qing department biotechnology Co., ltd. (the optimized nucleotide sequence is shown as SEQ ID NO: 1), and is constructed between EcoRI and Eco53 kI restriction nuclease cleavage sites of the pTrc99A vector, thus obtaining recombinant plasmid Ptrc99A-PcAAS. UGT85A1 (GenBank: AT1G22400, the optimized nucleotide sequence is shown as SEQ ID NO: 3) is constructed between the restriction sites of the Eco53 kI and SacI of the pTrc99a vector to obtain recombinant plasmid pTrc99a-UGT85A1.

The recombinant plasmid pTrc99a-PcAAS-UGT85A1 is obtained by construction, and the steps are as follows: recombination to be synthesizedThe plasmid Ptrc99A-PcAAS is subjected to linear amplification, and the amplification system is as follows: mu.L of 50 ng/. Mu.L of Ptrc99A-PcAAS vector DNA as a template, primers pTrc99A-F and pTrc99A-R (Table 1) at a concentration of 10. Mu.M were each 1. Mu.L, 2X PrimeSTAR MAX Premix. Mu.L, ddH ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 30sec;57 ℃,30sec;72 ℃ for 4min; for a total of 30 cycles, the termination temperature was 4 ℃. After the completion, the agarose gel electrophoresis is used for verification, and the correct PCR product is recovered after the template DNA is digested by using a Dpn I enzyme digestion system. Obtaining target fragment UGT85A1, and amplifying system: 1. Mu.L of 50 ng/. Mu.L of recombinant plasmid pTrc99a-UGT85A1 as a template, primer F-UGT and primer R-UGT at a concentration of 10. Mu.L, 2X PrimeSTAR MAX Premix. Mu.L, ddH, respectively ₂ O22. Mu.L. The PCR reaction conditions were: pre-denaturing at 98 deg.c for 5min, and then temperature cycling at 98 deg.c for 30sec;57 ℃,30sec;72 ℃ for 2min; after the PCR is finished, the agarose gel electrophoresis verifies that the PCR is utilized to digest the template DNA by using a Dpn I enzyme digestion system, and then the template DNA is recovered, so that the UGT85A1 fragment with the trc promoter is obtained. The linearized fragment pTrc99a-PcAAS was linked to fragment UGT85A1 by one-step cloning using the ClonExpII One Step Cloning Kit kit, ligation system: 1. Mu.L of the linearization fragment pTrc99a-PcAAS at 60 ng/. Mu.L, 2. Mu.L of the gene fragment UGT85A1 at 60 ng/. Mu.L, 4. Mu.L of 5 Xbuffer, 2. Mu.L of ClonExpress II One Step Cloning Kit C, ddH ₂ O was added to 20. Mu.L, and the reaction was carried out at 37℃for 30min. And (3) carrying out transformation verification after connection, screening positive transformants the next day, extracting plasmid sequencing, and verifying the sequence correctness of the positive transformants to obtain pTrc99a-PcAAS-UGT85A1 plasmid. Each gene on the recombinant plasmid is expressed separately, and thus each gene carries the Trc promoter. Transformation of this plasmid into WY5 competence yielded the salidroside-producing WSA1 strain.

Example 2: shaking bottle fermentation production of tyrosol and salidroside

(1) The metabolically engineered E.coli strain WAY1-WAY5 prepared in example 1 was inoculated into 50mL LB liquid medium containing Amp, respectively, and cultured at 37℃and 180rpm for 12 hours; preparing seed liquid.

(2) Inoculating the seed solution prepared in the step (1) into 50mL of LB liquid medium containing Amp according to the inoculum size of 1% by volume, culturing at 37 ℃ and 180rpm, and when OD600 = 0.8, adding 0.1mM IPTG with the final concentration, and culturing for 14h under the conditions of 20 ℃ and 180 rpm.

(3) And (3) centrifuging the induced bacterial liquid obtained in the step (2) at 4000rpm for 5min to collect bacterial bodies, re-suspending the bacterial bodies by using 3mL of fermentation medium, transferring the bacterial bodies into 50mL of fermentation medium, and culturing at 30 ℃ for 72h at 180 rpm. Samples were taken for 72 hours and tested for tyrosol content by HPLC, and the results of the yield of tyrosol for E.coli strains WAY1-WAY5 are shown in FIG. 2, with WAY5 producing the highest amount of tyrosol at 1.35g/L.

The detection result shows that the WY5 strain has higher tyrosol production amount, the WY5 strain is made into chemotransformation competence, and the recombinant plasmid pTrc99a-PcAAS-UGT85A1 is transformed to obtain the WSA1 strain to produce the salidroside. WSA1 strain was inoculated at 1% inoculum size into 50mL of medium containing Amp (100 mg/L), cultured at 37℃and 180rpm until OD600 = 0.8, and induced overnight at 20℃with the addition of IPTG at a final concentration of 0.1 mM. Then, the collected cells were transferred to 50mL of fermentation medium and cultured at 30℃and 180rpm for 72 hours. Samples were taken for 72h and the product content was checked by HPLC.

Example 3: fermentation tank fermentation production of salidroside

(1) The prepared escherichia coli WSA1 strain is inoculated in 50mL of LB liquid medium (100 mg/LAmp), and is cultivated for 12 hours at 37 ℃ and 180 rpm; preparing a first stage seed solution;

(2) Inoculating the seed liquid prepared in the step (1) into 100mL of LB liquid culture medium (100 mg/L Amp) according to the inoculum size of 1% by volume, and culturing at 37 ℃ and 180rpm for 12h to obtain a second stage seed liquid; (3) Transferring the seed solution of the second stage prepared in the step (2) into a 5L fermentation tank containing 1.8L fermentation medium (100 mg/L Amp) according to the inoculation amount of 10% by volume, and culturing to OD under the conditions of the temperature of 37 ℃, the aeration ratio of 1VVM, the dissolved oxygen of 40% and the pH=7.0 ₆₀₀ Adding IPTG with final concentration of 0.1mM when the concentration reaches 10-11, performing induction culture at 20deg.C for 16h, and fermenting at 30deg.C for 100h to obtain fermentation broth containing salidroside. Regulating pH with 5M ammonia water during fermentation at 30deg.C; after 16h of induction culture, the glucose is controlled to be 5-10g/L, and the liquid is added by feeding 600g/L glucose. After induction, sampling and detecting OD600 and salidroside yield at intervals of about 4 hours, forThe samples were subjected to HPLC detection. The results are shown in FIG. 3: the salidroside yield of the strain WSA1 after 100h fermentation in a 5L fermenter is 2110mg/L.

The engineering strain constructed by the invention and the fermentation strategy applied provide guidance for the industrial green and efficient production of salidroside.

While the invention has been described with respect to the preferred embodiments, it is not limited thereto, and various changes and modifications may be made by those skilled in the art without departing from the spirit and scope of the invention, which is therefore to be limited only by the appended claims.

SEQ ID NO:1

ATGGGCAGCATTGACAACCTGACCGAAAAACTGGCGAGCCAGTTCCCGATGAACACCCTGGAACCGGAAGAATTTCGCCGCCAGGGCCACATGATGATTGATTTTCTGGCGGACTACTACCGCAAAGTGGAAAACTACCCGGTGCGCTCCCAGGTGAGCCCGGGTTACCTGCGCGAAATTCTGCCGGAAAGCGCCCCGTATAACCCGGAAAGCCTGGAAACCATCCTGCAAGATGTGCAAACCAAAATTATCCCGGGCATTACCCATTGGCAGTCGCCGAATTTTTTTGCCTATTTCCCGTCCAGCGGCTCGACCGCGGGCTTTCTGGGCGAAATGCTGTCGACCGGCTTTAACGTTGTGGGCTTTAACTGGATGGTCAGCCCGGCGGCCACCGAACTGGAAAACGTTGTGACCGATTGGTTTGGTAAAATGCTGCAGCTGCCGAAATCGTTTCTGTTTAGCGGCGGCGGCGGCGGTGTGCTGCAAGGTACCACCTGTGAAGCGATTCTGTGCACCCTGGTGGCGGCGCGCGATAAAAACCTGCGTCAGCATGGCATGGATAACATTGGCAAACTGGTGGTGTATTGTTCGGATCAGACCCATAGCGCACTGCAGAAAGCGGCGAAAATTGCGGGCATTGATCCGAAAAACTTCCGCGCCATTGAAACCACGAAAAGCAGCAACTTTCAACTGTGCCCGAAACGCCTGGAAAGCGCGATTCTGCATGATCTGCAAAACGGTCTGATTCCGCTGTACCTGTGCGCCACCGTGGGTACCACCAGCAGCACCACCGTCGATCCGCTGCCGGCGCTGACCGAAGTGGCCAAAAAGTATGATCTGTGGGTTCATGTGGACGCGGCCTACGCCGGCAGCGCATGTATTTGCCCGGAATTTCGCCAGTATCTGGATGGTGTGGAAAACGCAGATAGCTTTAGTCTGAATGCGCATAAATGGTTTCTGACCACCCTGGATTGCTGTTGCCTGTGGGTGCGTAACCCGTCGGCGCTGATTAAAAGCCTGTCCACCTATCCGGAATTTCTGAAAAACAACGCGTCCGAAACCAACAAAGTGGTTGATTATAAAGATTGGCAGATTATGCTGAGCCGCCGCTTTCGCGCGCTGAAACTGTGGTTTGTTCTGCGCTCGTATGGCGTGGGCCAGCTGCGCGAATTTATTCGCGGCCATGTGGGTATGGCGAAATATTTTGAAGGCCTGGTTAACATGGATAAACGCTTTGAAGTGGTGGCGCCGCGCCTGTTTAGCATGGTGTGTTTTCGTATTAAACCGAGTGCGATGATTGGTAAAAATGACGAAGATGAAGTGAACGAAATTAATCGCAAACTGCTGGAATCGGTGAATGATAGTGGCCGCATCTATGTGAGCCATACGGTGCTGGGCGGCATCTATGTGATTCGCTTTGCGATCGGCGGCACCCTGACGGACATTAACCACGTGAGCGCGGCCTGGAAAGTGCTGCAAGATCATGCCGGCGCGCTGCTGGATGACACCTTTACGTCGAACAAACTGGTGGAAGTGCTGAGCTAA

SEQ ID NO:2

MGSIDNLTEKLASQFPMNTLEPEEFRRQGHMMIDFLADYYRKVENYPVRSQVSPGYLREILPESAPYNPESLETILQDVQTKIIPGITHWQSPNFFAYFPSSGSTAGFLGEMLSTGFNVVGFNWMVSPAATELENVVTDWFGKMLQLPKSFLFSGGGGGVLQGTTCEAILCTLVAARDKNLRQHGMDNIGKLVVYCSDQTHSALQKAAKIAGIDPKNFRAIETTKSSNFQLCPKRLESAILHDLQNGLIPLYLCATVGTTSSTTVDPLPALTEVAKKYDLWVHVDAAYAGSACICPEFRQYLDGVENADSFSLNAHKWFLTTLDCCCLWVRNPSALIKSLSTYPEFLKNNASETNKVVDYKDWQIMLSRRFRALKLWFVLRSYGVGQLREFIRGHVGMAKYFEGLVNMDKRFEVVAPRLFSMVCFRIKPSAMIGKNDEDEVNEINRKLLESVNDSGRIYVSHTVLGGIYVIRFAIGGTLTDINHVSAAWKVLQDHAGALLDDTFTSNKLVEVLS

SEQ ID NO:3

ATGGGTAGCCAGATTATTCATAATAGCCAGAAACCGCATGTTGTTTGCGTTCCGTATCCGGCCCAGGGCCATATTAATCCGATGATGCGCGTTGCGAAACTGCTGCATGCCCGTGGTTTTTATGTTACCTTTGTTAATACCGTTTATAACCATAACCGTTTTCTGCGTTCACGCGGTAGTAATGCACTGGATGGCCTGCCGAGTTTTCGTTTTGAAAGCATCGCAGATGGTCTGCCGGAAACCGATATGGATGCAACCCAGGATATTACCGCACTGTGTGAAAGCACCATGAAAAATTGTCTGGCACCGTTTCGTGAACTGCTGCAGCGCATTAACGCCGGTGATAATGTTCCTCCGGTTAGCTGTATTGTTTCAGATGGCTGTATGAGCTTTACCCTGGATGTTGCGGAAGAACTGGGTGTTCCGGAAGTTCTGTTTTGGACCACAAGTGGCTGTGCATTTCTGGCATATCTGCATTTTTATCTGTTTATTGAAAAAGGCCTGTGTCCGCTGAAAGATGAAAGTTATCTGACTAAAGAATATCTGGAAGATACCGTTATCGATTTTATTCCGACCATGAAAAACGTTAAACTGAAAGATATCCCGAGCTTTATTCGTACCACCAATCCTGATGATGTGATGATTTCTTTTGCACTGCGCGAAACCGAACGCGCAAAACGTGCAAGCGCAATTATTCTGAATACCTTTGATGATCTGGAACATGATGTTGTTCATGCAATGCAGAGCATTCTGCCGCCGGTTTATTCTGTTGGTCCTCTGCATCTGCTGGCAAACCGTGAAATTGAAGAAGGCTCTGAAATTGGTATGATGAGCAGCAACCTGTGGAAAGAAGAAATGGAATGTCTGGATTGGCTGGATACCAAAACCCAGAACTCCGTAATTTATATTAACTTTGGTAGCATCACGGTGCTGAGCGTGAAACAGCTGGTTGAATTTGCATGGGGTCTGGCGGGCAGCGGTAAAGAATTTCTGTGGGTTATCCGCCCTGATCTGGTTGCTGGTGAAGAAGCAATGGTTCCTCCGGATTTTCTGATGGAAACCAAAGATCGTAGCATGCTGGCAAGCTGGTGTCCGCAGGAAAAAGTTCTGAGCCATCCGGCAATTGGTGGTTTTCTGACACATTGTGGTTGGAATAGCATTCTGGAAAGCCTGAGCTGTGGCGTTCCTATGGTTTGTTGGCCGTTCTTCGCAGATCAGCAGATGAATTGTAAATTTTGTTGTGATGAATGGGATGTTGGTATTGAAATTGGCGGTGATGTTAAACGTGAAGAAGTTGAAGCAGTTGTTCGTGAACTGATGGATGGTGAAAAAGGTAAGAAGATGCGTGAAAAAGCGGTGGAATGGCAGCGTCTGGCAGAAAAAGCGACAGAACATAAACTGGGTAGCAGCGTGATGAATTTTGAAACCGTGGTTAGCAAATTTCTGCTGGGTCAGAAAAGCCAGGATTAA

SEQ ID NO:4

MGSQIIHNSQKPHVVCVPYPAQGHINPMMRVAKLLHARGFYVTFVNTVYNHNRFLRSRGSNALDGLPSFRFESIADGLPETDMDATQDITALCESTMKNCLAPFRELLQRINAGDNVPPVSCIVSDGCMSFTLDVAEELGVPEVLFWTTSGCAFLAYLHFYLFIEKGLCPLKDESYLTKEYLEDTVIDFIPTMKNVKLKDIPSFIRTTNPDDVMISFALRETERAKRASAIILNTFDDLEHDVVHAMQSILPPVYSVGPLHLLANREIEEGSEIGMMSSNLWKEEMECLDWLDTKTQNSVIYINFGSITVLSVKQLVEFAWGLAGSGKEFLWVIRPDLVAGEEAMVPPDFLMETKDRSMLASWCPQEKVLSHPAIGGFLTHCGWNSILESLSCGVPMVCWPFFADQQMNCKFCCDEWDVGIEIGGDVKREEVEAVVRELMDGEKGKKMREKAVEWQRLAEKATEHKLGSSVMNFETVVSKFLLGQKSQD

SEQ ID NO:5

MNYQNDDLRIKEIKELLPPVALLEKFPATENAANTVAHARKAIHKILKGNDDRLLVVIGPCSIHDPVAAKEYATRLLALREELKDELEIVMRVYFEKPRTTVGWKGLINDPHMDNSFQINDGLRIARKLLLDINDSGLPAAGEFLDMITPQYLADLMSWGAIGARTTESQVHRELASGLSCPVGFKNGTDGTIKVAIDAINAAGAPHCFLSVTKWGHSAIVNTSGNGDCHIILRGGKEPNYSAKHVAEVKEGLNKAGLPAQVMIDFSHANSSKQFKKQMDVCADVCQQIAGGEKAIIGVMVESHLVEGNQSLESGEPLAYGKSITDACIGWEDTDALLRQLANAVKARRG

SEQ ID NO:6

MNYQNDDLRIKEIKELLPPVALLEKFPATENAANTVAHARKAIHKILKGNDDRLLVVIGPCSIHDPVAAKEYATRLLALREELKDELEIVMRVYFEKPRTTVGWKGLINDPHMDNSFQINDGLRIARKLLLDINDSGLPAAGEFLNMITPQYLADLMSWGAIGARTTESQVHRELASGLSCPVGFKNGTDGTIKVAIDAINAAGAPHCFLSVTKWGHSAIVNTSGNGDCHIILRGGKEPNYSAKHVAEVKEGLNKAGLPAQVMIDFSHANSSKQFKKQMDVCADVCQQIAGGEKAIIGVMVESHLVEGNQSLESGEPLAYGKSITDACIGWEDTDALLRQLANAVKARRG

SEQ ID NO:7

MVAELTALRDQIDEVDKALLNLLAKRLELVAEVGEVKSRFGLPIYVPEREASILASRRAEAEALGVPPDLIEDVLRRVMRESYSSENDKGFKTLCPSLRPVVIVGGGGQMGRLFEKMLTLSGYQVRILEQHDWDRAADIVADAGMVIVSVPIHVTEQVIGKLPPLPKDCILVDLASVKNGPLQAMLVAHDGPVLGLHPMFGPDSGSLAKQVVVWCDGRKPEAYQWFLEQIQVWGARLHRISAVEHDQNMAFIQALRHFATFAYGLHLAEENVQLEQLLALSSPIYRLELAMVGRLFAQDPQLYADIIMSSERNLALIKRYYKRFGEAIELLEQGDKQAFIDSFRKVEHWFGDYVQRFQSESRVLLRQANDNRQ。

Claims

1. A metabolically engineered escherichia coli, characterized in that said metabolically engineered escherichia coli is constructed as follows:

the genetically engineered bacterium WTY8 is obtained by modifying escherichia coli W3110 as follows: knocking out tyrR gene, pykF gene, trpD gene and pheA gene; the promoter of galP gene, the promoter of glk gene, the promoter of ppsA gene and the promoter of tyrA gene are replaced with trc promoters, respectively; mutant tyrA gene into tyrA coding for the amino acid sequence shown as SEQ ID NO. 7 ^fbr A gene;

the genetic engineering includes: knocking out ptsG gene; the promoter of the tktA gene, the promoter of the adhE gene, the promoter of the pgm gene and the promoter of the galU gene are replaced with trc promoters, respectively; inserting ARO10 gene into the site of the knocked-out pykF gene and the site of the knocked-out pheA gene respectively; replacement of aroG Gene with aroG ^fbr An expression cassette for a gene; the feaB gene, the pabA gene and the ushA gene are respectively replaced by ARO10 genes;

(3) Transferring the recombinant plasmid in the step (2) into the genetically engineered bacterium WY5 in the step (1) to obtain the escherichia coli strain WSA1 for producing salidroside by metabolic engineering.

2. The metabolically engineered escherichia coli of claim 1 wherein: the genetic engineering in step (1) uses CRISPR/Cas9 technology for gene editing.

3. The metabolically engineered escherichia coli of claim 1 wherein: aroG as described in step (1) ^fbr The promoter in the expression cassette of the gene is the trc promoter.

4. The metabolically engineered escherichia coli of claim 1 wherein: the nucleotide sequence of the aromatic aldehyde synthase gene in the step (2) is shown as SEQ ID NO: 1.

5. The metabolically engineered escherichia coli of claim 1 wherein: the nucleotide sequence of the glycosyltransferase gene in the step (2) is shown as SEQ ID NO: 3.

6. The metabolically engineered escherichia coli of claim 1 wherein: the expression vector in the step (2) is pTrc99a vector.

7. The metabolically engineered escherichia coli of claim 1 wherein: the recombinant plasmid in the step (2) is constructed according to the following method:

8. Use of a metabolically engineered escherichia coli according to any one of claims 1-7 for the fermentative preparation of salidroside.

9. The application according to claim 8, characterized in that the application is:

10. The use according to claim 9, wherein: the pH during the culture is controlled by feeding 5M ammonia water; in the induction culture process, the final concentration of glucose is controlled to be 5-10g/L by feeding glucose; the glucose feed consists of the following components in final concentration: glucose 600g/L, yeast extract 50g/L.