CN112226464B - Construction method and application of novel coronavirus humanized receptor hACE2 mouse model - Google Patents

Abstract

The invention belongs to the field of genetic engineering, and provides a construction method and application of a novel coronavirus humanized receptor hACE2 mouse model. In order to obtain an animal model which can be used for research and development of a pathogenesis mechanism, a medicine and a vaccine of a new coronavirus, an mT/mG mouse is used as an experimental animal, a CRISPR/Cas9 gene editing technology is utilized, and a CDS sequence of human angiotensin converting enzyme hACE2 with a polyA sequence at the 3' end is inserted in front of an initiation codon of mouse endogenous angiotensin converting enzyme mACE2, so that a new coronavirus humanized receptor hACE2 mouse model capable of red-green fluorescence conversion is obtained, the problems of random insertion of hACE2 and expression of mouse endogenous ACE2 protein are solved, tracking, positioning and detection of a virus infection process can be realized, and subsequent research and application can be greatly facilitated.

Description

Construction method and application of novel coronavirus humanized receptor hACE2 mouse model

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a construction method and application of a novel coronavirus humanized receptor hACE2 mouse model.

Background

The animal model is a key ring for research and development of new coronavirus medicines and vaccines, and is also an essential tool for deeply developing researches on virus pathogenesis and the like. Non-human primates (such as monkeys) are closer to humans, but are not suitable for general popularization and application due to the problems of high price, long period, inconvenient operation and the like. The mouse is the most common experimental animal and still the first choice of animal model, but because of the large difference between the structure of the virus receptor (ACE2) and the human, the mouse is not susceptible to the new coronavirus, and can not be directly applied to the experiment.

Similar to SARS virus, the new coronavirus (COVID-19) also mediates invasion of cells via the human cell surface receptor protein ACE 2. In the process of researching SARS, a plurality of mouse models expressing humanized ACE2 are established at home and abroad, such as an hACE2 mouse established by McCray and the like (2007), Tseng and the like (2007) and units such as China's cooperative medical university (2007), military medical academy of sciences (2008) and the like. The common defect of the mouse models is that random insertion of hACE2 causes that the integration site and copy number can not be controlled, on one hand, random insertion can cause potential negative effects on mice; on the other hand, human ACE2 is expressed simultaneously with mouse endogenous ACE2, which may cause the mouse model not to reproduce human disease characteristics well. More importantly, the traditional mouse models cannot rapidly and intuitively reflect the virus infection condition and cannot study the virus infection process in real time.

Disclosure of Invention

In order to solve the problems of random insertion of the existing novel coronavirus humanized receptor mouse model hACE2 and expression of endogenous ACE2 protein of a mouse, the invention provides a construction method of the novel coronavirus humanized receptor hACE2 mouse model, the construction strategy is shown in figure 1, and the specific method is as follows:

1) design of gRNA: designing 2 gRNA sites near a second exon initiation codon ATG of a mouse angiotensin converting enzyme mACE2 gene;

2) design of Donor DNA: connecting an upstream homologous arm of human angiotensin converting enzyme hACE2, a CDS sequence and a polyA sequence of human angiotensin converting enzyme hACE2 and a downstream homologous arm of human angiotensin converting enzyme hACE2 to form a Donor DNA fragment;

3) microinjection: mixing the 2 gRNAs obtained in the step 1), the Donor DNA obtained in the step 2), the Cas9 protein and the Microinjection buffer, and injecting the mixture into a pronucleus of a fertilized egg of an mT/mG mouse to obtain an embryo;

4) embryo transplantation: continuously culturing the embryo obtained in the step 3) to 2-cells, then carrying out oviduct transplantation, transplanting the 2-cell embryo to the oviduct of a pseudopregnant female mouse, and continuously feeding the female mouse until a newborn mouse is born;

5) and (3) genotype identification: and (4) identifying the genotype of the baby mouse obtained in the step (4), wherein the baby mouse with the gene sequence of the human angiotensin converting enzyme hACE2 is the new coronavirus humanized receptor hACE2 mouse model.

In one embodiment of the invention, the sequence of the second exon of the mouse angiotensin converting enzyme mACE2 gene is shown as SEQ ID No. 4.

Further limiting, the two gRNAs in the step 1) are gRNA-1 and gRNA-2 respectively, the sequence of the gRNA-1 is shown as SEQ ID No.1, and the sequence of the gRNA-2 is shown as SEQ ID No. 2.

Further limited, the CDS sequence of the human angiotensin converting enzyme hACE2 in the step 2) is shown as SEQ ID No. 5.

Further limited, the sequence of the upstream homology arm in the step 2) is shown as SEQ ID No.11, and the sequence of the downstream homology arm is shown as SEQ ID No. 12.

Further limiting, the primer-F of the upstream homology arm is shown as SEQ ID No.13, the primer-R of the upstream homology arm is shown as SEQ ID No.14, the primer-F of the downstream homology arm is shown as SEQ ID No.15, and the primer-R of the downstream homology arm is shown as SEQ ID No. 16.

Further limited, the sequence of the Donor DNA is shown as SEQ ID No. 17.

In one embodiment of the invention, step 3) is mixing gRNA-1, gRNA-2, Donor DNA and Cas protein in a final concentration ratio of 5:5:2: 25.

In one embodiment of the present invention, the mouse fertilized egg described in step 3) is incubated at 37 ℃ for 15 minutes before microinjection.

The invention also provides application of the novel coronavirus humanized receptor hACE2 mouse model obtained by the construction method in research of pathogenesis of novel coronavirus and research and development of medicines or vaccines.

Advantageous effects

The construction method of the new coronavirus humanized receptor hACE2 mouse model provided by the invention adopts a gene editing technology, replaces the expression of the angiotensin converting enzyme mACE2 gene of a mouse by a human angiotensin converting enzyme hACE2 coding region, not only solves the problems that the integration site and copy number can not be controlled due to the random insertion of hACE2 in the existing new coronavirus humanized receptor hACE2 mouse model, and the human ACE2 is expressed and simultaneously the human ACE2 is also expressed, which possibly causes the mouse model not to well reproduce the human disease characteristics, moreover, by using mice with fluorescence conversion elements as experimental animals, infected cells (green) and uninfected cells (red) can be distinguished, the obtained mouse model can realize tracking, positioning and detection of the virus infection process, and can be greatly convenient for subsequent research and application.

Drawings

FIG. 1.hACE2 gene knock-in strategy;

FIG. 2. Process for obtaining Donor DNA;

FIG. 3 shows the mT/mG fluorescence conversion principle and an example of the embryonic cell fluorescence conversion;

FIG. 4 shows the results of genotyping of mice.

Detailed Description

The present invention will be described in further detail with reference to the following embodiments and the accompanying drawings, and the present invention is not limited to the following embodiments. Variations and advantages that may occur to those skilled in the art may be incorporated into the invention without departing from the spirit and scope of the inventive concept, and the scope of the appended claims is intended to be protected. The procedures, conditions, reagents, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited. Such as described in Sambrook et al, molecular cloning, A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Example 1:

design of gRNAs

Through multi-tool prediction and comprehensive analysis, 3 transcripts of the mouse mACE2 can be known, 2 gRNA sites with potential high targeting and low off-target risk are screened near the second exon initiation codon ATG of the mACE2 gene, so that 22bp sequences including ATG can be completely knocked out, and further the endogenous ACE2 of the mouse can not be expressed. The seed sequence of gRNA-1 is shown in SEQ ID NO.1, namely GGATGGGATCTTGGCGCACG; the seed sequence of gRNA-2 is shown in SEQ ID NO.2, namely GAAAGATGTCCAGCTCCTCC; the knocked-out 22bp sequence is shown as SEQ ID NO.3, namely ACGGGGAAAGATGTCCAGCTCC; the sequence of the second exon containing the initiation codon is shown in SEQ ID NO. 4.

Design of Donor DNA

We first cloned the CDS and polyA sequence of hACE2 from the purchased hACE2 plasmid, and verified the sequences to be completely correct by sequencing, wherein the hACE2 plasmid is purchased from VISIE Biotechnology GmbH, the product name is ACE2, the product code is NM-021804, the CDS sequence of hACE2 is shown in SEQ ID NO.5, the polyA sequence is shown in SEQ ID NO.6, the sequences of the primers hACE2-F and hACE2-R are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively, in addition, when designing the primer of hACE2, a Flag tag and a 6 XHis tag are added at the downstream of hACE2 for later detection, the sequence of the Flag tag is shown in SEQ ID NO.9, and the sequence of the 6 XHis tag is shown in SEQ ID NO. 10; an upstream homology arm and a downstream homology arm of the pCE-zero vector are respectively designed according to the cutting sites of the gRNA, the length of the upstream homology arm is 980bp, the sequence is shown as SEQ ID NO.11, the length of the downstream homology arm is 978bp, and the sequence is shown as SEQ ID NO. 12; an upstream homologous arm sequence, an hACE2 sequence, a polyA sequence and a downstream homologous arm sequence are sequentially connected together by utilizing a homologous recombination method and cloned to a pCE-zero vector, wherein the used upstream homologous arm primer-F sequence is shown as SEQ ID NO.13, the upstream homologous arm primer-R sequence is shown as SEQ ID NO.14, the downstream homologous arm primer-F sequence is shown as SEQ ID NO.15, and the downstream homologous arm primer-R sequence is shown as SEQ ID NO. 16. And finally obtaining the recombinant plasmid with completely correct sequence by transforming escherichia coli, and carrying out PCR detection and sequencing identification on the colony monoclonal. Using this plasmid as a template, a DNA fragment containing the upstream homology arm, hACE2+ polyA and the downstream homology arm was amplified and purified as a Donor DNA whose sequence is shown in SEQ ID NO.17, and the results of PCR amplification are shown in FIG. 2. The Kit used in the experimental process is Clon express One Step Cloning Kit (C115) of Vazyme company.

3. Microinjection and embryo transfer

The invention takes mT/mG mice as experimental animals, and the mice are pre-provided with fluorescence conversion elements at the safe loci of the genome Rosa 26. As shown in FIG. 3, the principle of fluorescence conversion is briefly that a Cre/loxP recombinase system is used, loxP sites are added on both sides of a red fluorescent protein gene tdTomato, and a STOP transcription termination sequence is added on the upstream of a green fluorescent protein gene EGFP. Normally, the promoter CAG initiates transcription of tdTomato to express red fluorescent protein, while green fluorescent protein is not expressed due to the presence of STOP sequence, so the cells show red fluorescence. And when Cre recombinase is introduced, the Cre recombinase can specifically act on the loxP sites, so that tdTomato and STOP elements are cut, green fluorescent protein is expressed, and the fluorescence of the cells is converted from red to green.

We have verified the effectiveness of the fluorescence transition by preliminary microinjection experiments. The cells can successfully complete the fluorescence conversion of red → green and develop into blastocysts by injecting the fertilized ovum or Cre mRNA of 2-cell monoblastomere in a microinjection way. The blastocyst is transplanted to breed mother mouse, and various fluorescence converting mice can be obtained. Therefore, if the new coronavirus is slightly modified and the Cre gene sequence is added, the red → green fluorescence conversion can occur after the new coronavirus infects the mouse cells, so that the infected cells and the uninfected cells can be visually distinguished.

And (3) superovulation treatment is carried out on the mT/mG female mouse, and then the female mouse and the male mouse are closed to obtain a fertilized egg. On the day of microinjection, 2 grnas, Donor DNA, and Cas9 protein were mixed uniformly, the ratio and final concentration of each component are shown in table 1, and the mixture was injected into the pronuclei of mT/mG mouse zygotes incubated at 37 ℃ for 15 minutes. After injection, the embryos are continuously cultured to 2-cells for oviduct transplantation. Approximately 10 2-cell embryos were transplanted into the oviduct of each side of a pseudopregnant mother mouse, and the mother mouse continued to be fed for approximately 19 days until the newborn mouse was born.

TABLE 1 microinjection System Components amounts and Final concentrations

4. Genotyping

And (4) on the 6 th day after birth of the newborn mouse, taking the clipped toe or tail tip of the newborn mouse for genotype identification. 21 born mice of 1 pregnant mother mouse are preliminarily identified by hACE2 detection primer, and target bands (shown as A in figure 4) are amplified from No.5, No.13, No.15, No.16 and No. 21 mice. Further, it was confirmed that hACE2 did indeed generate gene knock-in by 2-pair detection of primers in which the upper and lower homologous arms were ligated to hACE 2. Detection of the WT band of interest by the mouse ACE2 specific primer also amplified, indicating that a single allele knock-in occurred (shown as B in figure 4). The insert was sequenced in full length and the 5, 15, 16 and 21 mouse inserts were completely correct, so these 4 mice were fountain mice, a humanized receptor for new corona virus hACE2 mouse model, and subsequently homozygous mouse models with the biallelic hACE2 gene knock-in were obtained by mating propagation. Primers for the wild-type ACE2 sequence used in the examples are shown in SEQ ID NO.18 and SEQ ID NO. 19.

SEQ ID NO.6

Name: PolyA sequence

AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA

SEQ ID NO.7

Name: hACE2-F

CAACCCAAGTTCAAAGGCTGATG

SEQ ID NO.8

Name: hACE2-R

GTCGTCCATTGTCACCTT

SEQ ID NO.9

Name: flag tag

GATTATAAGGATGACGACGATAAA

SEQ ID NO.10

Name: 6 × His tag

CACCACCACCACCACCA CACCACCACCACCACCAC C

SEQ ID No.13

Name: upstream homology arm primer-F

ggatcttccagagatCAAAGCCACACAGGAAGCATC

SEQ ID NO.14

Name: upstream homology arm primer-R

taccggatcctAGATCCCATCCACTGAGCAACT

SEQ ID NO.15

Name: downstream homology arm primer-F

atgggatctAGGATCCGGTACCGAGGAGA

SEQ ID NO.16

Name: downstream homology arm primer-R

ctgagaaggagTCAAACGAGTTGGTGCTCATGG

SEQ ID NO.18

Name: wild type sequence-F

CAACCCAAGTTCAAAGGCTGATG

SEQ ID NO.19

Name: wild type sequence-R

cctcaagaacttacCATCTTTTGGG

SEQUENCE LISTING

<110> Harbin Industrial university

<120> construction method and application of novel coronavirus humanized receptor hACE2 mouse model

<130>

<160> 19

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> gRNA-1

<400> 1

ggatgggatc ttggcgcacg 20

<210> 2

<211> 20

<212> DNA

<213> gRNA-2

<400> 2

gaaagatgtc cagctcctcc 20

<210> 3

<211> 22

<212> DNA

<213> cut-out 22bp sequence

<400> 3

acggggaaag atgtccagct cc 22

<210> 4

<211> 2712

<212> DNA

<213> sequence of second exon of mACE2 gene in mouse

<400> 4

ataatcaagc aggcccatga gccctgccat ttaaagtggc tcctctctta cactctggga 60

atgaggacac ggagccagct gctgaacttc accaggataa ccattaaaat tgctttggag 120

ttcatatttc cacgatccca tgcctatgga tgccaaggac ttgtcatgga tgcgctttgg 180

atttcataat gcagagtcat tattacttcc ttgagttctc agctgagttg taagcaggta 240

agtgaaaggg aaagaggcac ctgataaagt cagctgtagg actagagttt agcatgtctc 300

ctgagaaata gaaaatgact gcttgaaact ttaccaaagc cacacaggaa gcatcaaact 360

ccctatggag tggagaagag tcttataatt ttttaaatgg gcagagaaat gaatttattt 420

ttaattttta gagacagggt ttctttgtat agctctagct gtctttgatt ggtagacaaa 480

gctgtcctca aactcagaga tcttccttcc tttgtctcct gagtgctggg attaaaggca 540

tggaccacca ctgccctgcc ccattctctc cattaatttt aagtgaatgc ttgcaaaagc 600

tcacttcttt ggtgaacagc ttcctttaca aataagtacc tttgccttcg tttttatagg 660

attcttaaaa agaaaaaaaa gattcagcca ggtggttgtg gtgcacacct ttaatcccag 720

cagtcaggag gcagaggaaa gcagatctct tgagtttgag gctagcctag tctacagagg 780

gagttccagg acagccaagg ctacagagag gaactgtcta aaaacaccaa gaaagagaga 840

aaggagagag ggagaggatg gatagcttat tgatagaatt gtcagaaaag gctataagtt 900

ccaatatgtg tcccatgatt tctaagtcta gccctttctg ttatagtaaa atcatagtac 960

accctcctcc tccagtgtat ctttaacagc ttttaaggaa catattaact aaatgtccag 1020

gttttgattt ggccataaaa tgttagcaaa gctaaggttt tctaggatta atgaataaca 1080

tgtctttatt tagtttactt aaaaaaatca ttctaaaata tctgtttaca tatctgtcct 1140

ctccaggatt aacttcatat tggtccagca gcttgtttac tgttctcttc tgtttcttct 1200

tctgcttttt ttttcttctc ttctcagtgc ccaacccaag ttcaaaggct gatgagagag 1260

aaaaactcat gaagagattt tactctaggg aaagttgctc agtggatggg atcttggcgc 1320

acggggaaag atgtccagct cctcctggct ccttctcagc cttgttgctg ttactactgc 1380

tcagtccctc accgaggaaa atgccaagac atttttaaac aactttaatc aggaagctga 1440

agacctgtct tatcaaagtt cacttgcttc ttggaattat aatactaaca ttactgaaga 1500

aaatgcccaa aagatggtaa gttcttgagg ctacccaggg ggttattgat tgcttcttaa 1560

agatcagaat tactgcctat aaaactggat aaggaaatca tagagatctc tcaagtgtga 1620

ggatgagtga ctgcctctgt agctctgatc ctagtctccc agatggctaa attcaattga 1680

ccttagagtt catctggaaa attgttatga atgaattatt tgcccagatt ccaaagatga 1740

gtgaaaatgt ttaataaagt tgccatcact attctcatta tatttggtat gtaaagcatt 1800

catggaaatg ttctaagtcg ttattgagcc aataattttc tttagcttat aatgccaaca 1860

ggtctatccg agaactacaa atgacatatt aactgaaaaa tgcaactggg gtttactgaa 1920

ggcagcagct tagtaattaa ggtaaccatg gcttaggtga aactggacct gggaattcct 1980

tctttcattg acacagagct ctgaggaatt tccaaaggtc acagaagaaa agctataatt 2040

aaactagtcc caaaaaatct cagcctactc tgggaaagca gcatattttg tttgacaagt 2100

gcaaggactt agaacttttt tttttctcac tgatcctgaa gtgcctttta agtatagtta 2160

agtggtggaa aattgagcaa ctatttaaga aaagactctt ttttttcttc ttccagcaat 2220

gctttccttc aaaacggtag cttcaaaact tcctgtcttt taaatgatca gggggctgtg 2280

tgtttaaatt attgccattc atagaacaga gtgggtctga ggatgcctgt ttcctttgaa 2340

attctatgcc ccctcccagt tttctaaaat ttaagaaacc acagagactt tgacaatgta 2400

gttgccaaat gagttgcttt taactgctct aatagtttgg tcttaccggt gttgttttta 2460

gtgtaacttt ttttcccctc agtttttatt ttatttctgt tggagatcac caacgtgtac 2520

tgtagatttt ctgagctgaa tggttcaagg tgagactaat attatacttg aaagcctagc 2580

ctggagctga catccagatc ctggctgtac cactttttag ctgggtaaac ttgaattcat 2640

taaatggaca gtctgggtct tagttacttt ttgttttaag atgtatttta attttaaaac 2700

tatgtgtatg tg 2712

<210> 5

<211> 2415

<212> DNA

<213> CDS sequence of hACE2

<400> 5

atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc tcagtccacc 60

attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga agacctgttc 120

tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga gaatgtccaa 180

aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc cacacttgcc 240

caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct gcaggctctt 300

cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa cacaattcta 360

aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa tccacaagaa 420

tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga ctacaatgag 480

aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag gccattatat 540

gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga ggactatggg 600

gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta cagccgcggc 660

cagttgattg aagatgtgga acataccttt gaagagatta aaccattata tgaacatctt 720

catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag tccaattgga 780

tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa tctgtactct 840

ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat ggtggaccag 900

gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc tgttggtctt 960

cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg aaatgttcag 1020

aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag gatccttatg 1080

tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg gcatatccag 1140

tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa tgaaggattc 1200

catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca tttaaaatcc 1260

attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa cttcctgctc 1320

aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga gaagtggagg 1380

tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg gtgggagatg 1440

aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata ctgtgacccc 1500

gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac aaggaccctt 1560

taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg ccctctgcac 1620

aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat gctgaggctt 1680

ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa gaacatgaat 1740

gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga ccagaacaag 1800

aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag catcaaagtg 1860

aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga caatgaaatg 1920

tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa agtaaaaaat 1980

cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc aagaatctcc 2040

tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag aactgaagtt 2100

gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct gaatgacaac 2160

agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc ccctgtttcc 2220

atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat tgtcatcctg 2280

atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg agaaaatcct 2340

tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa cactgatgat 2400

gttcagacct ccttt 2415

<210> 6

<211> 122

<212> DNA

<213> PolyA sequence

<400> 6

aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

ta 122

<210> 7

<211> 23

<212> DNA

<213> hACE2-F

<400> 7

caacccaagt tcaaaggctg atg 23

<210> 8

<211> 18

<212> DNA

<213> hACE2-R

<400> 8

gtcgtccatt gtcacctt 18

<210> 9

<211> 24

<212> DNA

<213> Flag tag

<400> 9

gattataagg atgacgacga taaa 24

<210> 10

<211> 36

<212> DNA

<213> 6 × His tag

<400> 10

caccaccacc accaccacac caccaccacc accacc 36

<210> 11

<211> 980

<212> DNA

<213> upstream homology arm

<400> 11

caaagccaca caggaagcat caaactccct atggagtgga gaagagtctt ataatttttt 60

aaatgggcag agaaatgaat ttatttttaa tttttagaga cagggtttct ttgtatagct 120

ctagctgtct ttgattggta gacaaagctg tcctcaaact cagagatctt ccttcctttg 180

tctcctgagt gctgggatta aaggcatgga ccaccactgc cctgccccat tctctccatt 240

aattttaagt gaatgcttgc aaaagctcac ttctttggtg aacagcttcc tttacaaata 300

agtacctttg ccttcgtttt tataggattc ttaaaaagaa aaaaaagatt cagccaggtg 360

gttgtggtgc acacctttaa tcccagcagt caggaggcag aggaaagcag atctcttgag 420

tttgaggcta gcctagtcta cagagggagt tccaggacag ccaaggctac agagaggaac 480

tgtctaaaaa caccaagaaa gagagaaagg agagagggag aggatggata gcttattgat 540

agaattgtca gaaaaggcta taagttccaa tatgtgtccc atgatttcta agtctagccc 600

tttctgttat agtaaaatca tagtacaccc tcctcctcca gtgtatcttt aacagctttt 660

aaggaacata ttaactaaat gtccaggttt tgatttggcc ataaaatgtt agcaaagcta 720

aggttttcta ggattaatga ataacatgtc tttatttagt ttacttaaaa aaatcattct 780

aaaatatctg tttacatatc tgtcctctcc aggattaact tcatattggt ccagcagctt 840

gtttactgtt ctcttctgtt tcttcttctg cttttttttt cttctcttct cagtgcccaa 900

cccaagttca aaggctgatg agagagaaaa actcatgaag agattttact ctagggaaag 960

ttgctcagtg gatgggatct 980

<210> 12

<211> 978

<212> DNA

<213> downstream homology arm

<400> 12

ctccttctca gccttgttgc tgttactact gctcagtccc tcaccgagga aaatgccaag 60

acatttttaa acaactttaa tcaggaagct gaagacctgt cttatcaaag ttcacttgct 120

tcttggaatt ataatactaa cattactgaa gaaaatgccc aaaagatggt aagttcttga 180

ggctacccag ggggttattg attgcttctt aaagatcaga attactgcct ataaaactgg 240

ataaggaaat catagagatc tctcaagtgt gaggatgagt gactgcctct gtagctctga 300

tcctagtctc ccagatggct aaattcaatt gaccttagag ttcatctgga aaattgttat 360

gaatgaatta tttgcccaga ttccaaagat gagtgaaaat gtttaataaa gttgccatca 420

ctattctcat tatatttggt atgtaaagca ttcatggaaa tgttctaagt cgttattgag 480

ccaataattt tctttagctt ataatgccaa caggtctatc cgagaactac aaatgacata 540

ttaactgaaa aatgcaactg gggtttactg aaggcagcag cttagtaatt aaggtaacca 600

tggcttaggt gaaactggac ctgggaattc cttctttcat tgacacagag ctctgaggaa 660

tttccaaagg tcacagaaga aaagctataa ttaaactagt cccaaaaaat ctcagcctac 720

tctgggaaag cagcatattt tgtttgacaa gtgcaaggac ttagaacttt tttttttctc 780

actgatcctg aagtgccttt taagtatagt taagtggtgg aaaattgagc aactatttaa 840

gaaaagactc ttttttttct tcttccagca atgctttcct tcaaaacggt agcttcaaaa 900

cttcctgtct tttaaatgat cagggggctg tgtgtttaaa ttattgccat tcatagaaca 960

gagtgggtct gaggatgc 978

<210> 13

<211> 36

<212> DNA

<213> upstream homology arm primer-F

<400> 13

ggatcttcca gagatcaaag ccacacagga agcatc 36

<210> 14

<211> 33

<212> DNA

<213> upstream homology arm primer-R

<400> 14

taccggatcc tagatcccat ccactgagca act 33

<210> 15

<211> 29

<212> DNA

<213> downstream homology arm primer-F

<400> 15

atgggatcta ggatccggta ccgaggaga 29

<210> 16

<211> 33

<212> DNA

<213> downstream homology arm primer-R

<400> 16

ctgagaagga gtcaaacgag ttggtgctca tgg 33

<210> 17

<211> 4887

<212> DNA

<213> Donor DNA

<400> 17

caaagccaca caggaagcat caaactccct atggagtgga gaagagtctt ataatttttt 60

aaatgggcag agaaatgaat ttatttttaa tttttagaga cagggtttct ttgtatagct 120

ctagctgtct ttgattggta gacaaagctg tcctcaaact cagagatctt ccttcctttg 180

tctcctgagt gctgggatta aaggcatgga ccaccactgc cctgccccat tctctccatt 240

aattttaagt gaatgcttgc aaaagctcac ttctttggtg aacagcttcc tttacaaata 300

agtacctttg ccttcgtttt tataggattc ttaaaaagaa aaaaaagatt cagccaggtg 360

gttgtggtgc acacctttaa tcccagcagt caggaggcag aggaaagcag atctcttgag 420

tttgaggcta gcctagtcta cagagggagt tccaggacag ccaaggctac agagaggaac 480

tgtctaaaaa caccaagaaa gagagaaagg agagagggag aggatggata gcttattgat 540

agaattgtca gaaaaggcta taagttccaa tatgtgtccc atgatttcta agtctagccc 600

tttctgttat agtaaaatca tagtacaccc tcctcctcca gtgtatcttt aacagctttt 660

aaggaacata ttaactaaat gtccaggttt tgatttggcc ataaaatgtt agcaaagcta 720

aggttttcta ggattaatga ataacatgtc tttatttagt ttacttaaaa aaatcattct 780

aaaatatctg tttacatatc tgtcctctcc aggattaact tcatattggt ccagcagctt 840

gtttactgtt ctcttctgtt tcttcttctg cttttttttt cttctcttct cagtgcccaa 900

cccaagttca aaggctgatg agagagaaaa actcatgaag agattttact ctagggaaag 960

ttgctcagtg gatgggatct aggatccggt accgaggaga tctgccgccg cgatcgcatg 1020

tcaagctctt cctggctcct tctcagcctt gttgctgtaa ctgctgctca gtccaccatt 1080

gaggaacagg ccaagacatt tttggacaag tttaaccacg aagccgaaga cctgttctat 1140

caaagttcac ttgcttcttg gaattataac accaatatta ctgaagagaa tgtccaaaac 1200

atgaataatg ctggggacaa atggtctgcc tttttaaagg aacagtccac acttgcccaa 1260

atgtatccac tacaagaaat tcagaatctc acagtcaagc ttcagctgca ggctcttcag 1320

caaaatgggt cttcagtgct ctcagaagac aagagcaaac ggttgaacac aattctaaat 1380

acaatgagca ccatctacag tactggaaaa gtttgtaacc cagataatcc acaagaatgc 1440

ttattacttg aaccaggttt gaatgaaata atggcaaaca gtttagacta caatgagagg 1500

ctctgggctt gggaaagctg gagatctgag gtcggcaagc agctgaggcc attatatgaa 1560

gagtatgtgg tcttgaaaaa tgagatggca agagcaaatc attatgagga ctatggggat 1620

tattggagag gagactatga agtaaatggg gtagatggct atgactacag ccgcggccag 1680

ttgattgaag atgtggaaca tacctttgaa gagattaaac cattatatga acatcttcat 1740

gcctatgtga gggcaaagtt gatgaatgcc tatccttcct atatcagtcc aattggatgc 1800

ctccctgctc atttgcttgg tgatatgtgg ggtagatttt ggacaaatct gtactctttg 1860

acagttccct ttggacagaa accaaacata gatgttactg atgcaatggt ggaccaggcc 1920

tgggatgcac agagaatatt caaggaggcc gagaagttct ttgtatctgt tggtcttcct 1980

aatatgactc aaggattctg ggaaaattcc atgctaacgg acccaggaaa tgttcagaaa 2040

gcagtctgcc atcccacagc ttgggacctg gggaagggcg acttcaggat ccttatgtgc 2100

acaaaggtga caatggacga cttcctgaca gctcatcatg agatggggca tatccagtat 2160

gatatggcat atgctgcaca accttttctg ctaagaaatg gagctaatga aggattccat 2220

gaagctgttg gggaaatcat gtcactttct gcagccacac ctaagcattt aaaatccatt 2280

ggtcttctgt cacccgattt tcaagaagac aatgaaacag aaataaactt cctgctcaaa 2340

caagcactca cgattgttgg gactctgcca tttacttaca tgttagagaa gtggaggtgg 2400

atggtcttta aaggggaaat tcccaaagac cagtggatga aaaagtggtg ggagatgaag 2460

cgagagatag ttggggtggt ggaacctgtg ccccatgatg aaacatactg tgaccccgca 2520

tctctgttcc atgtttctaa tgattactca ttcattcgat attacacaag gaccctttac 2580

caattccagt ttcaagaagc actttgtcaa gcagctaaac atgaaggccc tctgcacaaa 2640

tgtgacatct caaactctac agaagctgga cagaaactgt tcaatatgct gaggcttgga 2700

aaatcagaac cctggaccct agcattggaa aatgttgtag gagcaaagaa catgaatgta 2760

aggccactgc tcaactactt tgagccctta tttacctggc tgaaagacca gaacaagaat 2820

tcttttgtgg gatggagtac cgactggagt ccatatgcag accaaagcat caaagtgagg 2880

ataagcctaa aatcagctct tggagataaa gcatatgaat ggaacgacaa tgaaatgtac 2940

ctgttccgat catctgttgc atatgctatg aggcagtact ttttaaaagt aaaaaatcag 3000

atgattcttt ttggggagga ggatgtgcga gtggctaatt tgaaaccaag aatctccttt 3060

aatttctttg tcactgcacc taaaaatgtg tctgatatca ttcctagaac tgaagttgaa 3120

aaggccatca ggatgtcccg gagccgtatc aatgatgctt tccgtctgaa tgacaacagc 3180

ctagagtttc tggggataca gccaacactt ggacctccta accagccccc tgtttccata 3240

tggctgattg tttttggagt tgtgatggga gtgatagtgg ttggcattgt catcctgatc 3300

ttcactggga tcagagatcg gaagaagaaa aataaagcaa gaagtggaga aaatccttat 3360

gcctccatcg atattagcaa aggagaaaat aatccaggat tccaaaacac tgatgatgtt 3420

cagacctcct ttacgcgtac gcggccgctc gaggattata aggatgacga cgataaattc 3480

gtcgagcacc accaccacca ccactaataa ggtttatccg atccaccgga tctagataag 3540

atatccgatc caccggatct agataactga tcataatcag ccataccaca tttgtagagg 3600

ttttacttgc tttaaaaaac ctcccacacc tccccctgaa cctgaaacat aaaatgaatg 3660

caattgttgt tgttaacttg tttattgcag cttataatgg ttacaaataa agcaatagca 3720

tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac 3780

tcatcaatgt atcttaacgc ggatctgggc gtggttaagg gtgggaaaga atatataagg 3840

tgggggtctt atgtagtttt gtatctgttt tgcagcagcc gccgccgcca tgagcaccaa 3900

ctcgtttgac tccttctcag ccttgttgct gttactactg ctcagtccct caccgaggaa 3960

aatgccaaga catttttaaa caactttaat caggaagctg aagacctgtc ttatcaaagt 4020

tcacttgctt cttggaatta taatactaac attactgaag aaaatgccca aaagatggta 4080

agttcttgag gctacccagg gggttattga ttgcttctta aagatcagaa ttactgccta 4140

taaaactgga taaggaaatc atagagatct ctcaagtgtg aggatgagtg actgcctctg 4200

tagctctgat cctagtctcc cagatggcta aattcaattg accttagagt tcatctggaa 4260

aattgttatg aatgaattat ttgcccagat tccaaagatg agtgaaaatg tttaataaag 4320

ttgccatcac tattctcatt atatttggta tgtaaagcat tcatggaaat gttctaagtc 4380

gttattgagc caataatttt ctttagctta taatgccaac aggtctatcc gagaactaca 4440

aatgacatat taactgaaaa atgcaactgg ggtttactga aggcagcagc ttagtaatta 4500

aggtaaccat ggcttaggtg aaactggacc tgggaattcc ttctttcatt gacacagagc 4560

tctgaggaat ttccaaaggt cacagaagaa aagctataat taaactagtc ccaaaaaatc 4620

tcagcctact ctgggaaagc agcatatttt gtttgacaag tgcaaggact tagaactttt 4680

ttttttctca ctgatcctga agtgcctttt aagtatagtt aagtggtgga aaattgagca 4740

actatttaag aaaagactct tttttttctt cttccagcaa tgctttcctt caaaacggta 4800

gcttcaaaac ttcctgtctt ttaaatgatc agggggctgt gtgtttaaat tattgccatt 4860

catagaacag agtgggtctg aggatgc 4887

<210> 18

<211> 23

<212> DNA

<213> wild type sequence-F

<400> 18

caacccaagt tcaaaggctg atg 23

<210> 19

<211> 25

<212> DNA

<213> wild type sequence-R

<400> 19

cctcaagaac ttaccatctt ttggg 25

Claims (9)

1. A method for constructing a novel coronavirus humanized receptor hACE2 mouse model is characterized by comprising the following steps:

1) design of gRNA: 2 gRNA sites are designed near an ATG (initiator codon) of a second exon of a mouse angiotensin converting enzyme mACE2 gene, and gRNA-1 and gRNA-2 are respectively arranged, wherein the sequence of the gRNA-1 is shown in SEQ ID No.1, and the sequence of the gRNA-2 is shown in SEQ ID No. 2;

2) design of Donor DNA: connecting an upstream homologous arm of human angiotensin converting enzyme hACE2, a CDS sequence and a polyA sequence of human angiotensin converting enzyme hACE2 and a downstream homologous arm of human angiotensin converting enzyme hACE2 to form a Donor DNA fragment;

3) microinjection: mixing the 2 gRNAs obtained in the step 1), the Donor DNA obtained in the step 2), the Cas9 protein and the Microinjection buffer, and injecting the mixture into a pronucleus of a fertilized egg of an mT/mG mouse to obtain an embryo;

4) embryo transplantation: continuously culturing the embryo obtained in the step 3) to 2-cells, and then transplanting the 2-cell embryo into the oviduct of a pseudopregnant female mouse until a newborn mouse is born;

5) and (3) genotype identification: and (3) identifying the genotype of the baby mouse obtained in the step 4), wherein the baby mouse with the gene sequence of the human angiotensin converting enzyme hACE2 is the new coronavirus humanized receptor hACE2 mouse model.

2. The construction method according to claim 1, wherein the sequence of the second exon of the mouse angiotensin converting enzyme mACE2 gene is shown as SEQ ID No. 4.

3. The method of claim 1, wherein the CDS sequence of the human angiotensin-converting enzyme hACE2 in step 2) is shown in SEQ ID No. 5.

4. The construction method according to claim 3, wherein the upstream homology arm sequence in step 2) is shown as SEQ ID No.11, and the downstream homology arm sequence is shown as SEQ ID No. 12.

5. The construction method according to claim 4, wherein the primer-F of the upstream homology arm is shown as SEQ ID No.13, the primer-R of the upstream homology arm is shown as SEQ ID No.14, the primer-F of the downstream homology arm is shown as SEQ ID No.15, and the primer-R of the downstream homology arm is shown as SEQ ID No. 16.

6. The method according to claim 5, wherein the DNA of Donor has the sequence shown in SEQ ID No. 17.

7. The method according to claim 1, wherein the mixing in step 3) is performed by mixing gRNA-1, gRNA-2, Donor DNA and Cas protein in a final concentration ratio of 5:5:2: 25.

8. The method according to claim 1, wherein the mouse fertilized egg of step 3) is incubated at 37 ℃ for 15 minutes before microinjection.

9. The use of the mouse model of the humanized receptor hACE2 for the novel coronavirus obtained by the construction method of claim 1 in research on pathogenic mechanism of the novel coronavirus, and development of drugs or vaccines.

Images