CN113308480B - A-type Seneca virus SVA/HeB full-length infectious cDNA clone, and preparation method and application thereof - Google Patents

Abstract

The invention discloses a full-length infectious cDNA clone of A-type Seneca virus SVA/HeB, a preparation method and application thereof, belonging to the technical field of viruses. The rescue system used by the invention introduces a CMV enhancer, a beta-actin promoter and a ribozyme sequence at the upstream of the 5' end of the A-type seneca virus; introducing ribozyme and terminator sequence at the downstream of the 3' end, sectionally amplifying SVA full-length genome fragment by an RT-RCR method, cloning to pOK12 vector by utilizing homologous recombination technology, and constructing recombinant plasmid containing SVA/HeB full-length cDNA. The virus obtained by the rescue based on the infectious cDNA clone lays a foundation for the deep research of the biological characteristics, the replication mechanism and the pathogenic mechanism of the SVA and the research and development of related vaccines, and has important scientific application value.

Description

A-type Seneca virus SVA/HeB full-length infectious cDNA clone, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of viruses, and particularly relates to a full-length infectious cDNA clone of A-type Seneca virus SVA/HeB, a preparation method and application thereof.

Background

SenecavirusA (SVA) belongs to the genus SenecavirusA of the family Picornaviridae, and is a single-stranded, positive-stranded, membrane-free RNA virus. SVA infected pigs have been shown to cause primary vesicular disease, which causes vesicular lesions in the nasal kisses and coronal belts of the hooves of pigs, accompanied by clinical manifestations of lameness, anorexia, lethargy and fever. It is difficult to distinguish from clinical symptoms caused by foot-and-mouth disease, swine vesicular disease and vesicular stomatitis.

In 2002, american scientists first discovered SVAs in cell culture. After 2015, SVA epidemic has developed in several countries, such as canada, usa, brazil, thailand, china, etc. Through retrospective monitoring and epidemiological investigation, SVAs are popular and spread in a plurality of areas of China, and the popularity range is wider and wider. However, the pathogenic mechanism of SVA and related vaccines have been studied only rarely so far, and the platform of reverse genetic manipulation of SVA is a key tool for studying the pathogenic mechanism of SVA and related vaccines.

Construction of SVA infectious clones is mostly based on traditional enzyme digestion to link fragments with vectors, which mainly includes two methods: one is that the PCR primer is introduced into the enzyme cutting site on the carrier when being designed, and the PCR product is directionally cloned to the target carrier after double enzyme cutting; the other is TA vector ligation. The two methods are time-consuming, labor-consuming and tedious. The homologous recombination technology is a new, rapid and simple cloning method, aims to overcome the defects, can insert one or more target DNA fragments at any site of a plasmid without any restriction enzyme and ligase, and has high cloning efficiency, and positive cloning is up to more than 90%.

In addition, two methods can be used to construct strategies for generating progeny virus after synthesis of full-length cDNA: RNA transfection and DNA transfection. In the RNA transfection strategy, the RNA of the virus is synthesized by in vitro transcription by using a T7 or SP6 prokaryotic promoter, the RNA of the virus is transcribed in vitro and then transfected into cells to start the rescue process of the virus, but the method is complicated and unstable, and the reagent is expensive.

Disclosure of Invention

In order to solve the technical problems, the invention provides an A-type Seneca virus SVA/HeB full-length infectious cDNA clone, a preparation method and application thereof.

The DNA transfection strategy used by the invention adopts a eukaryotic dual-promoter CMV enhancer and a beta-acitn promoter as the upstream of the full-length virus genome cDNA infectious clone for the first time, and the infectious virus particles can be obtained by directly transfecting cells with complete plasmids.

In order to achieve the purpose, the invention adopts the following technical scheme:

a full-length infectious cDNA clone of A-type Seneca virus SVA/HeB, the rescue system is that upstream of 5' end of Seneca virus nucleic acid sequence is inserted with CMV enhancer, beta-actin promoter and ribozyme sequence; the ribozyme and terminator sequences were inserted downstream of the 3' end of the seneca virus nucleic acid sequence.

The skeleton vector of the recombinant plasmid used in the invention is modified pOK-CMV-Actin.

In the invention, the nucleotide sequence of the Seneca virus is inserted into pOK-CMV-Actin vector in a homologous recombination mode through an EcoR I enzyme cutting site. The nucleotide sequence of the inserted Seneca virus is shown as SEQ ID NO. 7.

According to the invention, a hammerhead ribozyme sequence (Hamrz) is introduced into the 5 'end of the SVA full-length cDNA genome, the core sequence of the enzyme is 58nt, and the 3' end C of the enzyme is provided with a self-cutting modification site; a hepatitis delta virus ribozyme sequence (Hdvrz) was introduced at the 3 'end of the SVA full-length cDNA genome, the ribozyme core sequence had 88nt, and the 5' end G had a self-cleaving modification site. When the infectious clone containing SVA genome is transfected into susceptible cells, virus RNA precursor is transcribed and packaged through a CMV enhancer and a beta-actin promoter regulatory element, and then the virus RNA precursor is cut and modified by hammerhead ribozyme and hepatitis delta virus ribozyme to generate infectious virus RNA.

A construction method of full-length infectious clone of A-type Selenecar virus SVA/HeB comprises the following steps:

1) and (3) modifying a carrier: selecting a low-copy vector pOK12 as a vector constructed by cloning full-length infectious cDNA of the A-type Senecan, artificially synthesizing CMV enhancer and beta-Actin promoter sequences, cloning the sequences into corresponding enzyme cutting sites of a pOK12 vector through Sal I and Hind III, and constructing a low-copy plasmid pOK-CMV-Actin containing a double promoter. The nucleotide sequences of the artificially synthesized CMV enhancer and beta-actin promoter are shown in SEQ ID NO. 12.

2) Three pairs of overlapping primers AF/AR, BF/BR and CF/CR covering the SVA/HeB virus complete genome are respectively designed and synthesized by taking cDNA of the A-type Seneca virus SVA/HeB as a template.

The nucleotide sequence of the AF is shown in SEQ ID NO. 1; the nucleotide sequence of the AR is shown as SEQ ID NO. 2; the nucleotide sequence of the BF is shown in SEQ ID NO. 3; the nucleotide sequence of the BR is shown in SEQ ID NO. 4; the nucleotide sequence of the CF is shown as SEQ ID NO. 5; the nucleotide sequence of CR is shown as SEQ ID NO. 6;

3) pOK-CMV-Actin was linearized with EcoR I, the linearized fragment was cloned with A, B and C fragments of SVA genome into pOK-CMV-Actin vector by NEB-uilder HiFi DNAsemblycloning Kit, and transformed into DH 5. alpha. competent cells to obtain recombinant plasmid pOK-rSVA/HeB.

The invention selects a low-copy vector pOK12 as a vector constructed by cloning full-length infectious cDNA of an A-type senecan, clones artificially synthesized CMV enhancer and beta-Actin promoter sequences into corresponding enzyme cutting sites of a pOK12 vector through Sal I and Hind III, and constructs a low-copy plasmid pOK-CMV-Actin containing double promoters.

The invention takes the cDNA of SVA/HeB as a template, and uses a specific primer pair to amplify the A gene of SVA/HeB strain; the specific primer pair comprises an upstream primer SVA-AF and a downstream primer SVA-AR, and the primer sequence for amplifying the A gene is as follows:

SVA-AF:5’-CATCATTTTGGCAAAGTGTTAAGCGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTCCTATAGTCTTGAAATGGGGGGCTGGGCCCTCAT-3’(SEQ ID NO.1)；

SVA-AR:5’-AGGTCCAACTAGAGTTCAAGCCTATG-3’(SEQ ID NO.2)；

The program of the invention in the A gene amplification process is preferably pre-denatured at 98 ℃ for 30 s; denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 2min, and 35 cycles; extension for 10min at 72 ℃. The upstream primer SVA-AF used for amplifying the A gene is introduced into pOK-CMV-Actin vector EcoR I enzyme cutting site homologous arm and hammerhead ribozyme sequence to ensure that infectious virus RNA is generated after the transcription through shearing modification.

The method takes cDNA of an SVA/HeB strain as a template, and uses a specific primer pair to amplify B genes of the SVA/HeB strain, wherein the specific primer pair comprises an upstream primer SVA-BF and a downstream primer SVA-BR, the nucleotide sequence of the upstream primer SVA-BF is shown as SEQ ID No.3, and the nucleotide sequence of the downstream primer SVA-BR is shown as SEQ ID No. 4. The primer sequences used for amplifying the B gene are shown as follows:

SVA-BF:5’-CACAACCACAGACCCTTTCTGAA-3’(SEQ ID NO.3)；

SVA-BR:5’-TGCATTTCCATAAGAGAGAGCGCTC-3’(SEQ ID NO.4)；

the program of the invention in the B gene amplification process is preferably pre-denatured at 98 ℃ for 30 s; denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, and 35 cycles; extension at 72 ℃ for 10 min.

The method takes cDNA of an SVA/HeB strain as a template, and uses a specific primer pair to amplify C genes of the SVA/HeB strain, wherein the specific primer pair comprises an upstream primer SVA-CF and a downstream primer SVA-CR, the nucleotide sequence of the upstream primer SVA-CF is shown as SEQ ID No.5, and the nucleotide sequence of the downstream primer SVA-CR is shown as SEQ ID No. 6. The primer sequences used for amplifying the C gene are shown as follows:

SVA-CF:5’-TAGGAGCGAGAATGCTTATGACGGC-3’(SEQ ID NO.5)；

SVA-CR:5’-TACCAGATCTGAATCGCCCTCCCTTAGCCATCCGAGTGGACGTGCGTCCTCCTTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCTTTTCCCTTTTCTGTTCCGAC-3’(SEQ ID NO.6)；

The procedure of the present invention in the C gene amplification process is preferably pre-denatured at 98 ℃ for 30 s; denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 2min, and 35 cycles; extension at 72 ℃ for 10 min. The downstream primer of the invention introduces pOK-CMV-Actin vector EcoR I enzyme cutting site homologous arm and hepatitis delta virus ribozyme sequence to ensure that infectious virus RNA is generated by cutting modification after transcription. In the invention, base G is mutated into base T at 5906 site while C segment is amplified, Mlu I enzyme cutting site is introduced, and the site mutation can be used for constructing full-length cDNA and can be used as genetic marker to distinguish from parent virus.

The pOK-CMV-Actin is linearized by EcoR I, the linearized fragment and a A, B, C fragment of SVA genome are cloned to pOK-CMV-Actin vector by NEB-uilder HiFi DNAsemblycloning Kit, and the vector is transformed to DH5 alpha competent cells, so that a recombinant plasmid pOK-rSVA/HeB is obtained.

The invention also provides application of the full-length infectious clone of the seneca virus constructed by the construction method in rescuing the seneca virus.

The invention also provides a method for rescuing the epikayavirus, which comprises the following steps: the recombinant plasmid pOK-rSVA/HeB is transfected into Seneca virus sensitive cells and placed in a medium containing 5% CO ₂ Culturing in an incubator at 37 ℃, harvesting the virus when 80-90% of cells have pathological changes, repeatedly freezing and thawing for 3 times, and then inoculating the seneca virus sensitive cells again until the virus can stably generate the cytopathic changes, thereby obtaining the recombinant virus rSVA/HeB. The cytopathic effect includes rounding off of the cells, shedding, and a large number of floating dead cells.

The recombinant virus rSVA/HeB provided by the invention can proliferate in BHK-21, PK-15 and IBRS-2 cells and cause cytopathy.

The gene of the seneca recombinant virus rSVA/HeB contains a silent mutation Mlu I molecular marker, and the genetic marker can be distinguished from a parental wild strain.

The conventional in vitro transcription system saves the virus, is complicated and unstable in operation and expensive in reagent, and the eukaryotic double-promoter-based control sequence is simple and convenient to operate, so that the virus can be saved, the in vitro transcription and RNA transfection are avoided, the experimental process is greatly simplified, the RNA degradation and loss caused in the in vitro transcription and transfection process are also avoided, and the virus saving efficiency is improved. The epikaavirus rescued by the system has high consistency with the biological characteristics of parent viruses.

Compared with the prior art, the invention has the following beneficial effects:

The invention uses the carrier containing CMV and beta-actin dual promoters as SVA infectious clone skeleton for the first time, and has high starting efficiency, higher rescue capacity and higher speed. Compared with the traditional enzyme digestion method adopted in other patents, the homologous recombination technology adopted by the invention has the advantages that: (1) cloning genes at any position of the vector; (2) is quick and simple: the processes of enzyme digestion, rubber tapping recovery, enzyme linkage and the like are omitted, and the vector construction is completed within about 1 hour; (3) and (3) precision: no additional procedure is needed; (4) the cloning efficiency is high, and the positive cloning rate is up to more than 90%; (5) multiple fragments of target genes are recombined at one time.

Drawings

FIG. 1 is a schematic diagram of infectious clone construction of full-length cDNA of Seneca virus according to the present invention.

FIG. 2 is a gel electrophoresis of the amplified product of the A, B, C fragment in example 1.

FIG. 3 is a graph comparing BHK-21 cells infected with the rescued recombinant virus rSVA/HeB in example 2.

FIG. 4 is a comparison of the rescued recombinant virus rSVA/HeB infected PK-15 cells in example 3.

FIG. 5 is a graph comparing the rescued recombinant virus rSVA/HeB infected IBRS-2 cells in example 3.

FIG. 6 is an indirect immunofluorescence plot of BHK-21 cells infected with SVA/HeB and rSVA/HeB, respectively, and non-detoxified BHK-21 cells of example 4.

Detailed Description

Example 1

Construction method of Seneca recombinant virus infectious clone

The A-type Selenecarin virus SVA/HeB (GenBank access number: MZ375462) was isolated and stored in this experiment. Based on the SVA genome sequence, by comparative analysis, amplification primers were designed that introduce the rescue elements and cover the SVA whole genome:

SVA-AF:5’-CATCATTTTGGCAAAGTGTTAAGCGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTCCTATAGTCTTGAAATGGGGGGCTGGGCCCTCAT-3’(SEQ ID NO.1)；

SVA-AR:5’-AGGTCCAACTAGAGTTCAAGCCTATG-3’(SEQ ID NO.2)；

SVA-BF:5’-CACAACCACAGACCCTTTCTGAA-3’(SEQ ID NO.3)；

SVA-BR:5’-TGCATTTCCATAAGAGAGAGCGCTC-3’(SEQ ID NO.4)；

SVA-CF:5’-TAGGAGCGAGAATGCTTATGACGGC-3’(SEQ ID NO.5)；

SVA-CR:5’-TACCAGATCTGAATCGCCCTCCCTTAGCCATCCGAGTGGACGTGCGTCCTCCTTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCTTTTCCCTTTTCTGTTCCGAC-3’(SEQ ID NO.6)；

in the specific primers, an upstream primer SVA-AF used for amplifying the A fragment is introduced with an EcoR I enzyme cutting site homologous arm and a hammerhead ribozyme sequence of a vector so as to ensure that infectious virus RNA is generated after transcription through shearing modification. The downstream primer used for amplifying the C fragment is introduced into an EcoR I enzyme cutting site homologous arm of an pOK-CMV-Actin vector and a hepatitis delta virus ribozyme sequence so as to ensure that infectious virus RNA is generated through shearing modification after transcription.

The specific process is as follows:

(1) extracting total RNA of SVA/HeB by Trizol method, reverse transcribing according to PrimeScript 1st Standard cDNA Synthesis Kit (TaKaRa company) by using the total RNA as a template, wherein the reaction system is as follows: oligo dT Primer 1ul, dNTP mix 1ul, RNA template 5ul, adding water to 10ul, keeping the temperature of the mixed solution at 65 ℃ for 5min, and rapidly cooling on ice; to the reaction solution were added 5 XPrimeScript Buffer 4. mu.l, RNase Inhibitor 0.5. mu.l, PrimeScript RTase 1. mu.l, RNase free dH ₂ O4.5 mul, slowly mixing the above reaction solution, reacting at 42 ℃ for 1h, and keeping the temperature at 95 ℃ for 5 min. Taking the reverse transcription first strand cDNA as a template, and amplifying by using primers SVA-AF and SVA-AR to obtain a first gene fragment A fragment; and (3) taking the reverse-transcribed first strand cDNA as a template, and amplifying by using primers SVA-BF and SVA-BR to obtain a second gene fragment B fragment. And amplifying by using primers SVA-CF and SVA-CR by using the reverse transcribed first strand cDNA as a template to obtain a third gene fragment C. The amplification was carried out by Q5 ultra-fidelity DNA polymerase (NEB), and PCR amplification products were purified and recovered, wherein the electrophoresis results of the amplification products are shown in FIG. 2, and A, B and C are A: 2544bp B, 3367bp C, 2386bp, which are consistent with the expected sizes, and the A, B gene fragments and the C gene fragments are respectively recovered by glue.

(2) A, B and C gene fragments recovered from the gel are cloned to pOK-CMV-Actin vector by a homologous recombination technology (NEB-uilder HiFi DNA Assembly Cloning Kit), transformed to DH5 alpha competent cells, and plated for identification. All the plaques are respectively identified by using primers of A, B and C fragments through PCR, a target band can be amplified, the sequencing result is all correct, and the positive rate is up to 100%, so that the eukaryotic transcription plasmid pOK-rSVA/HeB is obtained.

Example 2

The rescue process for recombinant senecavirus was as follows:

the recombinant plasmid pOK-rSVA/HeB obtained in example 1 was used to inoculate BHK-21 cells in a 6-well plate, transfection was performed when the cells grew to 80%, 3ug of the recombinant plasmid was transfected into BHK-21 cells under the mediation of X-tremeGENE HPDNAstrafection Reagent (Roche), and a transfection Reagent control and a normal cell control were set simultaneously, and the cells were placed in a chamber containing 5% CO ₂ Observing the cell state and the cytopathic condition in a 37 ℃ incubator, harvesting the virus when about 80-90% of cells have pathological changes, repeatedly freezing and thawing for 3 times, and then inoculating the BHK-21 cells again until the virus can stably produce the cytopathic changes, the cells become round and fall off, and a large amount of floating dead cells exist. The resulting recombinant virus was named rSVA-HeB, and in FIG. 3, A: pictures of normal control BHK-21 cells; b: the rescued recombinant virus rSVA/HeB infected BHK-21.

Example 3

Culture characteristics of recombinant seneca virus rSVA/HeB in different cells:

(1) the recombinant Seneca virus rSVA/HeB strain obtained from the rescue of example 2 infects PK-15 cells and causes typical cytopathic effect, which is similar to the culture characteristics of the wild parent strain SVA/HeB strain. The lesions caused by the rSVA/HeB strain on PK-15 cells are shown in FIG. 4, wherein A: normal control PK-15 cell pictures; b: the rescued recombinant virus rSVA/HeB infected PK-15.

(2) The recombinant Seneca virus rSVA/HeB strain obtained from the rescue of the example 2 is infected with IBRS-2 cells, and typical cytopathic effect can be observed, which is similar to the culture characteristics of the wild parent strain SVA/HeB strain. The lesions caused by the rSVA/HeB strain on IBRS-2 cells are shown in FIG. 5, where A: normal control IBRS-2 cell pictures; b: the rescued recombinant virus rSVA/HeB infected IBRS-2.

Example 4

The identification of the recombinant Seneca virus rSVA/HeB comprises the following steps:

(1) RT-PCR identification and genetic stability analysis results

Extracting total RNA from supernatant of BHK-21 cells infected by the stably passaged rSVA/HeB strain by a Trizol method, performing reverse transcription, and amplifying P1 and P2 genes, wherein primers for amplifying the P1 gene are as follows:

P1-F：5'-GTGGGAAGGTATCTTTCGTGCT-3'(SEQ ID NO.8)；

P1-R：5'-TCATAGTGGTGAGACTTTGGGC-3'(SEQ ID NO.9)；

the primers for amplifying the P2 gene are as follows:

P2F：5'-GCACACACGTGATGAGCCTT-3'(SEQ ID NO.10)；

P2R：5'-AGGGATGCCTAGGATTGCTT-3'(SEQ ID NO.11)；

the amplified fragment is purified and recovered and then sequenced, and the result shows that the obtained P1 gene is consistent with the reference sequence of the wild strain, and the Mlu I molecular marker of the silent mutation introduced into the P2 gene can be stably inherited.

(2) Indirect immunofluorescence assay

When the cell density reaches about 60%, infecting cells with the rSVA/HeB and SVA/HeB viruses in the embodiment 2, establishing a non-virus group, selecting a proper time point, abandoning virus liquid, washing 3 times with PBS, fixing the cells with 4% paraformaldehyde for 10-15 min, washing 3 times with PBS, treating the cells with 0.1% TritonX-100 for 15min, washing 3 times with PBS, adding an anti-SVAVP 3 monoclonal antibody, and incubating for 1h at 37 ℃ in a incubator; PBST is washed for 3 times, anti-mouse IgG marked by FITC is added, and incubation is carried out for 1h at 37 ℃; PBST was washed 3 times and observed under an inverted fluorescence microscope. As shown in FIG. 6, the results of fluorescence microscope observation show that A and B are BHK-21 cells infected with SVA/HeB and rSVA/HeB, respectively, and show stronger specific immunofluorescence, and some cells are full of cytoplasm; c is non-toxic BHK-21 cells, and the result shows that only weak non-specific fluorescence appears.

The embodiment shows that the invention successfully constructs the full-length infectious DNA clone of the A-type Seneca virus based on the eukaryotic double promoter, successfully constructs the infectious cDNA clone of the A-type Seneca virus based on the whole genome sequence determination of SVA/HeB, lays a foundation for further research and development of SVA pathogenesis, related vaccines and expression exogenous reporter genes, and has important scientific application value.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> university of agriculture in Hebei

<120> A type Seneca virus SVA/HeB full length infectious cDNA clone, preparation method and application thereof

<130> 2021.06.07

<141> 2021-06-17

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 99

<212> DNA

<213> Artificial sequence ()

<400> 1

catcattttg gcaaagtgtt aagcgtctga tgagtccgtg aggacgaaac tataggaaag 60

gaattcctat agtcttgaaa tggggggctg ggccctcat 99

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 2

aggtccaact agagttcaag cctatg 26

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 3

cacaaccaca gaccctttct gaa 23

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 4

tgcatttcca taagagagag cgctc 25

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 5

taggagcgag aatgcttatg acggc 25

<210> 6

<211> 123

<212> DNA

<213> Artificial sequence ()

<400> 6

taccagatct gaatcgccct cccttagcca tccgagtgga cgtgcgtcct ccttcggatg 60

cccaggtcgg accgcgagga ggtggagatg ccatgccgac ccttttccct tttctgttcc 120

gac 123

<210> 7

<211> 7312

<212> DNA

<213> Artificial sequence ()

<400> 7

tttgaaaggg ggggctgggc cctcatgccc agtccttcct ttccccttcc ggggggtaaa 60

ccggctgtgt ttgctagagg cacagaggag caacatccaa cctgcttttg tggggaacgg 120

tgcggctcca attcctgcgt cgccaaaggt gttagcgcac ccaaacggcg catctaccaa 180

tgctattggt gtggtctgcg agttctagcc tactcgtttc tcccctactc actcattcac 240

acacaaaaac tgtgttgtaa ctacaagatt tggccctcgc acgggatgtg cgataaccgc 300

aagattgact caagcgcgga aagcgctgta accacatgct gttagtccct ttatggctgt 360

gagatggcta tccacctcgg atcactgaac tggagctcga ccctccttag taagggaacc 420

gagaggcctt cctgcaacaa gctccgacac agagtccacg tgattgctac caccatgagt 480

acatggttct cccctctcga cccaggactt ctttttgaat atccacggct cgatccagag 540

ggtggggcat gatcccccta gcatagcgag ctacagcggg aactgtagct aggccttagc 600

gtgccttgga tactgcctga tagggcgacg gcctagtcgt gtcggttcta taggtagcac 660

atacaaatat gcagaactct catttttctt tcgatacagc ctctggcacc tttgaagacg 720

taaccggaac aaaagtcaag atcgttgaat accccagatc ggtgaacaat ggtgtttacg 780

attcgtccac tcatttagag atactgaacc tacagggtga aattgaaatt ttaaagtctt 840

tcaacgaata ccaaattcgc gccgccaaac aacaacttgg actggacatc gtatacgaac 900

tacagggtaa tgttcagaca acctcaaaga atgattttga ttcccgcggc aataatggta 960

acatgacctt caattactac gcaaacactt accagaattc agtagacttc tcgacctcct 1020

cgtcggcgtc aggcgccgga cccgggaact cccggggcgg attagcgggt ctcctcacaa 1080

atttcagtgg aatcttgaac cctcttggct acctcaaaga tcacaatacc gaagaaatgg 1140

aaaactctgc tgatcgagtc ataacgcaaa cggcgggcaa cactgccata aacacgcaat 1200

catcactggg tgtgttgtgt gcctacgttg aagacccgac caaatctgac cctccgtcca 1260

gcagcacaga tcaacccacc accactttta ctgccatcga caggtggtac actggacggc 1320

tcaattcttg gacaaaagct gtaaaaacct tctcttttca ggccgtcccg ctccctggag 1380

ccttcctgtc taggcaggga ggcctcaacg gaggggcctt cacggctacc ctacatagac 1440

atttcttaat gaagtgcggg tggcaagtgc aggtccaatg caatttgaca caattccacc 1500

aaggcgctct tcttgttgcc atggtccccg aaaccaccct tgatgtcaaa cctgacggca 1560

aggcaaagag cttacaagag ctgaatgaag agcagtgggt ggagatgtct gacgattacc 1620

ggaccgggaa aaacatgcct tttcagtctc ttggcactta ctatcggccc cctaactgga 1680

cttggggccc caatttcatc aacccctatc aagtaacagt cttcccacac caaattctga 1740

acgcgagaac ctctacctcg gtagacataa gtgtcccata catcggggag actcctacgc 1800

aatcctcaga gacacagaac tcctggaccc tcctcgttat ggtgcttgtc cccctggact 1860

acaaggaggg agccacaact gacccagaaa ttacattttc tgtaaggcct acaagtcctt 1920

acttcaatgg gcttcgcaac cgtttcacga ccgggacgga cgaggagcag gggcccattc 1980

ccacagcacc cagagaaaat tcgcttatgt ttctctcaac catccctgat gacactgttc 2040

ctgcttacgg gaatgtgcgt acccctcccg tcaattacct ccctggtgaa ataaccgacc 2100

tcttacaact ggcccgtata cccactctca tggcgtttgg gcgggtgtct gaacccgagc 2160

ctgcctcaga cgcatatgtg ccctacgttg ccgttcctgc ccagttcgac gacaagcctc 2220

tcatctcctt cccgatcacc ctttcagatc ctgtctacca gaacaccctg gtaggcgcca 2280

tcagttcgaa cttcgccaac taccgggggt gtatccaaat cactctgaca ttttgtggac 2340

ccatgatggc aagagggaaa ttcctgctct cgtattctcc cccaaatgga gcacaaccac 2400

agaccctttc tgaagctatg cagtgcacat actctatttg ggatataggc ttgaactcta 2460

gttggacctt tgtcatcccc tacatctcgc ctagtgatta ccgtgaaact cgggctatta 2520

ccaactcagt ttattctgct gatggttggt ttagcttgca caagctgacc aaaattactc 2580

taccacctga ctgcccacag agtccctgta ttctcttttt cgcctctgct ggtgaggatt 2640

acaccctccg cctccctgtt gattgtaatc cttcctacgt gttccactcc accgacaacg 2700

ccgagactgg ggttattgag gcaggtaaca ctgacaccga tttctctggt gaactggcgg 2760

ctcctggctc taaccatact aacgtcaaat tcctgtttga ccgatctcgg ctactgaatg 2820

taattaaggt actggagaag gacgccgtct tcccccgtcc tttccccaca gcaacaggta 2880

cacagcagga cgatggttac ttttgtcttc taacaccccg cccaacagtc gcttcccgac 2940

ccgccactcg tttcggcctg tacgtcaacc cgtctgacag tggcgttctc gctaacactt 3000

cactggattt caatttttac agtttggcct gtttcactta ctttagatca gaccttgaag 3060

tcacggtggt ctcactggag ccagatttgg aattcgccgt ggggtggttc ccctctggca 3120

gtgagtacca ggcttctagc tttgtctacg accaactgca tgtaccctac cacttttctg 3180

ggcgcactcc ccgcgctttc accagcaagg gtggaaaggt atctttcgtg ctcccttgga 3240

actctgtctc ttccgtgctt cccgtgcgct gggggggcgc ctccaagctt tcttctgcca 3300

cgcggggtct gccggctcat gctgactggg ggaccattta cgcctttatc ccccgtccta 3360

acgagaagaa aagcaccgct gtaaagcacg tggcggtgta cgttcggtac aagaacgcgc 3420

gtgcttggtg ccccagcatg cttccctttc gcagctacaa gcagaagatg ctgatgcaat 3480

caggcgacat cgagaccaac cctggccctg cttctgacaa cccaatcttg gagtttcttg 3540

aagcggaaaa cgatttagtc actctggcct ctctctggaa gatggtgcac tctgttcaac 3600

agacctggag aaagtacgtg aagaacgaca atttttggcc caacttgctc agtgagctag 3660

tgggggaagg ctccatcgcc ttggccgcca cgctatctaa ccaagcttca gtgaaagctc 3720

tcttgggcct gcattttctc tctcgagggc tcaattacac agatttttac tctttactga 3780

tagagaaatg ctctagtttc tttactgtag aaccgcctcc tccaccagct gaaaatctga 3840

tgaccaagcc ctccgtgaag tcgaaattcc gaaagctgtt taagatgcaa ggacccatgg 3900

acacagtcaa agactggaac caaatagccg ccggcttgaa gaatttccaa tttgttcgtg 3960

acctagtcaa ggaggtggtc gactggctcc aggcctggat caacaaagag aaagccagcc 4020

ctgtcctcca gtaccagctg gagatgaaga agctcgggcc cgtggctttg gctcatgatg 4080

ccttcatggc cggttccggg ccccctcttg gtgacgacca gattgaatac ctccagaacc 4140

tcaaatctct tgccctgaca ctgggaaaga ctaatttggc ccaaagtctc accactatga 4200

tcaatgccaa gcagagctcc gcccaacgag tcgaacccgt tgtggtggtc ctcagaggca 4260

agccgggatg cggcaaaagc ttggcctcca cgttgattgc ccaggctgtg tccaagcgtc 4320

tctacggctc gcaaagtgtg tattctcttc ctccggaccc agacttcttc gacggatata 4380

aaggacagtt tgtaaccttg atggacgatc tgggacaaaa cccggatggg caagatttct 4440

ccaccttttg tcagatggtg tcgaccgccc aatttcttcc caatatggcg gaccttgcag 4500

agaaggggcg tcccttcacc tccaatctta tcattgcaac tacaaacctc cctcacttta 4560

gccctgtcac cattgctgat ccttctgcag tctctcggcg tatcaactac gacctgactc 4620

tagaagtatc tgaggcttac aagaagcaca cacggctgaa tttcgacctg gctttcagac 4680

gcactgacgc cccccccatt tacccttttg ctgcccacgt gcccttcgtg gacgtggctg 4740

tgcgcttcaa aaatggtcat caaagcttca atctcctaga gttggtcgac tccatttgtg 4800

cagacattcg ggccaagcaa caaggtgccc gaaatatgca gactctggtt ctacagagcc 4860

ctaacgagaa cgacgacacc cccgtcgacg aggcgttggg tagagttctc acccccgctg 4920

cggtcgacga ggcgcttgtc gacctcgctc cagatgccga cccggttggc cgcttggcta 4980

ttctcgccaa gctaggtctt gccctagctg cggtcacccc tggtttgata atcttggcag 5040

tgggactcta caagtacttc tctggctctg atacagacca agaagaaaca gaaactgagg 5100

agcctgctaa agcgcctagg agcgagaatg cttatgacgg cccgaagaaa aactccaagc 5160

cccctggagc gctctctctt atggaaatgc aacagcccaa cgtggacatg ggctttgagg 5220

ctgcagttgc taagaaagtg gtcgtcccca ttaccttcat ggttcccaac agaccttctg 5280

gacttacaca gtccgctctt cttgtggccg gccggacctt cctaatcaat gagcatacat 5340

ggtccaaccc ctcctggacc agcttcacaa tccgtggtga ggtgcacact cgtgatgagc 5400

ctttccaaac ggttcatttt actcaccatg gtcttcccac agatctgatg atggtacgtc 5460

tcggaccggg caactctttc cctaacaatc tagacaagtt tggacttgac cagatgccgg 5520

cacgtaactc ccgtgtggtt ggcgtttcgg ctagttacgg taacttcttc ttctctggga 5580

acttcctcgg gtttgttgac tccatcacct ctgaccaagg aacctatgcg agacttttca 5640

ggtacagggt gacgacttac aagggatggt gcggttcggc cctggtctgt gaggccggtg 5700

gtgttcgacg cataattggc ctgcactctg ctggtgccgc tggtatcggc gccgggactt 5760

acatctcaaa attaggactg atcaaagccc ttaaacacct cggtgagcct ctggctacaa 5820

tgcaaggact gatgactgag ctagagcctg gagtcaccgt acacgtaccc cgaaaatcta 5880

aattgagaaa gacgaccgca cacgcggtgt acaaaccgga gtttgaacct gctgtgttgt 5940

caaaatttga tcccagactg aacaaggatg ttgacctaga tgaggtaatt tggtctaaac 6000

acaccgccaa cgtcccttat caacctcctt tgttttacac atacatgtca gagtacgctc 6060

atcgggtttt ctcctttttg ggaaaagaca atgacattct gaccgtcaaa gaagcaatcc 6120

taggcatccc tggactagac cctatggatc cccacacagc tccgggtctg ccctacgcca 6180

ttagcggtct tcgacgtact gatctcgtcg attttgcgaa cggcacggta gacccggcac 6240

tggccatgca gatccagaaa ttcttagacg gtgactactc tgaccatgtc ttccaaactt 6300

ttctgaaaga cgaaatcaga ccctcagaga aggtccgggc gggaaaaacc cgcattgtcg 6360

atgtgccctc cctggcgcac tgcatcgtgg gcagaatgct acttgggcgc tttgccgcca 6420

agtttcaatc ccatcctggc tttctccttg gctccgctat cgggtctgac cccgatgtct 6480

tctggaccgt cataggggct cagctcgagg gaagaaagaa cacgtatgac gtggactaca 6540

gtgcctttga ctcttcacac ggcactggct ccttcgaggc tctcatctct cactttttca 6600

ccgtggacaa tggtttcagc cctgcgctgg gaccgtatct cagatccctg gctgtctcgg 6660

tgcacgctta cggcgagcgt cgcatcaaga ttaccggagg cctcccctct ggttgtgccg 6720

cgaccagcct gctgaataca gtgctcaaca atgtgatcat caggactgct ctggcattga 6780

cctacaagga atttgaatat gacatggttg atatcatcgc ctacggtgac gaccttttgg 6840

ttggtacgga ttacgatctg gacttcaatg aggtggcgcg gcgcgctgcc aaactggggt 6900

ataagatgac tcctgccaac aagggttctg tcttccctcc gacttcctct ctctccgatg 6960

ctgtttttct aaaacgcaaa ttcgtccaaa acaacgacgg cttatataaa ccagttatgg 7020

atttaaagaa tttggaagcc atgctctcct acttcaaacc aggaacacta ctcgagaagc 7080

tgcaatctgt ttctatgttg gctcaacatt ctggaaaaga agaatatgat agattgatgc 7140

accccttcgc tgactacggt gccgtaccga gtcacgagta cctgcaggca agatggaggg 7200

ccttgttcga ctgacctgga tagcctaacg cgcttcggtg ctgccggcga ttctgggaga 7260

actcagtcgg aacagaaaag ggaaaaaaaa aaaaaaaaaa aaaaaaaaaa aa 7312

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 8

gtgggaaggt atctttcgtg ct 22

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 9

tcatagtggt gagactttgg gc 22

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 10

gcacacacgt gatgagcctt 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 11

agggatgcct aggattgctt 20

<210> 12

<211> 1622

<212> DNA

<213> Artificial sequence ()

<400> 12

gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60

gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120

ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180

ggactttcca ttgacgtcaa tgggtggact atttacggta aactgcccac ttggcagtac 240

atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300

cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360

tattagtcat cgctattacc atgggtcgag gtgagcccca cgttctgctt cactctcccc 420

atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 480

gcgatggggg cggggggggg ggggccgcgc gccagccggg gcggggcggg gcgaggggcg 540

gggcggggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 600

tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 660

gggagtcgct gcgttgcctt cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc 720

ccggctctga ctgaccgcgt tactcccaca ggtgagcggg cgggacggcc cttctcctcc 780

gggctgtaat tagcgcttgg tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag 840

ccttaaaggg ctccgggagg gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg 900

tgtgtgtgtg cgtggggagc gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg 960

cgggcgcggc gcggggcttt gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc 1020

ggtgccccgc ggtgcggggg ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg 1080

tgggggggtg agcagggggt gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc 1140

cctccccgag ttgctgagca cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc 1200

gcggggctcg ccgtgccggg cggggggtgg cggcaggtgg gggtgccggg cggggcgggg 1260

ccgcctcggg ccggggaggg ctcgggggag gggcgcggcg gccccggagc gccggcggct 1320

gtcgaggcgc ggcgagccgc agccattgcc ttttatggta atcgtgcgag agggcgcagg 1380

gacttccttt gtcccaaatc tggcggagcc gaaatctggg aggcgccgcc gcaccccctc 1440

tagcgggcgc gggcgaagcg gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt 1500

cgtgcgtcgc cgcgccgccg tccccttctc catctccagc ctcggggctg ccgcaggggg 1560

acggctgcct tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg 1620

gc 1622

Claims (1)

1. A method for constructing full-length infectious cDNA clone of A-type Selenecar virus SVA/HeB is characterized by comprising the following steps:

(1) transformation of the carrier: selecting a low-copy vector pOK12 as a vector constructed by cloning full-length infectious cDNA of an A-type senecan, and allowing CMV enhancer and beta-actin promoter sequences to pass throughSalI andHind III is cloned to the corresponding enzyme cutting site of the pOK12 vector to construct a low-copy plasmid pOK-CMV-Actin containing a double promoter;

(2) using cDNA of A-type Seneca virus SVA/HeB as a template, respectively designing and synthesizing three pairs of overlapping primers AF/AR, BF/BR and CF/CR covering SVA/HeB virus whole genome;

the nucleotide sequence of the AF is shown as SEQ ID NO. 1; the nucleotide sequence of the AR is shown as SEQ ID NO.2, and a first gene fragment A is obtained by amplification with a primer AF/AR; the nucleotide sequence of the BF is shown in SEQ ID NO. 3; the nucleotide sequence of the BR is shown as SEQ ID NO.4, and a primer BF/BR is used for amplification to obtain a second gene segment B segment; the nucleotide sequence of the CF is shown as SEQ ID NO. 5; the nucleotide sequence of CR is shown as SEQ ID NO.6, and a third gene segment C segment is obtained by amplification of a primer CF/CR;

(3) pOK-CMV-Actin is utilizedEcoR I linearization, cloning A, B and C segment of SVA genome into pOK-CMV-Actin vector through homologous recombination, and obtaining the recombinant plasmid pOK-rSVA/HeB.

Images