CN113684227B

CN113684227B - Rapid construction method and application of ACE2 humanized mouse model

Info

Publication number: CN113684227B
Application number: CN202110810638.1A
Authority: CN
Inventors: 孙瑞林; 王津津; 池骏; 慈磊
Original assignee: Guangdong Nanmo Biotechnology Co ltd; Shanghai Dishi Biotechnology Co ltd; Shanghai Model Organisms Center Inc
Current assignee: Guangdong Nanmo Biotechnology Co ltd; Shanghai Dishi Biotechnology Co ltd; Shanghai Model Organisms Center Inc
Priority date: 2021-07-19
Filing date: 2021-07-19
Publication date: 2022-11-29
Anticipated expiration: 2041-07-19
Also published as: CN113684227A

Abstract

The invention provides a transgenic vector, a method for quickly constructing an ACE2 humanized animal model by using the vector and application of the transgenic vector in research and development of a novel coronavirus SARS-CoV-2 medicament, wherein the transgenic vector comprises a PiggyBac transposon 5 'inverted repeat sequence (ITR), a CAG promoter, a human ACE2 coding region, a ribosome grafting site (IRES), firefly Luciferase (Luciferase), a woodchuck hepatitis post-transcription regulatory element (WPRE), a poly-adenylation (polyA) site and a 3' inverted repeat sequence (ITR), and the vector can efficiently insert human ACE2 and a Luciferase gene expression frame into a mouse genome, and can quickly screen and obtain a transgenic mouse expressed by Luciferase and human ACE2 through a Luciferase living body imaging system.

Description

Rapid construction method and application of ACE2 humanized mouse model

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to a rapid construction strategy of an ACE2 humanized mouse model and application thereof in research and development of novel coronavirus SARS-CoV-2 resistant therapeutic drugs.

Background

The current research and development of new coronavirus SARS-CoV-2 vaccines and antiviral drugs is still urgently needed.

Animal models are crucial for understanding the pathogenesis of the virus, vaccine development and drug screening. Therefore, the development of a novel animal model susceptible to the coronavirus SARS-CoV-2 is an important ring for the development of viral vaccines and antiviral drugs. Among various animal models, non-human primates (NHPs) are more similar to humans and have better prognostic significance for clinical outcome. However, the use of NHP animal models is limited by high cost, low numbers and high requirements for feeding facilities, and is not suitable for mass screening in the drug development phase. Therefore, a suitable small animal model is essential for research and development of antiviral therapies. Mouse models have been widely used to study the pathogenesis of human coronavirus because of their low cost, short breeding cycle, clear genetic background, and the ability to perform the corresponding gene editing and transformation. Human angiotensin converting enzyme II (ACE 2) has been identified as a functional receptor for SARS-CoV virus causing atypical pneumonia and SARS-CoV-2 virus infected cells this time. However, previous studies have shown that SARS-CoV-2 can bind to ACE2 cell receptors of humans, bats or cats, infecting cells; but not to bind ACE2 in mice themselves. Previous mouse models prepared with SARS-CoV virus showed that SARS-CoV virus has poor replication in mice, and infection models need to be constructed by serial passaging to adapt or prepare transgenic mice expressing human ACE2. Therefore, based on the presumption of a receptor of cellular function common to both, it is likely that both pathways are also required for the establishment of a mouse model of susceptibility to SARS-CoV-2 virus. However, the SARS-CoV-2 virus strain adapting to the mouse is obtained by screening the virus in a mouse continuous passage method, and the method for establishing the susceptible model has long period, high failure rate and high requirements on experimental conditions, can be carried out in a BSL3 laboratory, and is not beneficial to the rapid establishment and development of the model; expressing humanized ACE2 in a mouse by a conventional transgenic mode, wherein the process of strain establishment, expression identification and the like is usually carried out, and the time is at least 9-12 months; the humanized ACE2 is expressed in a mouse by a gene editing mode, because the gene editing is influenced by the size of an insert fragment, the difficulty of carrying out complex genetic operation is high, and meanwhile, the strain also needs to be subjected to strain building, expression verification and the like, and the preparation period is not less than 9-12 months. Therefore, if a corresponding model is not prepared in the early stage, it is difficult to prepare a desired animal model in a short time for an outbreak of an epidemic.

In view of this, establishing a mouse model susceptible to SARS-CoV-2 virus, which can be obtained rapidly, is of great significance for studying the spread and pathogenesis of SARS-CoV-2 and evaluating the efficacy of vaccines and drugs.

Disclosure of Invention

The invention aims to provide a method for quickly constructing an ACE2 humanized animal (preferably a mammal, preferably a mouse) model and application thereof in research and development of a medicine for aiming at a novel coronavirus SARS-CoV-2. The method utilizes a Piggybac transposon system to efficiently insert a humanized ACE2 and luciferase gene expression frame into a mouse genome; a luciferase living imaging system can be used for rapidly screening to obtain a transgenic mouse expressed by luciferase and humanized ACE 2; the transgenic mouse expressed by the human ACE2 is a susceptible model of SARS-CoV-2 and can be applied to the evaluation of the effects of medicaments and vaccines aiming at the SARS-CoV-2.

Transposons (transposons) are a class of mobile genetic elements that can alter the position of insertion in a host genome, and their transposition activity can introduce foreign genes into the recipient genome. The PiggyBac (PB) transposon system belongs to one of DNA transposons, and has the advantages of high transposition efficiency, large load capacity and the like. Previous studies have shown that PB transposition systems have been demonstrated to transpose efficiently in mammalian cells and mice, and PB transposon-mediated transgenic mice have been successfully generated.

Luciferase (Luciferase) is a generic name of enzymes capable of generating bioluminescence in nature, and takes a commonly used Luciferase (firefly Luciferase) as an example, which can take luciferin (Luciferase) as a substrate to catalyze the oxidation reaction of the substrate to generate reflected light, and the emitted light can be captured by an imaging system equipped with a high-sensitivity CCD camera. Thus, the intensity of the fluorescence can be captured by the imaging system in response to the amount of luciferase expressed. Bioluminescence based on luciferase does not need exciting light, has strong specificity, is less absorbed by tissues, has no self luminescence in an animal body, and has the advantages of low background and high signal to noise ratio; by the living body imaging system, the observation can be carried out in a living body state of the animal by adopting a non-invasive method.

The specific method for constructing the ACE2 humanized mouse model comprises the following steps: the construction of the Piggybac transgenic vector is shown in figure 1, and the vector structure sequentially comprises a Piggybac transposon 5 'terminal Inverted Terminal Repeat (ITR), a CAG promoter, a human ACE2 coding region, an Internal Ribosome Entry Site (IRES), luciferase (Luciferase), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a poly A (polyA) site and a 3' terminal Inverted Terminal Repeat (ITR) from left to right. The strategy adopts a CAG strong promoter to drive the expression of human ACE2, the CAG promoter comprises an enhancer sequence of a CMV virus promoter, a chicken beta-actin promoter and a rabbit beta-Globin splicing acceptor, the CAG promoter is a strong promoter for the broad-spectrum expression of various tissues and organs, the promoter can drive the human ACE2 to be widely expressed in various tissues, and the SARS-CoV-2 can be conveniently infected with various tissues and organs; in the strategy, ACE2 and Luciferase are connected in series through an IRES element and are driven by the same CAG promoter, the expression of human ACE2 can be deduced through the expression of the Luciferase, the expression of the Luciferase can be directly detected under a living imaging system through the administration of a fluorescein substrate, and therefore the expression of the ACE2 can be directly detected in a mode of detecting the expression of the Luciferase through the living imaging system, and transgenic mice expressing the human ACE2 are screened out for subsequent virus infection and efficacy evaluation experiments. Construction of ACE2 transgenic mice the ACE2 expressing mouse model obtained by screening from fertilized egg injection only needs 2 months to achieve rapid construction.

Drawings

For a clearer explanation of the embodiments of the present invention or technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention, and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to these drawings without creative efforts.

Figure 1 shows the strategy for constructing the ace2 humanized mouse model and the vector information. FIG. A is a schematic diagram of the construction strategy of an ACE2 humanized mouse model; FIG. B is a schematic diagram of the constructed transgenic mouse vector; FIG. C shows the digestion result of the constructed vector.

Figure 2 construction of acee 2 humanized mouse model. FIG. A is a gel electrophoresis representation of the F0 generation genotype identification PCR product of an ACE2 humanized mouse (the number is the mouse number; M is 1kb DNA marker); the picture B is a representative picture of living body imaging of the genotype identification positive F0-generation mouse, the left picture is a shooting result of the back of the mouse, and the right picture is a shooting result of the abdomen of the mouse (the number is the serial number of the mouse); figure C is Luciferase in vivo imaging widely expressed in mice # 22 dissected each tissue as a result of Luciferase imaging; panel D shows Western Blot results for ACE2 protein for various tissues of mice expressing Luciferase (+ mice positive for Luciferase expression, wild type mice).

FIG. 3: the result of infection of the ACE2 humanized mouse with SARS-CoV-2 virus (C57-WT is a wild type mouse,

TG-hACE2 is ACE2 humanized mouse).

FIG. 4 is a schematic view of: ACE2 humanized mice evaluated the protective effects of SARS-CoV-2 neutralizing antibodies (i.e., neutralizing antibodies to ACE 2) against the toxin. FIG. A is a graph showing the body weight changes of mice in groups at different times of SARS-CoV-2 virus infection; FIG. B is a graph showing the survival curves of groups of mice infected with SARS-CoV-2 virus at different times; and the graph C shows the detection result of the lung tissue virus content of each group of surviving mice 5 days after SARS-CoV-2 virus infection.

Detailed Description

Example one

Construction of an ACE2 humanized mouse model.

1) Constructing a Piggybac transgenic vector: the sequence of the Inverted Terminal Repeat (ITR) at the 5 'end of the PiggyBac transposon, the CAG promoter, the coding region of the human ACE2, the Internal Ribosome Entry Site (IRES), the Luciferase (Luciferase), the regulatory element after transcription (WPRE) of the woodchuck hepatitis virus, the poly A site and the Inverted Terminal Repeat (ITR) at the 3' end are SEQ ID NO:1-8 in sequence. The CAG promoter is obtained by PCR amplification by taking plvct-tTR-KRAB plasmid as a template, and the rest fragments are obtained by whole gene synthesis. In the construction process, firstly connecting two ITRs and enzyme cutting sites into a PBR322 carrier by an In-Fusion method to obtain a PBR322-ITR skeleton carrier; and then connecting the CAG promoter, the synthesized human ACE2 fragment and the IRES-Luciferase-WPRE-polyA into the PBR322-ITR skeleton vector In an In-Fusion manner to obtain the final PBR322-ITR-ACE2 transgenic vector. After the vector is subjected to enzyme digestion and sequencing verification to be correct, subsequent preparation of the transgenic mouse is carried out, and the enzyme digestion result of the vector is shown in FIG. 1C.

2) Construction of ACE2 transgenic mice: fertilized eggs of a C57BL/6 mouse are taken, after PBR322-ITR-ACE2 plasmid and transposase Pbase mRNA are mixed according to the method in the mouse embryo operation handbook (third edition), fertilized egg microinjection is carried out, the injected fertilized eggs are temporarily cultured by a culture box and then transplanted to an oviduct of a recipient female mouse, and a genetically modified mouse F0 generation mouse is obtained. After the birth of the F0 generation mouse, the tail of the mouse is cut to extract a genome, PCR upstream and downstream primers are respectively designed aiming at ACE2 and Luciferase, and the genotype of the F0 generation mouse is identified through PCR. The PCR identification conditions were as follows

Primer name	Sequence information (5 '→ 3')
		ACE2-For	ATAGTGGTTGGCATTGTCATCC(SEQ ID NO:9)
ACE2-Rev	TCCAGCGGTTCCATCTTCC(SEQ ID NO:10)

PCR reaction composition	Volume (μ l)
		ddH2O	31
PCR Buffer	10
		2.5mM dNTP	4
ACE2-For	1
		ACE2-Rev	1
DNA Polymerase	2
		genomic DNA	1
In total	50

Step (ii) of	Temperature (. Degree. C.)	Time	Remarks to note
				1	98	2min
2	98	15sec
				3	60	15sec
4	68	1min	Repeat steps 2-4 for a total of 34 cycles
				5	68	5min
6	12	10min

Representative results of PCR identification are shown in FIG. 2A, and according to the results of PCR identification, xx positive mice in the F0 generation were found in xx positive mice, and the positive rate of the mice was about 30%.

3) And (3) verifying expression of Luciferase and ACE 2: in order to verify the expression of Luciferase in mice positive for genotype identification, the in vivo imaging detection is carried out on the positive mice, and the brief process is as follows: after the hairs on the abdomen and the back of the mouse are shaved off, D-Luciferase (150 ul/mouse, the concentration is 15 mg/ml) is injected into the abdominal cavity, the mouse is anesthetized after 5 minutes of injection, after 10 minutes of injection, the mouse is placed into an in vivo imaging system (IVIS luminea) for detection, luciferase fluorescent signals of mice in different body positions are collected, a representative result is shown in fig. 2B, the result shows that 6 mice in 10 positive mice for genotype identification can detect strong Luciferase fluorescent signals, 2 mice can detect relatively weak fluorescent signals, and the expression rate of the Luciferase is about 80%; to further confirm the expression of Luciferase in each tissue of transgenic mice, the inventors selected one of the mice for dissection and imaged the fluorescence expression of each tissue, and the results are shown in fig. 2C and show that: similar to the results of the whole animal imaging, active expression of Luciferase was detected in each tissue of positive mice. According to theory, because ACE2 and Luciferase are driven by the same CAG promoter and are connected in series through IRES, the expression amount of the Luciferase can reflect the expression of the ACE2, in order to verify the expression of the ACE2 protein in a Luciferase positive mouse, western Blot detection is carried out on the expression of the ACE2 protein in a main tissue of the Luciferase positive mouse by the inventor, and the result is shown in FIG. 2D, the active expression of the ACE2 can be detected in the main tissue of the Luciferase positive mouse, and the expression of human-derived ACE2 cannot be detected in a wild-type mouse. Therefore, the Luciferase can be used as an ACE2 expression detection index, and the ACE2 protein expression of an F0 generation ACE2 transgenic mouse can be rapidly screened in a living state by using a living imaging system.

Example two

Construction of ACE2 humanized mouse SARS-CoV-2 virus susceptibility model

The infection and detection experiment of ACE2 humanized mouse SARS-CoV-2 virus is completed in a biosafety tertiary laboratory (BSL-3), 5F 0 generation mice with positive expression detection of Luciferase and 5 wild type C57BL/6 mice are treated in a biosafety cabinet by dripping 50 mu L (4.15 multiplied by 10) of the virus into the nose ⁴ PFU) SARS-CoV-2 virus solution is dropped into the nasal cavity of the mouse, after 4 days of infection, the lung tissue of the mouse is taken, RNA is extracted for reverse transcription, and then real-time fluorescence quantitative PCR (Realtime PCR) is carried out to detect the content of SARS-CoV-2 virus in the lung tissue of different groups of mice, the result is shown in figure 3, and the result shows that: after 4 days of SARS-CoV-2 virus infection, the virus content in lung tissue of the ACE2 humanized mouse with positive expression of Luciferase is about 1000 times that of the wild type mouse, which indicates that the ACE2 humanized mouse is susceptible to SARS-CoV-2 virus of new coronary pneumonia.

EXAMPLE III

The protective effect of SARS-CoV-2 neutralizing antibodies was evaluated using ACE2 humanized mice.

After infection administration, the state and the weight of the mice are recorded every day, after 5 days of infection, the lung tissues of the living mice are taken and stored, RNA is extracted for reverse transcription, and then Realtime PCR is carried out, and the content of SARS-CoV-2 virus in the lung tissues of different groups of mice is detected. The results of the experiment are shown in fig. 4, and show that: after viral infection, the body weights of all 4 groups of mice were significantly reduced; the mice administered with the high-dose neutralizing antibody still survive for 5 days after infection, the survival rate of the medium-dose administration is 80%, the survival rates of the control group and the low-dose group are 50% and 40% respectively, and the state of the mice is poor; compared with the control group, the lung tissue virus content of the survival mice of the medium-dose and high-dose administration groups is obviously lower than that of the survival mice of the control group. The results show that in the SARS-CoV-2 challenge experiment of the ACE2 humanized mouse, the administration of a neutralizing antibody with medium dose and high dose can effectively avoid the death of the humanized mouse and the replication of the virus in vivo caused by SARS-CoV-2 infection, which indicates that the ACE2 humanized mouse can be applied to the in vivo effect evaluation of the SARS-CoV-2 neutralizing antibody, vaccine and other potential drugs.

In conclusion, the inventor provides a method for quickly constructing an ACE2 humanized mouse model, a positive transgenic mouse expressing ACE2 can be quickly screened out by utilizing the efficient transgenosis of a Piggybab transposase system to an ACE2 gene and combining a luciferase reporter gene and a living body imaging system, and the construction can be completed only in 2-3 months by carrying out related application in the F0 generation; meanwhile, the inventor develops the research of in vivo efficacy verification of the anti-SARS-CoV-2 virus medicine by the ACE2 humanized mouse, and provides an application scene of researching and developing the anti-SARS-CoV-2 virus medicine by using the model.

Sequence listing

<110> Shanghai's Square model Biotech Co., ltd

Shanghai Yushi Biological Technology Co., Ltd.

Guangdong Nanmo Biological Technology Co., Ltd.

<120> quick construction method of ACE2 humanized mouse model and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 238

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccctagaaag ataatcatat tgtgacgtac gttaaagata atcatgcgta aaattgacgc 60

atgtgtttta tcggtctgta tatcgaggtt tatttattaa tttgaataga tattaagttt 120

tattatattt acacttacat actaataata aattcaacaa acaatttatt tatgtttatt 180

tatttattaa aaaaaaacaa aaactcaaaa tttcttctat aaagtaacaa aactttta 238

<210> 2

<211> 1620

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctagttatta atagtaatca attacggggt cattagttca tagcccatat atggagttcc 60

gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat 120

tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc 180

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 240

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt 300

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 360

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 420

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 480

ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc ggggcggggc gaggcggaga 540

ggtgcggcgg cagccaatca gagcggcgcg ctccgaaagt ttccttttat ggcgaggcgg 600

cggcggcggc ggccctataa aaagcgaagc gcgcggcggg cgggagtcgc tgcgttgcct 660

tcgccccgtg ccccgctccg cgccgcctcg cgccgcccgc cccggctctg actgaccgcg 720

ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa ttagcgcttg 780

gtttaatgac ggctcgtttc ttttctgtgg ctgcgtgaaa gccttaaagg gctccgggag 840

ggccctttgt gcggggggga gcggctcggg gggtgcgtgc gtgtgtgtgt gcgtggggag 900

cgccgcgtgc ggcccgcgct gcccggcggc tgtgagcgct gcgggcgcgg cgcggggctt 960

tgtgcgctcc gcgtgtgcgc gaggggagcg cggccggggg cggtgccccg cggtgcgggg 1020

gggctgcgag gggaacaaag gctgcgtgcg gggtgtgtgc gtgggggggt gagcaggggg 1080

tgtgggcgcg gcggtcgggc tgtaaccccc ccctgcaccc ccctccccga gttgctgagc 1140

acggcccggc ttcgggtgcg gggctccgtg cggggcgtgg cgcggggctc gccgtgccgg 1200

gcggggggtg gcggcaggtg ggggtgccgg gcggggcggg gccgcctcgg gccggggagg 1260

gctcggggga ggggcgcggc ggccccggag cgccggcggc tgtcgaggcg cggcgagccg 1320

cagccattgc cttttatggt aatcgtgcga gagggcgcag ggacttcctt tgtcccaaat 1380

ctggcggagc cgaaatctgg gaggcgccgc cgcaccccct ctagcgggcg cggggcgaag 1440

cggtgcggcg ccggcaggaa ggaaatgggc ggggagggcc ttcgtgcgtc gccgcgccgc 1500

cgtccccttc tccctctcca gcctcggggc tgtccgcggg gggacggctg ccttcggggg 1560

ggacggggca gggcggggtt cggcttctgg cgtgtgaccg gcggctctag agcctctgct 1620

<210> 3

<211> 2418

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc tcagtccacc 60

attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga agacctgttc 120

tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga gaatgtccaa 180

aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc cacacttgcc 240

caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct gcaggctctt 300

cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa cacaattcta 360

aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa tccacaagaa 420

tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga ctacaatgag 480

aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag gccattatat 540

gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga ggactatggg 600

gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta cagccgcggc 660

cagttgattg aagatgtgga acataccttt gaagagatta aaccattata tgaacatctt 720

catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag tccaattgga 780

tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa tctgtactct 840

ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat ggtggaccag 900

gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc tgttggtctt 960

cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg aaatgttcag 1020

aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag gatccttatg 1080

tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg gcatatccag 1140

tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa tgaaggattc 1200

catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca tttaaaatcc 1260

attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa cttcctgctc 1320

aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga gaagtggagg 1380

tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg gtgggagatg 1440

aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata ctgtgacccc 1500

gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac aaggaccctt 1560

taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg ccctctgcac 1620

aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat gctgaggctt 1680

ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa gaacatgaat 1740

gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga ccagaacaag 1800

aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag catcaaagtg 1860

aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga caatgaaatg 1920

tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa agtaaaaaat 1980

cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc aagaatctcc 2040

tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag aactgaagtt 2100

gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct gaatgacaac 2160

agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc ccctgtttcc 2220

atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat tgtcatcctg 2280

atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg agaaaatcct 2340

tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa cactgatgat 2400

gttcagacct ccttttag 2418

<210> 4

<211> 585

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60

gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120

ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180

gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240

aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360

acgttgtgag ttggatagtt gtggaaagag tcaaatggct ctcctcaagc gtattcaaca 420

aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480

gcacatgctt tacatgtgtt tagtcgaggt taaaaaaacg tctaggcccc ccgaaccacg 540

gggacgtggt tttcctttga aaaacacgat gataatatgg ccaca 585

<210> 5

<211> 1653

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatccgct ggaagatgga 60

accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt 120

gcttttacag atgcacatat cgaggtggac atcacttacg ctgagtactt cgaaatgtcc 180

gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta 240

tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt 300

gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgggcatt 360

tcgcagccta ccgtggtgtt cgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa 420

aaaaagctcc caatcatcca aaaaattatt atcatggatt ctaaaacgga ttaccaggga 480

tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat 540

tttgtgccag agtccttcga tagggacaag acaattgcac tgatcatgaa ctcctctgga 600

tctactggtc tgcctaaagg tgtcgctctg cctcatagaa ctgcctgcgt gagattctcg 660

catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt 720

gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt 780

cgagtcgtct taatgtatag atttgaagaa gagctgtttc tgaggagcct tcaggattac 840

aagattcaaa gtgcgctgct ggtgccaacc ctattctcct tcttcgccaa aagcactctg 900

attgacaaat acgatttatc taatttacac gaaattgctt ctggtggcgc tcccctctct 960

aaggaagtcg gggaagcggt tgccaagagg ttccatctgc caggtatcag gcaaggatat 1020

gggctcactg agactacatc agctattctg attacacccg agggggatga taaaccgggc 1080

gcggtcggta aagttgttcc attttttgaa gcgaaggttg tggatctgga taccgggaaa 1140

acgctgggcg ttaatcaaag aggcgaactg tgtgtgagag gtcctatgat tatgtccggt 1200

tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct 1260

ggagacatag cttactggga cgaagacgaa cacttcttca tcgttgaccg cctgaagtct 1320

ctgattaagt acaaaggcta tcaggtggct cccgctgaat tggaatccat cttgctccaa 1380

caccccaaca tcttcgacgc aggtgtcgca ggtcttcccg acgatgacgc cggtgaactt 1440

cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat 1500

tacgtcgcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac 1560

gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagaga gatcctcata 1620

aaggccaaga agggcggaaa gatcgccgtg taa 1653

<210> 6

<211> 588

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcaacctctg gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc 60

ttttacgcta tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat 120

ggctttcatt ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg 180

gcccgttgtc aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg 240

ttggggcatt gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat 300

tgccacggcg gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt 360

gggcactgac aattccgtgg tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc 420

ctgtgttgcc acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa 480

tccagcggac cttccttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg 540

ccttcgccct cagacgagtc ggatctccct ttgggccgcc tccccgca 588

<210> 7

<211> 232

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctagagctcg ctgatcagcc tcgactgtgc cttctagttg ccagccatct gttgtttgcc 60

cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 120

atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 180

ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg ga 232

<210> 8

<211> 309

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gatatctata acaagaaaat atatatataa taagttatca cgtaagtaga acatgaaata 60

acaatataat tatcgtatga gttaaatctt aaaagtcacg taaaagataa tcatgcgtca 120

ttttgactca cgcggtcgtt atagttcaaa atcagtgaca cttaccgcat tgacaagcac 180

gcctcacggg agctccaagc ggcgactgag atgtcctaaa tgcacagcga cggattcgcg 240

ctatttagaa agagagagca atatttcaag aatgcatgcg tcaattttac gcagactatc 300

tttctaggg 309

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atagtggttg gcattgtcat cc 22

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tccagcggtt ccatcttcc 19

Claims

1. A transgenic vector comprises a 5 'end inverted terminal repetitive sequence (ITR), a CAG promoter, a human ACE2 coding region, a luciferase coding region and a 3' end inverted terminal repetitive sequence (ITR) of a PiggyBac transposon from 5 'end to 3' end in sequence.

2. The transgenic vector of claim 1, further comprising a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and/or a poly a (polyA) site.

3. The transgenic vector of any one of claims 1-2, wherein the luciferase is a firefly luciferase.

4. The transgenic vector of claim 3, comprising, in order from 5 'to 3', a PiggyBac transposon Inverted Terminal Repeat (ITR) at 5', a CAG promoter, a human ACE2 coding region, an Internal Ribosome Entry Site (IRES), a firefly luciferase coding region, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a poly A (polyA) site, and an Inverted Terminal Repeat (ITR) at 3'.

5. A method of constructing a humanized mouse model of ACE2, comprising introducing the transgenic vector of any one of claims 1 to 4 into a mouse.

6. Use of the transgenic vector of any one of claims 1 to 4 or the mouse model constructed by the method of claim 5 for evaluating drugs associated with SARS-CoV-2 virus infection.

7. The use according to claim 6, wherein the medicament is an antibody or vaccine.