CN113684227A

CN113684227A - Rapid construction method and application of ACE2 humanized mouse model

Info

Publication number: CN113684227A
Application number: CN202110810638.1A
Authority: CN
Inventors: 孙瑞林; 王津津; 池骏; 慈磊
Original assignee: Guangdong Nanmo Biotechnology Co ltd; Shanghai Dishi Biotechnology Co Ltd; Shanghai Model Organisms Center Inc
Current assignee: Guangdong Nanmo Biotechnology Co ltd; Shanghai Dishi Biotechnology Co Ltd; Shanghai Model Organisms Center Inc
Priority date: 2021-07-19
Filing date: 2021-07-19
Publication date: 2021-11-23
Anticipated expiration: 2041-07-19
Also published as: CN113684227B

Abstract

The invention provides a transgenic vector, a method for quickly constructing an ACE2 humanized animal model by using the vector and application of the transgenic vector in research and development of a medicine for a novel coronavirus SARS-CoV-2, wherein the transgenic vector comprises a PiggyBac transposon 5 'inverted repeat sequence (ITR), a CAG promoter, a human ACE2 coding region, a ribosome grafting site (IRES), firefly Luciferase (Luciferase), a woodchuck hepatitis post-transcription regulatory element (WPRE), a poly-adenylation (polyA) site and a 3' inverted repeat sequence (ITR), the vector can efficiently insert human ACE2 and a Luciferase gene expression frame into a mouse genome, and a transgenic mouse expressed by the human ACE2 can be quickly screened by using a living body imaging system.

Description

Rapid construction method and application of ACE2 humanized mouse model

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to a rapid construction strategy of an ACE2 humanized mouse model and application thereof in research and development of novel coronavirus SARS-CoV-2 resistant therapeutic drugs.

Background

The current development of new coronavirus SARS-CoV-2 vaccines and antiviral drugs is still in urgent need.

Animal models are crucial for understanding the pathogenesis of the virus, vaccine development and drug screening. Therefore, the development of a novel animal model susceptible to the coronavirus SARS-CoV-2 is an important ring for the development of viral vaccines and antiviral drugs. Among various animal models, non-human primates (NHPs) are more similar to humans and have a better prognosis for clinical outcome. However, the use of NHP animal models is limited by high cost, low volume and high requirements for feeding facilities, and is not suitable for mass screening in the drug development phase. Therefore, a suitable small animal model is essential for research and development of antiviral therapies. Mouse models have been widely used to study the pathogenesis of human coronavirus because of their low cost, short breeding cycle, clear genetic background, and the ability to perform the corresponding gene editing and transformation. Human angiotensin converting enzyme II (ACE 2) has been identified as a functional receptor for SARS-CoV virus causing atypical pneumonia and SARS-CoV-2 virus infected cells this time. However, previous studies have shown that SARS-CoV-2 can bind to ACE2 cell receptors of humans, bats or cats, infecting cells; but not to bind ACE2 in mice themselves. Previous mouse models prepared with SARS-CoV virus showed that SARS-CoV virus has poor replication in mice, and infection models need to be constructed by serial passaging to adapt or prepare transgenic mice expressing human ACE 2. Therefore, based on the presumption of cell function receptors common to both, it is likely that both pathways are also required for the establishment of mouse models susceptible to SARS-CoV-2 virus. However, the SARS-CoV-2 virus strain adapting to the mouse is obtained by screening the virus in a mouse continuous passage method, and the method for establishing the susceptible model has the advantages of long period, high failure rate and high requirements on experimental conditions, can be carried out in a BSL3 laboratory, and is not beneficial to the rapid establishment and development of the model; expressing humanized ACE2 in mice by a conventional transgenic mode, wherein the expression generally needs at least 9-12 months through strain establishment, expression identification and other processes; the humanized ACE2 is expressed in mice by a gene editing mode, because the gene editing is influenced by the size of an insert, the difficulty of carrying out complex genetic operation is high, and meanwhile, the strain also needs to be subjected to strain building, expression verification and the like, and the preparation period is not less than 9-12 months. Therefore, if a corresponding model is not prepared in the early stage, it is difficult to prepare a desired animal model in a short time for an outbreak of an epidemic.

In view of this, establishing a mouse model susceptible to SARS-CoV-2 virus, which can be obtained rapidly, is of great significance for studying the spread and pathogenesis of SARS-CoV-2 and evaluating the efficacy of vaccines and drugs.

Disclosure of Invention

The invention aims to provide a method for quickly constructing an ACE2 humanized animal (preferably a mammal, preferably a mouse) model and application thereof in research and development of a medicine for aiming at novel coronavirus SARS-CoV-2. The method utilizes a Piggybac transposon system to efficiently insert the humanized ACE2 and luciferase gene expression frame into a mouse genome; the transgenic mice expressed by luciferase and humanized ACE2 can be rapidly screened and obtained by a luciferase living body imaging system; the transgenic mouse expressed by the human ACE2 is a susceptible model of SARS-CoV-2, and can be applied to the evaluation of the effects of medicines and vaccines aiming at SARS-CoV-2.

Transposons (transposons) are a class of mobile genetic elements that can alter the position of insertion in a host genome, and their transposition activity can introduce foreign genes into the recipient genome. The PiggyBac (PB) transposon system belongs to one of DNA transposons and has the advantages of high transposition efficiency, large load capacity and the like. Previous studies have shown that PB transposition systems have been demonstrated to transpose efficiently in mammalian cells and mice, and PB transposon-mediated transgenic mice have been successfully generated.

Luciferase (Luciferase) is a generic name of enzymes capable of generating bioluminescence in nature, and takes a commonly used Luciferase (firefly Luciferase) as an example, which can take luciferin (Luciferase) as a substrate to catalyze the oxidation reaction of the substrate to generate reflected light, and the emitted light can be captured by an imaging system equipped with a high-sensitivity CCD camera. Therefore, the intensity of fluorescence can be captured by the imaging system in response to the amount of luciferase expressed. The luciferase-based bioluminescence does not need exciting light, has strong specificity, is less absorbed by tissues, has no self luminescence in animal bodies, and has the advantages of low background and high signal to noise ratio; by the living body imaging system, the observation can be carried out in a living body state of the animal by adopting a non-invasive method.

The specific method for constructing the ACE2 humanized mouse model comprises the following steps: the construction of the Piggybab transgenic vector is shown in figure 1, and the vector structure sequentially comprises a Piggybab transposon 5 'terminal inverted repeat sequence (ITR), a CAG promoter, a human ACE2 coding region, a ribosome inoculation site (IRES), a firefly Luciferase (Luciferase), a woodchuck hepatitis post-transcriptional regulatory element (WPRE), a polyadenylation (polyA) site and a 3' terminal inverted repeat sequence (ITR) from left to right. The strategy adopts CAG strong promoter to drive the expression of human ACE2, the CAG promoter comprises enhancer sequence of CMV virus promoter, chicken beta-actin promoter and rabbit beta-Globin splice acceptor, the promoter is a strong promoter with wide-spectrum expression of various tissues and organs, the promoter can drive human ACE2 to be widely expressed in various tissues, and SARS-CoV-2 is convenient to infect various tissues and organs; according to the strategy, ACE2 and Luciferase are connected in series through IRES elements and are driven by the same CAG promoter, the expression of human ACE2 can be deduced through the expression of the Luciferase, the expression of the Luciferase can be directly detected under a living imaging system through giving a fluorescein substrate, and therefore the expression of ACE2 can be directly detected through a mode of detecting the expression of the Luciferase by the living imaging system, and transgenic mice expressing human ACE2 are screened out for subsequent virus infection and efficacy evaluation experiments. Construction of ACE2 transgenic mice the injection of fertilized eggs to a mouse model screened for ACE2 expression only requires 2 months to achieve rapid construction.

Drawings

For a clearer explanation of the embodiments of the present invention or technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention, and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to these drawings without creative efforts.

FIG. 1 construction strategy and vector information for the ACE2 humanized mouse model. FIG. A is a schematic diagram of the construction strategy of an ACE2 humanized mouse model; FIG. B is a schematic diagram of the constructed transgenic mouse vector; FIG. C shows the restriction enzyme digestion result of the constructed vector.

FIG. 2 construction of a humanized mouse model of ACE 2. FIG. A is a gel electrophoresis representation of the genotype identification PCR product of the generation F0 of an ACE2 humanized mouse (the number is the mouse number; M is 1kb DNA marker); the picture B is a representative picture of living body imaging of the genotype-identified positive F0-generation mouse, the left picture is the shooting result of the back of the mouse, and the right picture is the shooting result of the abdomen of the mouse (the number is the serial number of the mouse); FIG. C shows the Luciferase imaging results of dissected tissues of No. 22 mouse widely expressed in Luciferase in vivo imaging; panel D shows Western Blot results for ACE2 protein for various tissues of mice expressing Luciferase (+ mice positive for Luciferase expression, -wild type mice).

FIG. 3: the result of infection of humanized mouse with ACE2 with SARS-CoV-2 virus (wild type mouse for C57-WT and humanized mouse for ACE2 for TG-hACE 2).

FIG. 4: ACE2 humanized mice evaluated the protective effects of SARS-CoV-2 neutralizing antibodies (i.e., neutralizing antibodies against ACE 2) in challenge experiments. FIG. A is a graph showing the body weight changes of mice in groups at different times of SARS-CoV-2 virus infection; FIG. B is a graph showing the survival curves of groups of mice infected with SARS-CoV-2 virus at different times; and the graph C shows the detection result of the lung tissue virus content of each group of mice survived 5 days after SARS-CoV-2 virus infection.

Detailed Description

Example one

Construction of an ACE2 humanized mouse model.

1) Construction of a Piggybac transgenic vector: the piggyBac transposon 5 'inverted repeat sequence (ITR), CAG promoter, humanized ACE2 coding region, ribosome grafting site (IRES), firefly Luciferase (Luciferase), woodchuck hepatitis post-transcriptional regulatory element (WPRE), polyadenylation (polyA) site and 3' inverted repeat sequence (ITR) are SEQ ID NO:1-8 in sequence. The CAG promoter is obtained by PCR amplification by taking plvct-tTR-KRAB plasmid as a template, and the rest fragments are obtained by whole gene synthesis. In the construction process, firstly connecting two ITRs and enzyme cutting sites into a PBR322 carrier by an In-Fusion method to obtain a PBR322-ITR framework carrier; and then connecting the CAG promoter, the synthesized human ACE2 fragment and the IRES-Luciferase-WPRE-polyA into the PBR322-ITR skeleton vector In an In-Fusion manner to obtain the final PBR322-ITR-ACE2 transgenic vector. After the vector is subjected to enzyme digestion and sequencing verification to be correct, subsequent preparation of the transgenic mouse is carried out, and the enzyme digestion result of the vector is shown in FIG. 1C.

2) ACE2 transgenic mouse construction: fertilized eggs of a C57BL/6 mouse are taken, PBR322-ITR-ACE2 plasmid and transposase Pbase mRNA are mixed according to the method in the mouse embryo operation handbook (third edition), then microinjection of the fertilized eggs is carried out, the injected fertilized eggs are temporarily cultured by a culture box and then transplanted to the oviduct of a receptor mother mouse, and a genetically modified mouse F0 generation mouse is obtained. After the birth of the F0 generation mouse, the genome is extracted by tailgating, PCR upstream and downstream primers are respectively designed aiming at ACE2 and Luciferase, and the genotype of the F0 generation mouse is identified by PCR. The PCR identification conditions were as follows

The primer information is as follows:

primer name	Sequence information (5 '→ 3')
		ACE2-For	ATAGTGGTTGGCATTGTCATCC （SEQ ID NO: 9）
ACE2-Rev	TCCAGCGGTTCCATCTTCC（SEQ ID NO: 10）

And (3) PCR reaction system:

PCR reaction composition	Volume (mu l)
		ddH2O	31
PCR Buffer	10
		2.5 mM dNTP	4
ACE2-For	1
		ACE2-Rev	1
DNA Polymerase	2
		genomic DNA	1
Total of	50

PCR reaction procedure:

step (ii) of	Temperature (. degree.C.)	Time	Remarks for note
				1	98	2 min
2	98	15 sec
				3	60	15 sec
4	68	1 min	Repeat steps 2-4 for a total of 34 cycles
				5	68	5 min
6	12	10 min

Representative results of PCR identification are shown in FIG. 2A, and according to the results of PCR identification, xx mice from F0 generation were positive, and the positive rate of the mice was about 30%.

3) Verification of Luciferase and ACE2 expression: in order to verify the expression of Luciferase in mice positive for genotype identification, the in vivo imaging detection is carried out on the positive mice, and the brief process is as follows: after the hairs on the abdomen and the back of the mouse are shaved, D-luciferin (150 ul/mouse, the concentration is 15mg/ml) is injected into the abdominal cavity, the mouse is anesthetized after 5 minutes of injection, the mouse is placed into an in vivo imaging system (IVIS luminea) for detection after 10 minutes of injection, the Luciferase fluorescence signals of the mice in different postures are collected, a representative result is shown in FIG. 2B, the result shows that 6 mice in 10 detected positive mice for genotype identification can detect strong Luciferase fluorescence signals, 2 mice can detect relatively weak fluorescence signals, and the expression rate of the Luciferase is about 80%; to further confirm the expression of Luciferase in each tissue of transgenic mice, the inventors selected one of the mice for dissection and imaged the fluorescence expression of each tissue, and the results are shown in fig. 2C and show that: similar to the results of the whole animal imaging, active expression of Luciferase was detected in each tissue of positive mice. According to theory, because ACE2 and Luciferase are driven by the same CAG promoter and are connected in series through IRES, the expression amount of the Luciferase can reflect the expression of ACE2, in order to verify the expression of ACE2 protein in a mouse positive to the Luciferase, the inventor carried out Western Blot detection on the expression of ACE2 protein in main tissues of the mouse positive to the Luciferase, and the result is shown in FIG. 2D, the active expression of ACE2 can be detected in the main tissues of the mouse positive to the Luciferase, but the expression of human ACE2 cannot be detected in a wild type mouse. Therefore, the Luciferase can be used as an ACE2 expression detection index, and the ACE2 protein expression of F0 generation ACE2 transgenic mice can be rapidly screened in a living state by using a living body imaging system.

Example two

Construction of ACE2 humanized mouse SARS-CoV-2 virus susceptibility model

ACE2 infection and detection experiment of humanized mouse SARS-CoV-2 virus was performed in biosafety third-level laboratory (BSL-3), and 50. mu.L (4.15X 10) of 5 mice of F0 generation with positive expression of Luciferase and 5 mice of wild type C57BL/6 were dropped into a biosafety cabinet⁴PFU) SARS-CoV-2 virus solution is dropped into the nasal cavity of the mouse, after 4 days of infection, the lung tissue of the mouse is taken, after RNA extraction reverse transcription, real-time fluorescence quantitative PCR (Realtime PCR) is carried out to detect the content of SARS-CoV-2 virus in the lung tissue of different groups of mice, the result is shown in figure 3, and the result shows that: after 4 days of SARS-CoV-2 virus infection, the virus content in lung tissue of the ACE2 humanized mouse with positive Luciferase expression was about 1000 times that of the wild type mouse, indicating that the ACE2 humanized mouse is susceptible to SARS-CoV-2 virus of new coronary pneumonia.

EXAMPLE III

The protective effect of SARS-CoV-2 neutralizing antibodies was evaluated using an ACE2 humanized mouse.

To verify whether ACE2 humanized mice could be used for the evaluation of in vivo efficacy against neutralizing antibodies to SARS-CoV-2, vaccines and other potential drugs, the inventors performed dosing and in vivo evaluation in the biosafety third-order laboratory (BSL-3) using ACE2 humanized miceAnd (5) performing a toxicity counteracting experiment. 21F 0 mice positive for Luciferase fluorescence expression were divided into four groups: control group, neutralizing antibody low dose group, neutralizing antibody medium dose group and neutralizing antibody high dose group. A SARS-CoV-2 virus infection model was established by instilling 50. mu.L (4.15X 104 PFU) of SARS-CoV-2 virus solution into the nasal cavity of a mouse by nasal instillation, and the mouse was administered with different doses of neutralizing antibody 2 hours after instilling into the nasal cavity, and the grouping and administration were as shown in the following table.

Group of	Number of mice	Administration (after 2h infection)	Dosage (mg/kg)	Route of administration
					Control group	6	PBS	-	Abdominal injection
Low dose group of neutralizing antibody	5	Neutralizing Antibody-Low dose	5	Abdominal injection
					Neutralizing antibody medium dose group	5	Neutralizing Antibody-Medium dose	10	Abdominal injection
Neutralizing antibody high dose group	5	NeutralizingAntibody-High dose	20	Abdominal injection

After infection administration, the state and the weight of the mice are recorded every day, after 5 days of infection, the lung tissues of the living mice are taken and stored, RNA is extracted for reverse transcription, and then Realtime PCR is carried out, and the content of SARS-CoV-2 virus in the lung tissues of different groups of mice is detected. The experimental results are shown in fig. 4, and the results show that: after viral infection, the body weights of all 4 groups of mice were significantly reduced; the mice administered with the high-dose neutralizing antibody still survive for 5 days after infection, the survival rate of the medium-dose administration is 80%, the survival rates of the control group and the low-dose group are 50% and 40% respectively, and the state of the mice is poor; compared with the control group, the lung tissue virus content of the mice survived in the medium-dose and high-dose administration groups is obviously lower than that of the mice survived in the control group. The results show that in SARS-CoV-2 challenge experiments of ACE2 humanized mice, the administration of neutralizing antibodies with medium dose and high dose can effectively avoid the death of humanized mice and the replication of viruses in vivo caused by SARS-CoV-2 infection, which indicates that ACE2 humanized mice can be applied to the in vivo effect evaluation of SARS-CoV-2 neutralizing antibodies, vaccines and other potential drugs.

In conclusion, the inventor provides a method for quickly constructing an ACE2 humanized mouse model, a Piggybab transposase system is used for efficiently transgenically expressing an ACE2 gene, a luciferase reporter gene and a living body imaging system are combined, a positive transgenic mouse expressing ACE2 can be quickly screened out, relevant application can be carried out in the F0 generation, and the construction can be completed in 2-3 months; meanwhile, the inventor develops the research of in vivo efficacy verification of anti-SARS-CoV-2 virus drugs by using ACE2 humanized mice, and provides an application scene for researching and developing anti-SARS-CoV-2 virus drugs by using the model.

Sequence listing

<110> Shanghai's Square model Biotech Co., Ltd

Shanghai Yushi Biological Technology Co., Ltd.

Guangdong Nanmo Biological Technology Co., Ltd.

<120> quick construction method of ACE2 humanized mouse model and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 238

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccctagaaag ataatcatat tgtgacgtac gttaaagata atcatgcgta aaattgacgc 60

atgtgtttta tcggtctgta tatcgaggtt tatttattaa tttgaataga tattaagttt 120

tattatattt acacttacat actaataata aattcaacaa acaatttatt tatgtttatt 180

tatttattaa aaaaaaacaa aaactcaaaa tttcttctat aaagtaacaa aactttta 238

<210> 2

<211> 1620

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctagttatta atagtaatca attacggggt cattagttca tagcccatat atggagttcc 60

gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat 120

tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc 180

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 240

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt 300

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 360

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 420

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 480

ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc ggggcggggc gaggcggaga 540

ggtgcggcgg cagccaatca gagcggcgcg ctccgaaagt ttccttttat ggcgaggcgg 600

cggcggcggc ggccctataa aaagcgaagc gcgcggcggg cgggagtcgc tgcgttgcct 660

tcgccccgtg ccccgctccg cgccgcctcg cgccgcccgc cccggctctg actgaccgcg 720

ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa ttagcgcttg 780

gtttaatgac ggctcgtttc ttttctgtgg ctgcgtgaaa gccttaaagg gctccgggag 840

ggccctttgt gcggggggga gcggctcggg gggtgcgtgc gtgtgtgtgt gcgtggggag 900

cgccgcgtgc ggcccgcgct gcccggcggc tgtgagcgct gcgggcgcgg cgcggggctt 960

tgtgcgctcc gcgtgtgcgc gaggggagcg cggccggggg cggtgccccg cggtgcgggg 1020

gggctgcgag gggaacaaag gctgcgtgcg gggtgtgtgc gtgggggggt gagcaggggg 1080

tgtgggcgcg gcggtcgggc tgtaaccccc ccctgcaccc ccctccccga gttgctgagc 1140

acggcccggc ttcgggtgcg gggctccgtg cggggcgtgg cgcggggctc gccgtgccgg 1200

gcggggggtg gcggcaggtg ggggtgccgg gcggggcggg gccgcctcgg gccggggagg 1260

gctcggggga ggggcgcggc ggccccggag cgccggcggc tgtcgaggcg cggcgagccg 1320

cagccattgc cttttatggt aatcgtgcga gagggcgcag ggacttcctt tgtcccaaat 1380

ctggcggagc cgaaatctgg gaggcgccgc cgcaccccct ctagcgggcg cggggcgaag 1440

cggtgcggcg ccggcaggaa ggaaatgggc ggggagggcc ttcgtgcgtc gccgcgccgc 1500

cgtccccttc tccctctcca gcctcggggc tgtccgcggg gggacggctg ccttcggggg 1560

ggacggggca gggcggggtt cggcttctgg cgtgtgaccg gcggctctag agcctctgct 1620

<210> 3

<211> 2418

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc tcagtccacc 60

attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga agacctgttc 120

tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga gaatgtccaa 180

aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc cacacttgcc 240

caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct gcaggctctt 300

cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa cacaattcta 360

aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa tccacaagaa 420

tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga ctacaatgag 480

aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag gccattatat 540

gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga ggactatggg 600

gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta cagccgcggc 660

cagttgattg aagatgtgga acataccttt gaagagatta aaccattata tgaacatctt 720

catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag tccaattgga 780

tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa tctgtactct 840

ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat ggtggaccag 900

gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc tgttggtctt 960

cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg aaatgttcag 1020

aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag gatccttatg 1080

tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg gcatatccag 1140

tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa tgaaggattc 1200

catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca tttaaaatcc 1260

attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa cttcctgctc 1320

aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga gaagtggagg 1380

tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg gtgggagatg 1440

aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata ctgtgacccc 1500

gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac aaggaccctt 1560

taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg ccctctgcac 1620

aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat gctgaggctt 1680

ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa gaacatgaat 1740

gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga ccagaacaag 1800

aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag catcaaagtg 1860

aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga caatgaaatg 1920

tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa agtaaaaaat 1980

cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc aagaatctcc 2040

tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag aactgaagtt 2100

gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct gaatgacaac 2160

agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc ccctgtttcc 2220

atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat tgtcatcctg 2280

atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg agaaaatcct 2340

tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa cactgatgat 2400

gttcagacct ccttttag 2418

<210> 4

<211> 585

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60

gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120

ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180

gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240

aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360

acgttgtgag ttggatagtt gtggaaagag tcaaatggct ctcctcaagc gtattcaaca 420

aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480

gcacatgctt tacatgtgtt tagtcgaggt taaaaaaacg tctaggcccc ccgaaccacg 540

gggacgtggt tttcctttga aaaacacgat gataatatgg ccaca 585

<210> 5

<211> 1653

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatccgct ggaagatgga 60

accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt 120

gcttttacag atgcacatat cgaggtggac atcacttacg ctgagtactt cgaaatgtcc 180

gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta 240

tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt 300

gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgggcatt 360

tcgcagccta ccgtggtgtt cgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa 420

aaaaagctcc caatcatcca aaaaattatt atcatggatt ctaaaacgga ttaccaggga 480

tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat 540

tttgtgccag agtccttcga tagggacaag acaattgcac tgatcatgaa ctcctctgga 600

tctactggtc tgcctaaagg tgtcgctctg cctcatagaa ctgcctgcgt gagattctcg 660

catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt 720

gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt 780

cgagtcgtct taatgtatag atttgaagaa gagctgtttc tgaggagcct tcaggattac 840

aagattcaaa gtgcgctgct ggtgccaacc ctattctcct tcttcgccaa aagcactctg 900

attgacaaat acgatttatc taatttacac gaaattgctt ctggtggcgc tcccctctct 960

aaggaagtcg gggaagcggt tgccaagagg ttccatctgc caggtatcag gcaaggatat 1020

gggctcactg agactacatc agctattctg attacacccg agggggatga taaaccgggc 1080

gcggtcggta aagttgttcc attttttgaa gcgaaggttg tggatctgga taccgggaaa 1140

acgctgggcg ttaatcaaag aggcgaactg tgtgtgagag gtcctatgat tatgtccggt 1200

tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct 1260

ggagacatag cttactggga cgaagacgaa cacttcttca tcgttgaccg cctgaagtct 1320

ctgattaagt acaaaggcta tcaggtggct cccgctgaat tggaatccat cttgctccaa 1380

caccccaaca tcttcgacgc aggtgtcgca ggtcttcccg acgatgacgc cggtgaactt 1440

cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat 1500

tacgtcgcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac 1560

gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagaga gatcctcata 1620

aaggccaaga agggcggaaa gatcgccgtg taa 1653

<210> 6

<211> 588

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcaacctctg gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc 60

ttttacgcta tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat 120

ggctttcatt ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg 180

gcccgttgtc aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg 240

ttggggcatt gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat 300

tgccacggcg gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt 360

gggcactgac aattccgtgg tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc 420

ctgtgttgcc acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa 480

tccagcggac cttccttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg 540

ccttcgccct cagacgagtc ggatctccct ttgggccgcc tccccgca 588

<210> 7

<211> 232

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctagagctcg ctgatcagcc tcgactgtgc cttctagttg ccagccatct gttgtttgcc 60

cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 120

atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 180

ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg ga 232

<210> 8

<211> 309

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gatatctata acaagaaaat atatatataa taagttatca cgtaagtaga acatgaaata 60

acaatataat tatcgtatga gttaaatctt aaaagtcacg taaaagataa tcatgcgtca 120

ttttgactca cgcggtcgtt atagttcaaa atcagtgaca cttaccgcat tgacaagcac 180

gcctcacggg agctccaagc ggcgactgag atgtcctaaa tgcacagcga cggattcgcg 240

ctatttagaa agagagagca atatttcaag aatgcatgcg tcaattttac gcagactatc 300

tttctaggg 309

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atagtggttg gcattgtcat cc 22

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tccagcggtt ccatcttcc 19

Claims

1. A transgenic vector comprising the 5 'inverted repeat (ITR) and 3' inverted repeat (ITR) sequences of the PiggyBac transposon, a luciferase encoding gene sequence and a human ACE2 encoding gene sequence.

2. The transgenic vector of claim 1, further comprising a CAG promoter sequence.

3. The transgenic vector of any one of claims 1-2, further comprising woodchuck hepatitis post-transcriptional regulatory element (WPRE) and/or a polyadenylation (polyA) site.

4. The transgenic vector of any one of claims 1-3, wherein the Luciferase is a firefly Luciferase (Luciferase).

5. The transgenic vector of any one of claims 1-4, comprising, in order from 5 'to 3', a PiggyBac transposon inverted repeat 5 'region (ITR), a CAG promoter, a human ACE2 coding region, a ribosome entry site (IRES), firefly Luciferase (Luciferase), a woodchuck hepatitis post-transcriptional regulatory element (WPRE), a polyadenylation (polyA) site, and a 3' inverted repeat (ITR).

6. A host cell comprising the transgenic vector of any one of claims 1-5.

7. A method for constructing a humanized animal model of ACE2, comprising introducing the transgenic vector of any one of claims 1-5 into a host animal.

8. The method of claim 6, wherein the animal is a mammal.

9. The method of claim 7, wherein the animal is a mouse.

10. Use of the transgenic vector according to any one of claims 1 to 5, the host cell according to claim 6 or the animal model constructed by the method according to any one of claims 7 to 9 for the evaluation of drugs associated with SARS-CoV-2 viral infection.

11. The use according to claim 9, wherein the medicament is an antibody or vaccine.