CN112126712B

CN112126712B - Specific primer pair, probe and detection kit for detecting carp herpesvirus type II

Info

Publication number: CN112126712B
Application number: CN201911255393.XA
Authority: CN
Inventors: 袁锐; 刘肖汉; 巫爱军; 王晶晶; 刘训猛; 陈静; 吴亚锋; 于继彬
Original assignee: JURONG AQUATIC PRODUCT TECHNOLOGY DIRECTION STATION; Nantong Haimen District Aquatic Technology Guidance Station; Jiangsu Fishery Technology Promotion Center
Current assignee: JURONG AQUATIC PRODUCT TECHNOLOGY DIRECTION STATION; Nantong Haimen District Aquatic Technology Guidance Station; Jiangsu Fishery Technology Promotion Center
Priority date: 2019-12-10
Filing date: 2019-12-10
Publication date: 2021-08-24
Anticipated expiration: 2039-12-10
Also published as: CN112126712A

Abstract

The invention discloses a specific primer pair for detecting a carp herpes virus type II (CyHV-2), and a probe and a detection kit which are matched with the primer pair. The invention takes the gene ORF71 of the conserved gene in CyHV-2 as a detection target, and improves the detection convenience and specificity of the CyHV-2 type by using a specific primer and probe combination through a constant temperature amplification technology, and simultaneously greatly shortens the detection time. Compared with the PCR detection method, the method of the invention omits the product electrophoresis verification process, avoids the occurrence of false positive results and improves the detection accuracy. Compared with qPCR, the method of the invention is simple and easy to implement, does not need to operate complicated instruments and equipment, saves cost, improves detection efficiency, and is convenient to popularize and use in a large range. Compared with other constant-temperature amplification methods, the detection method disclosed by the invention is shorter in required time and higher in detection accuracy.

Description

Specific primer pair, probe and detection kit for detecting carp herpesvirus type II

Technical Field

The invention relates to a primer, a probe and a kit, in particular to a specific primer pair, a probe and a detection kit for detecting a carp herpes virus type II.

Background

The carp herpesvirus type ii, Cyprinic herpesvirus 2, abbreviated as CyHV-2, mainly affects Goldfish hematopoietic organs and is therefore also known as Goldfish hematopoietic necrosis virus (GFHNV) or Herpes Viral Hematopoietic Necrosis Virus (HVHNV). The CyHV-2 nucleocapsid is hexagonal or spherical, the diameter is 110nm and the diameter of the enveloped elliptic virus particle is 175 nm and 200 nm. The virus has high pathogenicity to goldfish and crucian, and the death rate can almost reach 100%. Viral infections have occurred in japan, usa, australia, uk and china, causing a great impact on the aquarium fish farming industry, causing economic losses. In recent years, the crucian in the main culture area of the crucian (carassius auratus gibelio) in China is dead in a large scale, the death rate reaches more than 80%, and the pathogen is CyHV-2 through electron microscope observation and molecular detection. The disease has wide spread range, strong infectivity, quick morbidity and high lethality, has caused great economic loss to the crucian breeding industry in China, and becomes one of the most serious viral diseases in the aquaculture in China. At present, no vaccine aiming at CyHV-2 exists, so that early diagnosis is very important for preventing and controlling the disease.

At present, there are many methods for detecting and identifying CyHV-2, and the cell culture separation technology is an important detection method for virus diagnosis and is usually the first choice method for fish virus detection recommended by the world health Organization (OIE). However, there are studies showing that CyHV-2 is difficult to proliferate in the existing fish cell lines. Although cell lines such as koi fin cell KF-1 and goldfish fin cell GFF can generate cytopathic effect, the pathological changes are gradually unobvious or even disappear along with the increase of virus algebra. It can be seen that at the present stage, cell culture is not an effective method for CyHV-2 diagnosis.

After that, a technology for detecting CyHV-2 by enzyme-linked immunosorbent assay (ELISA) appears, the detection result of ELISA can be quantified, the judgment is easy, the time consumption is short, and the sensitivity of the technology is high. In addition, the kit required by the method is expensive and not beneficial to large-area popularization; with the development of molecular biotechnology, pcr (polymerase Chain reaction) technology with higher sensitivity, accuracy and stability has emerged.

PCR uses 4 dNTPs as substrates, and performs extension of a complementary strand at the 3' end of a DNA template in the presence of a primer, and can exponentially amplify a trace amount of template nucleic acid through repeated cycles. Taking a trace amplification product to carry out agarose gel electrophoresis, observing by using an ultraviolet detector and taking a picture by using a gel imaging system, and observing whether a target fragment appears or not. The analysis of PCR products generally adopts agarose gel electrophoresis analysis, preliminarily judges whether the size of PCR product fragments is consistent with the expected size, and gradually advances, and establishes a PCR technology for detecting CyHV-2 by the soldier, Yang Germany and the like, so that the problem of headache is that the common PCR amplification detection is easy to generate aerosol pollution, and the detection result generates false positive. With the development of molecular biology, means for detecting CyHV-2 by using a fluorescent quantitative PCR technology are gradually developed, and if the CyHV-2 is detected by courage, an RT-PCR detection technology for rapidly detecting CyHV-2 is established by the soldier once on blame.

Fluorescent quantitative PCR (real-time fluorescent quantitative PCR) is a new quantitative test technology of nucleic acid introduced by Applied Biosystems in the United states in 1996, and is realized by adding a fluorescent probe or a corresponding fluorescent dye on the basis of conventional PCR. As the PCR reaction proceeds, the PCR reaction products are accumulated continuously, and the intensity of the fluorescence signal is increased in equal proportion. After each cycle, the fluorescence signal is collected, so that the change of the product amount can be monitored through the change of the fluorescence intensity, and a fluorescence amplification curve is obtained. The Ct value in real-time fluorescent quantitative PCR technology refers to the number of cycles that the fluorescent signal in each reaction tube undergoes when it reaches a set threshold. The Ct value of each template has a linear relation with the logarithm of the initial copy number of the template, and the more the initial copy number is, the smaller the Ct value is. A standard curve can be made using a standard with a known starting copy number, where the abscissa represents the logarithm of the starting copy number and the ordinate represents the Ct value. Therefore, once the Ct value of an unknown sample is obtained, the initial copy number of the sample can be calculated from the standard curve. Although the real-time fluorescent quantitative PCR simplifies the operation steps, the closed-tube detection can avoid the occurrence of aerosol false positive caused by PCR gel leakage, the sensitivity is high, the real-time monitoring can be realized, and the quantitative judgment can also be realized. The real-time fluorescent quantitative PCR needs to be matched with a fluorescent quantitative PCR instrument with high price, the equipment maintenance cost is high, the machine setting operation is complex, and professional personnel are needed, so that the comprehensive popularization is difficult.

Loop-mediated isothermal amplification (LAMP) is a new gene amplification technology, published in Notomi2000 by Japan scholars in the journal of Nucleic Acids Res, and has been widely applied to the field of molecular detection as a molecular biological detection technology. The LAMP principle is that 4 specific primers are designed for 6 regions of a target gene, and 10 specific primers can be obtained in a water bath at about 63 ℃ for 60 minutes under the action of strand displacement DNA polymerase (such as Bst enzyme)⁹～10¹⁰The amplification of nucleic acid has high amplification efficiency, simple operation and no need of special instrument for detection. Although the amplification efficiency is increased by LAMP, non-specific pairing between primers easily causes false positive results, and the application of the LAMP method is limited.

Disclosure of Invention

The purpose of the invention is as follows: the invention aims to solve the technical problem of providing a specific primer pair for detecting the carp herpesvirus II type, namely CyHV-2. The invention utilizes Vector NTI software to compare common conserved genes listed in the literature, selects strong-conservative ORF71 gene as a target amplification segment, utilizes Oligo 6 software to respectively design 4 pairs of primers and 3 probes in the conserved region, and carries out BLAST comparison on the designed sequences on NCBI to ensure species conservation and interspecies specificity.

The invention also provides a probe matched with the primer pair for use.

The invention also provides a kit containing the primer pair and a probe matched with the primer pair for use.

The technical scheme is as follows: in order to solve the problems in the prior art, the invention adopts the following technical scheme: a specific primer pair for detecting CyHV-2, the primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO:5 or SEQ ID NO: 7, and the downstream nucleotide sequence is shown as SEQ ID NO: 2or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO: shown in fig. 8.

The invention also comprises a probe matched with the primer pair for use, wherein the nucleotide sequence of the probe is shown as SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: shown at 11.

The probe is a probe marked by a fluorescent dye, and the fluorescent dye is one of SYTO-13, SYTO-82, FAM, FITC, SYBR Green I, SYTO-13, SYTO-82, VIC, HEX, JOE, TAMRA, TET, Cy3, ROX, TEXAS-Red or Cy 5.

Wherein, the length of the probe is 35-55 nucleotide bases, one base at the 28 th-35 th position is replaced by a nucleic acid analogue which is THF, two T bases are respectively arranged at the two sides of the THF and are marked with a fluorescent group and a quenching group, and the probe is blocked at the 3' -terminal by a blocking group.

The invention also provides a CyHV-2 detection kit, which comprises a primer pair and a probe; wherein the primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO:5 or SEQ ID NO: 7, the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 2or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO: 8 is shown in the specification; the nucleotide sequence of the probe is shown as SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: shown at 11.

Preferably, the reaction system of the detection kit comprises: recombinase, polymerase, single-stranded DNA binding protein, nuclease, a pair of or above primers, a strip of the probe, dNTP, crowding reagent, recombinant loading protein, energy system and salt ion.

Wherein, the recombinase is any one of or the combination of 2 of bacteriophage UvsX protein and escherichia coli recA protein.

Wherein the polymerase is any one or combination of more than one of klenow polymerase, Bsu polymerase or phi29 polymerase and mutants or large fragments thereof.

Wherein, the single-stranded DNA binding protein is any one of or the combination of Escherichia coli SSB protein, GP32 protein.

Wherein, the nuclease is any one of exonuclease III and endonuclease IV or the combination of 2.

Wherein, the recombinant loading protein is any one or the combination of more than one of bacteriophage UvsY protein, Escherichia coli RecO or Escherichia coli RecR.

Wherein the crowding reagent is one or more of polyethylene glycol, polyvinyl alcohol, dextran or polysucrose.

Wherein the polyethylene glycol is one or more of PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG20000, PEG25000, PEG30000, PEG35000 or PEG 40000.

Wherein the energy system is one or the combination of more than one of ATP, phosphocreatine and creatine kinase.

Wherein the salt ion is any one or combination of more than one of Tris, magnesium ion or potassium ion.

Specifically, the combination of the primer and the probe of the present invention may have the following four combinations:

the combination is as follows:

an upstream primer: 5'-TCACTCCATAGGACCTTCCACATTCAAC-3'

A downstream primer: 5'-CATAACAACTCGGTTTGATGGGACTGGAC-3'

And (3) probe: 5 '-TGTTTGTTTGTTTGTTTGATGAGACGATGG (BHQ1-dT) G (THF) C (FAM-dT) ATGGTTAATGTGTTGT (C3-SPACER) -3'

Combining two:

an upstream primer: 5'-CGCCTCTTTCAACCTACCCTTTAGCGTCAG-3'

A downstream primer: 5'-GTCCGGGTTCTGCACGTTATTGTGATTGAT-3'

Combining three components:

an upstream primer: 5'-AGTGGAATCAGTACAACCCGTCATGGTACGCC-3'

A downstream primer: 5'-AAATAAGTATTCATGCCGTGCGCCAGTTTCAG-3'

And (3) probe: 5 '-GTTTGTTTGTTTGATGAGACGATGGTGAC (FAM-dT) (THF) (BHQ1-dT) GGTTAATGTGTTGT (C3-SPACER) -3'

Or a combination of four:

an upstream primer: 5'-AATCAAGGTCGGATCTCTGGTGTGCGTACT-3'

A downstream primer: 5'-CGTCAGTCCCTGGCAGAAATAAGTATTCAT-3'

And (3) probe: 5 '-TGAGACGATGGTGACTATGGTTAATGTGT (FAM-dT) (THF) (BHQ1-dT) GTTGTGTTTGTGTA (C3-SPACER) -3'

The recombinase polymerase amplification technology has obvious advantages in the aspects of amplification time, amplification specificity, energy consumption required by amplification and the like. The principle is that two specific primers of 28-35 bases usually form a complex with a recombinase in a reaction system, strand exchange occurs on a template DNA for searching homologous sequences, and extension occurs under the action of DNA polymerase. The primers on the upstream and downstream are combined and extended at two ends of the specific section of the template respectively, and exponential amplification occurs in a circulating reciprocating manner. Although the increase of the fluorescence signal of the amplification product can be realized by adding SYBR Green dye, the detection is carried out by adding a specific fluorescent probe technology which can be used for carrying out base analogue excision by exonuclease III or endonuclease IV in a reaction system because the non-specificity cannot be distinguished by the fluorescent dye, thereby greatly improving the detection specificity.

The invention searches common CyHV-2 sugar ORF71 gene listed in the literature through NCBI, utilizes Vector NTI software to carry out comparison to find out the conserved region, selects partial region of ORF71 gene as a target amplification segment, constructs the target amplification segment into a Vector puc57, and prepares the positive plasmid of CyHV-2, wherein the plasmid is synthesized by the company Limited in the Biotechnology (Shanghai) and the selected partial sequence of glycoprotein ORF71 gene is as follows:

GTCAAGTGCGCCTCTTTCAACCTACCCTTTAGCGTCAGGTCCATAGAGGATCCAGAGTACAGCGAGTGTCTGGATATGGTTCAGCACAACGTTAGCACCGTACGTTTCCAAGAGATTATGCAGTCTCGGGTGAGGACTTGCGAAGAGTTTGATTTCTACACGCCTCGCATCATGCATCAGGACAACGCGGTCAGACAACTCAACGAGTCTTGTATGAAAAAGACTGTGGGCGCCGAACGGATCTTCAAGCCCAAGATCAATCACAATAACGTGCAGAACCCGGACGAGCGTAGAAAGTTTGCAGCCGTGGTCCGTCAACGGTTCAAGCACATTGACTTCTTTCAAGGCGTCCGAATCAAGGTCGGATCTCTGGTGTGCGTACTAAAATATCAAACTCAAGTGTTTGAAGGCTGTCTGGGAATAGTGGAATCAGTACAACCCGTCATGGTACGCCTTTTTTTGTTTGTTTGTTTGTTTGATGAGACGATGGTGACTATGGTTAATGTGTTGTGTTGTGTTTGTGTACAGGTACGATCTCTGGAATCTCAGAAGGTTCACTCCATAGGACCTTCCACATTCAACTTTGACAAGATGAGGACCGTGGAGTTTATGCCTCTGAAACTGGCGCACGGCATGAATACTTATTTCTGCCAGGGACTGACGTTCAAGTTTCCAGTGGTTTACTGTCCACCAAATTTTTACGCGTCCAGTCCCATCAAACCGAGTTGTTATGTTGTGTGTACAAGGGTGACAAATCGGGGTTTACTAAACTTGACCAACT(SEQ ID NO：12)

in the invention, 4 pairs of primers and 3 probes are respectively designed in a conserved region by using Oligo 6 software, and BLAST comparison is carried out on the designed sequences on NCBI (national center of Biotechnology information) to ensure the conservation of species and the specificity among species.

The invention also comprises a method for detecting CyHV-2, wherein an amplification system adopted by the method is the same as that of the detection kit, the method at least comprises two primers and a probe, the primers are respectively combined at the upstream and the downstream of the region to be amplified, the length of the primers is 15-45 nucleotide bases, and preferably 28-35 nucleotide bases; the probe is 35-55 nucleotide bases in length, preferably 46-52 bases in length, one base at positions 28-35 in the probe is replaced by a nucleic acid analogue, the nucleic acid analogue is preferably THF, two T bases are respectively arranged at two sides of the THF and are marked with a fluorescent group and a quenching group, and the probe is blocked at the 3' -end by a blocking group. The combination of primers and probes was the same as the four combinations described above.

In the amplification system, the final concentration of the tris-hydroxymethyl-aminomethane-acetic acid buffer solution pH8.0 is 20-60mM, and more preferably 30 mM; the final concentration of potassium acetate is 60-120mM, and more preferably 120 mM; the final concentration of the primer is 0.1-0.5nM, more preferably 0.42 nM; the final concentration of PEG is 5% PEG8000 or PEG20000, more preferably 5% PEG20000, and the final concentration of dithiothreitol is 1-10mM, more preferably 3 mM; ATP at a final concentration of 1-10mM, more preferably 2 mM; creatine phosphate final concentration 10-50mM, more preferably 20 mM; the final concentration of creatine kinase is 50-250 ng/ul, and more preferably 100 ng/ul; the final concentration of the phage gp32 protein is 100-1000 ng/. mu.l, more preferably 600 ng/. mu.l; the final concentration of the phage uvsX protein is 50-500 ng/. mu.l, more preferably 150 ng/. mu.l; the final concentration of the phage uvsY protein is 10-100 ng/. mu.l, more preferably 25 ng/. mu.l; the final concentration of the klenow polymerase is 5-100 ng/. mu.l, more preferably 80 ng/. mu.l; the final concentration of exonuclease III is 10-200 ng/. mu.l, more preferably 50 ng/. mu.l.

In the amplification reaction, the reaction temperature is 25-45 ℃, preferably 37-42 ℃, and generally recommended to be 37 ℃; the reaction time is 15 to 60 minutes, preferably 15 to 20 minutes.

Has the advantages that: compared with the prior art, the invention has the advantages that:

(1) the invention takes ORF71 gene in CyHV-2 as a detection target, improves the detection convenience and specificity of CyHV-2 by using a specific primer and probe combination through a constant temperature amplification technology, and greatly shortens the detection time.

(2) Compared with a PCR detection method, the detection kit provided by the invention omits a product electrophoresis verification process, avoids the occurrence of false positive results, and improves the detection accuracy. Compared with qPCR, the detection kit is simple and easy to use, does not need to operate complicated instruments and equipment, saves cost, improves detection efficiency, and is convenient to popularize and use in a large range. Compared with other constant-temperature amplification methods, the detection kit disclosed by the invention is shorter in required time and higher in detection accuracy.

(3) The detection kit provided by the invention depends on enzymatic amplification reaction, can perform continuous amplification reaction at a constant temperature, and has an amplification rate far higher than that of the conventional PCR temperature-variable reaction. The whole detection process can be finished in 20 minutes; in addition, in operation, various parameters do not need to be set, and detection operation can be performed without professional skills.

(4) The reaction conditions of the method are 37-42 ℃, the temperature control is not particularly strict, and a specific fluorescent probe is adopted, so that the nonspecific amplification can be better distinguished. Therefore, the test device is more convenient and fast to use for basic level tests, has lower energy consumption and is particularly suitable for field operation.

Drawings

FIG. 1 shows the results of sensitivity tests of the CyHV-2 recombinase polymerase amplification (exonuclease III binding) method; the number 1 represents the group of plasmids 7, at a concentration of 10^-5ng/mul; the number 2 represents the group of plasmids 8, at a concentration of 10^-6ng/mul; the number 3 represents the group of plasmids 9, at a concentration of 10^-7ng/mul; the number 4 represents the group of plasmids 10, at a concentration of 10^-8ng/μl；5.ddH₂O；

FIG. 2 shows the result of specificity test of CyHV-2 recombinase polymerase amplification (exonuclease III binding) method; wherein the test groups are CyHV-2, SVCV, ISKNV, KHV, IHNV, GIV and negative control ddH₂O；

FIG. 3 shows the results of the sensitivity test of the CyHV-2 recombinase polymerase amplification (with endonuclease IV) method; the number 1 represents the group of plasmids 7, at a concentration of 10^-5ng/mul; the number 2 represents the group of plasmids 8, at a concentration of 10^-6ng/mul; the number 3 represents the group of plasmids 9, at a concentration of 10^-7ng/mul; the number 4 represents the group of plasmids 10, at a concentration of 10^-8ng/μl；5.ddH₂O；

FIG. 4 shows the results of the optimal primer concentration test in the CyHV-2 recombinase polymerase amplification (exonuclease III binding) method; 1. 3, 5, 7 represent plasmid 7, at a concentration of 10^-5ng/mul;

groups

2, 4, 6, 8 represent ddH₂O；

FIG. 5 shows the result of the sensitivity test of the CyHV-2 assay kit; the number 1 represents the group of plasmids 7, at a concentration of 10^-5ng/mul; number 2 represents a plasmidGroup 8, concentration 10^-6ng/mul; the number 3 represents the group of plasmids 9, at a concentration of 10^-7ng/mul; number 4 represents ddH₂O; number 5, represents sample 1; numeral 6 represents sample 2; numeral 7 represents sample 3; number 8 represents ddH₂O；

FIG. 6 shows the result of specificity test of CyHV-2 assay kit; wherein the test groups are CyHV-2, SVCV, ISKNV, KHV, IHNV, GIV and negative control ddH₂O；

Detailed Description

The present invention will be described in further detail with reference to specific examples.

The invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the description of the embodiments is only for illustrating the present invention and should not be taken as limiting the invention as detailed in the claims. The following examples are intended to illustrate the invention in further detail, but are not intended to limit the invention.

The CyHV-2 positive plasmid adopted in the invention is synthesized by the biological engineering (Shanghai) corporation, and the CyHV-2 infected diseased fish tissue sample is provided by the technical popularization center of fishery in Jiangsu province.

Example 1

1. Acquisition of a positive plasmid for CyHV-2: the method comprises the following steps of searching a common CyHV-2ORF71 gene listed in a literature through NCBI, utilizing Vector NTI software to carry out alignment to find out a conserved region of the gene, selecting a partial region of an ORF71 gene as a target amplification segment, constructing the target amplification segment into a Vector puc57, and preparing a positive plasmid of the CyHV-2, wherein the plasmid is synthesized by a biological engineering (Shanghai) GmbH, and the selected partial sequence of the ORF71 gene is as follows:

2. selecting the plasmid containing the CyHV-2ORF71 gene sequence synthesized in step 1 as a detection target,

the sequence of the upstream primer is as follows: 5'-TCACTCCATAGGACCTTCCACATTCAAC-3' (Seq ID NO: 1);

the sequence of the downstream primer is: 5'-CATAACAACTCGGTTTGATGGGACTGGAC-3' (Seq ID NO: 2);

and (3) probe: 5 '-TGTTTGTTTGTTTGTTTGATGAGACGATGG (BHQ1-dT) G (THF) C (FAM-dT) ATGGTTAATGTGTTGT (C3-SPACER) -3' (SEQ ID NO: 9)

Amplifying by using a recombinase polymerase amplification (combined with exonuclease III) method, and constructing a 25 mu l amplification reaction system as follows:

30mM Tris-acetate buffer pH8.0

100mM potassium acetate

14mM magnesium acetate

3mM dithiothreitol

5% polyethylene glycol (molecular weight 20000)

2mM ATP

20mM creatine phosphate

100 ng/. mu.l creatine kinase

600 ng/. mu.l E.coli SSB protein

150 ng/. mu.l phage uvsX protein

25 ng/. mu.l phage uvsY protein

80 ng/. mu.l klenow polymerase large fragment (exo-)

50 ng/. mu.l exonuclease III

450μM dNTP

420nM each forward primer

420nM of each of the downstream primers

120nM each fluorescent probe

Template was synthetic positive plasmid 2. mu.l

The amplification temperature was 37 ℃ and the reaction was carried out for 20min, and the change in fluorescence was detected using a GS8 fluorescence isothermal amplification apparatus, and the fluorescence was read every 30 seconds. The recombinase polymerase amplification does not need a complex sample DNA pretreatment process, does not need thermal denaturation of a template, completes the reaction under the condition of lower constant temperature, has high reaction sensitivity and strong specificity, and can obtain a result after being detected on a computer for 20 min. The reaction is interpreted through a fluorescence numerical value, so that the process of PCR product electrophoresis verification is omitted, and aerosol pollution is avoided.

Template treatment: the concentration of positive plasmid was calibrated with NanoDrop, diluted to 10 ng/. mu.l with TE (named plasmid 1), followed by 10-fold sequential dilution to 1 ng/. mu.l (named plasmid 2) and 10^-1ng/. mu.l (designated plasmid 3), diluted to 10^-2ng/. mu.l (designated plasmid 4), diluted to 10^-3ng/. mu.l (named plasmid 5), diluted to 10^-4ng/. mu.l (designated plasmid 6), diluted to 10^-5ng/. mu.l (designated plasmid 7), diluted to 10^-6ng/. mu.l (named plasmid 8), diluted to 10^- ⁷ng/. mu.l (named plasmid 9), diluted to 10^-8ng/. mu.l (named plasmid 10); finally confirming that the sensitivity can be detected by 10 after detection^-6ng/. mu.l (designated as plasmid 8), (see FIG. 1 for results), the sensitivity was fully satisfactory for the application.

Example 2

The following primers and probe sequences were selected:

the sequence of the upstream primer is as follows: 5'-CGCCTCTTTCAACCTACCCTTTAGCGTCAG-3' (SEQ ID NO: 3);

the sequence of the downstream primer is: 5'-GTCCGGGTTCTGCACGTTATTGTGATTGAT-3' (SEQ ID NO: 4);

the probe sequence is: 5 '-TGTTTGTTTGTTTGTTTGATGAGACGATGG (BHQ1-dT) G (THF) C (FAM-dT) ATGGTTAATGTGTTGT (C3-SPACER) -3' (SEQ ID NO: 9)

A50-microliter amplification reaction system is constructed by synthesizing a plasmid containing a CyHV-2ORF71 gene sequence as a detection target and performing a recombinase polymerase amplification (endonuclease IV-combined) method version amplification test as follows:

60mM Tris-acetate buffer pH8.0

100mM potassium acetate

14mM magnesium acetate

3mM dithiothreitol

5% polyethylene glycol (20000)

2mM ATP

20mM creatine phosphate

100 ng/. mu.l creatine kinase

600 ng/. mu.l E.coli SSB protein

150 ng/. mu.l phage uvsX protein

25 ng/. mu.l phage uvsY protein

80 ng/. mu.l klenow polymerase large fragment (exo-)

50 ng/. mu.l exonuclease III

450μM dNTP

420nM each forward primer

420nM of each of the downstream primers

120nM each fluorescent probe

Template was synthetic positive plasmid 2. mu.l

The amplification temperature was 37 ℃ and the reaction was carried out for 20min, and the change in fluorescence was detected using a GS8 fluorescence isothermal amplification apparatus, and the fluorescence was read every 30 seconds. The positive plasmid synthesized above was used as a template for detection.

Template treatment: as in example 1, the sensitivity was finally confirmed to be 10^-7ng/. mu.l plasmid 9, the sensitivity is shown in FIG. 1.

Nucleic acid extraction: an Ezup column type animal genome DNA extraction and purification kit (DC25KA7394) is purchased from Biotechnology engineering (Shanghai) corporation, a sample to be detected is taken to obtain about 25mg of diseased tissue, the DNA extraction process is carried out according to the standard extraction steps in the kit, the extracted nucleic acid is subpackaged and frozen at-20 ℃ for later use.

And (3) specific detection: in order to verify the specificity of the primer and the probe, positive samples of common fish viruses CyHV-2, SVCV, ISKNV, KHV, IHNV and GIV are respectively used as templates for detection; only CyHV-2 positive samples were detected to be normally amplified, negative control ddH2O) and SVCV, ISKNV, KHV, IHNV, GIV positive samples were not amplified (see FIG. 2).

Example 3

The primer pair and probe sequence designed in example 2 were selected, and the amplification reaction system was amplified by the recombinase polymerase amplification (with endonuclease IV) method to construct a 50 μ l amplification reaction system as follows:

60mM Tris-acetate buffer pH8.0

100mM potassium acetate

14mM magnesium acetate

3mM dithiothreitol

5% polyethylene glycol (molecular weight 20000)

2mM ATP

20mM creatine phosphate

100 ng/. mu.l creatine kinase

400 ng/. mu.l of recA protein of escherichia coli

200 ng/. mu.l of E.coli SSB protein

60 ng/. mu.l of Escherichia coli recO protein

40 ng/. mu.l of recR protein of escherichia coli

60 ng/. mu.l of recF protein of Escherichia coli

8Units Bacillus subtilis DNA polymerase I

50 ng/. mu.l endonuclease IV

450μM dNTP

420nM each forward primer

420nM of each of the downstream primers

120nM fluorescent probe

Template was synthetic positive plasmid 2. mu.l

The amplification temperature was 42 ℃ and the reaction was carried out for 20min, and the change in fluorescence was detected using a GS8 fluorescence isothermal amplification apparatus, and the fluorescence was read every 30 seconds. The detection was carried out using the positive plasmid synthesized in example 1 as a template.

Template treatment: as in example 2, the sensitivity was finally confirmed to be 10^-7ng/. mu.l plasmid 9, sensitivity and recombinase polymerase amplificationThe amplification (with exonuclease III) method is essentially the same (see FIG. 3).

Example 4

Selecting a plasmid containing a CyHV-2ORF71 gene sequence as a detection target by synthesis,

the sequence of the upstream primer is as follows: 5'-AGTGGAATCAGTACAACCCGTCATGGTACGCC-3' (SEQ ID NO: 5);

the sequence of the downstream primer is: 5'-AAATAAGTATTCATGCCGTGCGCCAGTTTCAG-3' (SEQ ID NO: 6);

the probe sequence is: 5 '-GTTTGTTTGTTTGATGAGACGATGGTGAC (FAM-dT) (THF) (BHQ1-dT) GGTTAATGTGTTGT (C3-SPACER) -3' (SEQ ID NO: 10)

Amplifying by using a recombinase polymerase amplification (combined with exonuclease III) method, and constructing a 50 mu l amplification reaction system as follows:

30mM Tris-acetate buffer pH8.0

50mM potassium acetate

14mM magnesium acetate

3mM dithiothreitol

5% polyethylene glycol (molecular weight 20000)

2mM ATP

20mM creatine phosphate

100 ng/. mu.l creatine kinase

600 ng/. mu.l E.coli SSB protein

150 ng/. mu.l phage uvsX protein

25 ng/. mu.l phage uvsY protein

80 ng/. mu.l klenow polymerase large fragment (exo-)

50 ng/. mu.l exonuclease III

450μM dNTP

420nM each forward primer

420nM of each of the downstream primers

120nM each fluorescent probe

Template was synthetic positive plasmid 2. mu.l

The amplification temperature was 37 ℃ and the reaction was carried out for 20min, and the change in fluorescence was detected using a GS8 fluorescence isothermal amplification apparatus, and the fluorescence was read every 30 seconds. The detection was carried out using the positive plasmid synthesized in example 1 as a template.

Template treatment: as in example 1, it was confirmed by detection that 10-5 ng/. mu.l of plasmid 7 could be detected with sensitivity.

Example 5

Selecting a plasmid containing a CyHV-2 conserved region gene sequence as a detection target,

the sequence of the upstream primer is as follows: 5'-AATCAAGGTCGGATCTCTGGTGTGCGTACT-3' (Seq ID No. 7);

the sequence of the downstream primer is: 5'-CGTCAGTCCCTGGCAGAAATAAGTATTCAT-3' (Seq ID No. 8);

the probe sequence is: 5 '-TGAGACGATGGTGACTATGGTTAATGTGT (FAM-dT) (THF) (BHQ1-dT) GTTGTGTTTGTGTA (C3-SPACER) -3' (SEQ ID NO: 11)

30mM Tris-acetate buffer pH8.0

100mM potassium acetate

14mM magnesium acetate

3mM dithiothreitol

5% polyethylene glycol (molecular weight 20000)

2mM ATP

20mM creatine phosphate

100 ng/. mu.l creatine kinase

600 ng/. mu.l bacteriophage gp32 protein

150 ng/. mu.l phage uvsX protein

25 ng/. mu.l phage uvsY protein

70 ng/. mu.l klenow polymerase large fragment (exo-)

50 ng/. mu.l exonuclease III

450μM dNTP

400nM of each forward primer

400nM of each of the downstream primers

120nM each fluorescent probe

Template was synthetic positive plasmid 2. mu.l

Template treatment: as in example 1, the sensitivity was finally confirmed to be 10^-5ng/. mu.l plasmid 6.

In summary, example 1 is the best example, and the best primers and probes are SEQ ID NOs: 3. SEQ ID NO:4 and SEQ ID NO: 9 in combination.

Example 6

Optimization of primer dosage

The following primers and probe sequences were selected:

60mM Tris-acetate buffer pH8.0

100mM potassium acetate

14mM magnesium acetate

3mM dithiothreitol

5% polyethylene glycol (molecular weight 20000)

2mM ATP

20mM creatine phosphate

100 ng/. mu.l creatine kinase

600 ng/. mu.l E.coli SSB protein

150 ng/. mu.l phage uvsX protein

25 ng/. mu.l phage uvsY protein

80 ng/. mu.l klenow polymerase large fragment (exo-)

50 ng/. mu.l exonuclease III

450μM dNTP

420nM each forward primer

420nM of each of the downstream primers

120nM each fluorescent probe

Template was synthetic positive plasmid, 2. mu.l

The amplification temperature was 37 ℃ and the reaction was carried out for 20min, and the change in fluorescence was detected using a GS8 fluorescence isothermal amplification apparatus, and the fluorescence was read every 30 seconds. The positive plasmid synthesized in example 1 was used as a template for detection, and the primer concentrations were 400nM, 420nM, 450nM and 500nM, respectively.

Template treatment: as in example 1, 10 could be detected in all amplification systems with different primer concentrations^-5ng/. mu.l (designated plasmid 7) (see FIG. 4 for results); however, the corresponding amplification system with the concentration of the upstream primer and the downstream primer of 420nM is optimal.

Example 7

Composition of the kit

The kit components are divided into 4 types by the constructed 50-microliter amplification reaction system, and the specific steps are as follows:

example 8

Practical application verification and performance evaluation are carried out by adopting kit

In the selection example 7, the sensitivity, specificity and stability of the CyHV-2 sample are detected by using the prepared kit, and the specific amplification system is the same as that in the example 7.

The amplification temperature was 37 ℃ and the reaction was carried out for 20min, and the change in fluorescence was detected using a GS8 fluorescence isothermal amplification apparatus, and the fluorescence was read every 30 seconds. The positive plasmid synthesized in example 1 was used as a positive control for detection.

Nucleic acid extraction: ezup column type animal genome DNA extraction and purification kit (DC25KA 7)394) Purchased from Biotechnology engineering (Shanghai) Co., Ltd., about 25mg of diseased tissue of a sample to be detected is taken, the DNA extraction process is carried out according to the standard extraction step in a kit, the extracted nucleic acid is subpackaged and frozen at-20 ℃ for later use. The extracted nucleic acids were diluted 10-fold with TE (designated sample 1) and then sequentially diluted to 10³Fold (designated sample 3).

And (3) specific detection: in order to verify the specificity of the primer and the probe, positive samples of common fish viruses CyHV-2, SVCV, ISKNV, KHV, IHNV and GIV are respectively used as templates for detection; only CyHV-2 positive samples are normally amplified through detection, and negative control ddH2O) and SVCV, ISKNV, KHV, IHNV and GIV positive samples are not amplified.

In conclusion, the CyHV-2 detection kit is finally confirmed to have the sensitivity of detecting 10 through detection^-7ng/. mu.l (plasmid 9), while the detection of nucleic acid in the sample finally confirmed the sensitivity of the dilution 10 detected³Multiple (see fig. 5); only CyHV-2 positive samples were detected to be normally amplified, negative control ddH2O) and SVCV, ISKNV, KHV, IHNV, GIV positive samples were not amplified (see FIG. 6).

Sequence listing

<110> Jiangsu province fishery technology promotion center, sentence capacity city water production technology guidance station, Haimen city water production technology guidance station

<120> specific primer pair, probe and detection kit for detecting carp herpesvirus II

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> upstream primer (Artificial Sequence)

<400> 1

tcactccata ggaccttcca cattcaac 28

<210> 2

<211> 29

<212> DNA

<213> downstream primer (Artificial Sequence)

<400> 2

gtccagtccc atcaaaccga gttgttatg 29

<210> 3

<211> 30

<212> DNA

<213> upstream primer (Artificial Sequence)

<400> 3

cgcctctttc aacctaccct ttagcgtcag 30

<210> 13

<211> 29

<212> DNA

<213> downstream primer (Artificial Sequence)

<400> 13

tcaatcacaa taacgtgcag aacccggac 29

<210> 5

<211> 32

<212> DNA

<213> upstream primer (Artificial Sequence)

<400> 5

gtggaatcag tacaacccgt catggtacgc cc 32

<210> 6

<211> 32

<212> DNA

<213> downstream primer (Artificial Sequence)

<400> 6

ctgaaactgg cgcacggcat gaatacttat tt 32

<210> 7

<211> 30

<212> DNA

<213> upstream primer (Artificial Sequence)

<400> 7

aatcaaggtc ggatctctgg tgtgcgtact 30

<210> 8

<211> 30

<212> DNA

<213> downstream primer (Artificial Sequence)

<400> 8

atgaatactt atttctgcca gggactgacg 30

<210> 9

<211> 50

<212> DNA

<213> Probe Sequence (Artificial Sequence)

<400> 9

tgtttgtttg tttgtttgat gagacgatgg tgctatggtt aatgtgttgt 50

<210> 13

<211> 45

<212> DNA

<213> Probe Sequence (Artificial Sequence)

<400> 13

gtttgtttgt ttgatgagac gatggtgact tggttaatgt gttgt 45

<210> 13

<211> 45

<212> DNA

<213> Probe Sequence (Artificial Sequence)

<400> 13

tgagacgatg gtgactatgg ttaatgtgtt tgttgtgttt gtgta 45

<210> 12

<211> 781

<212> DNA

<213> ORF71 gene partial Sequence (Artificial Sequence)

<400> 12

gtcaagtgcg cctctttcaa cctacccttt agcgtcaggt ccatagagga tccagagtac 60

agcgagtgtc tggatatggt tcagcacaac gttagcaccg tacgtttcca agagattatg 120

cagtctcggg tgaggacttg cgaagagttt gatttctaca cgcctcgcat catgcatcag 180

gacaacgcgg tcagacaact caacgagtct tgtatgaaaa agactgtggg cgccgaacgg 240

atcttcaagc ccaagatcaa tcacaataac gtgcagaacc cggacgagcg tagaaagttt 300

gcagccgtgg tccgtcaacg gttcaagcac attgacttct ttcaaggcgt ccgaatcaag 360

gtcggatctc tggtgtgcgt actaaaatat caaactcaag tgtttgaagg ctgtctggga 420

atagtggaat cagtacaacc cgtcatggta cgcctttttt tgtttgtttg tttgtttgat 480

gagacgatgg tgactatggt taatgtgttg tgttgtgttt gtgtacaggt acgatctctg 540

gaatctcaga aggttcactc cataggacct tccacattca actttgacaa gatgaggacc 600

gtggagttta tgcctctgaa actggcgcac ggcatgaata cttatttctg ccagggactg 660

acgttcaagt ttccagtggt ttactgtcca ccaaattttt acgcgtccag tcccatcaaa 720

ccgagttgtt atgttgtgtg tacaagggtg acaaatcggg gtttactaaa cttgaccaac 780

t 781

Claims

1. A specific primer pair and probe combination for detecting CyHV-2, characterized in that: the primer pair comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO: 3, the nucleotide sequence of the downstream primer is shown as SEQ ID NO:4 is shown in the specification; the nucleotide sequence of the probe is shown as SEQ ID NO: shown at 9.

2. The specific primer pair and probe combination according to claim 1, wherein: the probe is a probe marked by a fluorescent dye, and the fluorescent dye is one of SYTO-13, SYTO-82, FAM, FITC, SYBR Green I, VIC, HEX, JOE, TAMRA, TET, Cy3, ROX, TEXAS-Red or Cy 5.

3. A CyHV-2 detection kit is characterized in that: the kit comprises a primer pair and a probe; wherein the primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 3, the nucleotide sequence of the downstream primer is shown as SEQ ID NO:4 is shown in the specification; the nucleotide sequence of the probe is shown as SEQ ID NO: shown at 9.

4. The CyHV-2 detection kit of claim 3, wherein: the reaction system of the detection kit comprises: a recombinase, a polymerase, a single-stranded DNA binding protein, a nuclease, the primer, the probe, dntps, a crowding reagent, a recombinant loading protein, an energy system, and a salt ion; the crowding reagent is polyethylene glycol, and the polyethylene glycol is one or a combination of more of PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG20000, PEG25000, PEG30000, PEG35000 or PEG 40000; the recombinant loading protein is any one or combination of more than one of phage UvsY protein, Escherichia coli RecO or Escherichia coli RecR.

5. The CyHV-2 detection kit of claim 4, wherein: the recombinase is any one of or the combination of 2 of bacteriophage UvsX protein and escherichia coli recA protein.

6. The CyHV-2 detection kit of claim 4, wherein: the nuclease is any one of exonuclease III and endonuclease IV or the combination of 2.

7. The CyHV-2 detection kit of claim 4, wherein: the energy system is one or the combination of more of ATP, phosphocreatine and creatine kinase.