CN111996277A - Tobacco PVY early warning gene Ntab0691000 and application thereof - Google Patents

Abstract

The invention belongs to the technical field of tobacco genome analysis and tobacco cultivation, and particularly relates to a tobacco potato Y virus disease early warning gene and application thereof. The base sequences of the early warning genes Ntab0691000 are respectively shown as SEQ ID No. 2. The early warning gene provided by the application has the technical advantages of quick response and high sensitivity, and has convenient technical advantages due to the fact that the early warning gene is used for detecting tobacco genomes (in the prior art, pathogenic bacterium genomes are mostly detected). The method can not only lay a certain technical foundation for monitoring and early prevention of the potato Y virus disease, but also provide reference and reference for prevention and control of other tobacco diseases, thereby having better application and scientific research values.

Description

Tobacco PVY early warning gene Ntab0691000 and application thereof

Technical Field

The invention belongs to the technical field of tobacco genome analysis and tobacco cultivation, and particularly relates to a tobacco potato Y virus disease early warning gene and application thereof.

Background

In tobacco cultivation, tobacco diseases are caused by various microorganisms such as fungi, bacteria and viruses, and meanwhile, insects with piercing-sucking mouthparts such as aphids can transmit pathogens to tobacco to cause the tobacco to generate diseases. And because the microorganisms are small and the propagation ways of tobacco diseases are various, the research on the occurrence and prevalence rules of tobacco diseases is difficult. In the prior art, indexes such as disease indexes are generally adopted to reflect the occurrence, development and prevalence rules of diseases, but the evaluation method usually needs to judge the occurrence or prevalence of the diseases until the diseases are attacked or even begin to spread, and the subsequent prevention and treatment are often delayed. Theoretically, if pathogens infect tobacco in the early stage, the pathogens can be detected in time and give an early warning, so that a good foundation can be laid for subsequent disease tracking, disease development and epidemic trend judgment, and sufficient time can be strived for controlling large-scale disease spreading.

Tobacco virus diseases caused by Potato Virus Y (PVY) are distributed worldwide, are also called macular necrosis, vein necrosis, brown vein disease and the like, and are also one of the virus diseases commonly occurring in the tobacco planting process in China. The tobacco strain infected with the virus disease at early stage can cause outcrop and serious loss; the yield loss of the infected tobacco strain close to the harvest period can reach 25 to 45 percent. Besides causing great loss of tobacco yield, PVY causes worse color and smoke flavor of diseased tobacco leaves after being exposed to the sun, and obviously reduces the quality.

Research has shown that tobacco PVY has diverse transmission pathways, generally mainly through sap-borne infection and aphid transmission. The friction contact between diseased leaves and healthy leaves between plants can cause the virus infection because the fuzz on the leaves is slightly damaged, and in addition, the virus transmission can be caused by the contact of hands, tools and the like with tobacco plants during the farm work operation. The aphid can obtain the virus after eating the disease plant for 5 seconds, and the virus can be transmitted to the healthy tobacco plant after the virus is transmitted for 10 seconds. The disease has wide spread range and various spread ways, and the proliferation and transfer speed in the tobacco plant body is fast, so that the early prevention and early warning are very important.

The existing main methods for detecting the tobacco virus comprise biological determination, serological determination, an electron microscope technology and a molecular biological technology method. The biological determination method is relatively large in workload, and the symptom response of tobacco plants is often influenced by soil, environment and climatic conditions, so that the biological determination method cannot be applied to actual prevention and treatment. Although the serological assay (ELISA method) is simple to operate, false positives are likely to occur due to problems such as cross-reactivity. Although the electron microscope technique can directly observe the size and form of the virus, it is expensive in equipment, high in technical requirements, and low in sensitivity, and therefore, it cannot be practically used for disease control. The Reverse transcription PCR method (Reverse transcription PCR) in molecular biology technology can realize early detection and diagnosis of tobacco viruses by specifically amplifying gene segments of the viruses, has the advantages of rapidness and sensitivity, and is the most potential detection method, but in practical application, the screening and determination of specific target genes are important preconditions for the application of the method. In a word, how to identify the tobacco PVY more quickly and timely is an important prerequisite for effective prevention and control of the PVY.

Disclosure of Invention

Aiming at tobacco Potato Virus Y (PVY), the application aims to provide two early warning genes which can quickly respond in the early stage of PVY infection, so that a good technical basis is laid for early prevention of the potato virus Y.

The technical solution adopted in the present application is detailed as follows.

Early warning genes Ntab0224260 and Ntab0691000 of tobacco potato Y virus disease (PVY) have base sequences shown as SEQ ID No.1 and SEQ ID No.2 respectively, and are specifically as follows:

ntab0224260 gene sequence (176 bp, SEQ ID No. 1) is as follows:

GGGATTCCAAATTGCCCTCCAATTATCGGTATATTCTCGAGGAATTGCTGGCCATGAGTATTGCAGGCATGGGTAAAAAGGACATTTTTGCAAAGCTTTCCCGGCCCAATTCTTTTGATTCTGGCACAAAGGAGGTATGGATTGATCAGAATAATGGAGGGGTTTGTTTGGCAGTT；

ntab0691000 gene sequence (157 bp, SEQ ID No. 2), as follows:

TGAGGAGGCTCAAAGTTCGTCGCCGGAAAGTGTTAATGATGATGTTTATGTTAGAGACCAAGATGAAGATGAAGAGAAAGAAACCAATGAAAATGTTGAAAACAATAAATTCTGGGAAACTCAACATCAACTTTTACAAGCTGTACTATGCCGGACA。

the early warning genes Ntab0224260 and Ntab0691000 for the tobacco and potato Y virus disease are applied to prevention and treatment of the tobacco and potato Y virus disease and serve as early warning genes for indicating the infection condition of the potato Y virus.

PCR primers for detecting the early warning genes Ntab0224260 and Ntab0691000 of the tobacco potato Y virus disease,

Ntab0224260-F：5’- GGGATTCCAAATTGCCCTCC-3’，

Ntab0224260-R：5’- AACTGCCAAACAAACCCCTC-3’；

Ntab0691000-F：5’- TGAGGAGGCTCAAAGTTCGT -3’，

Ntab0691000-R：5’- TGTCCGGCATAGTACAGCTT -3’。

the qRT-PCR detection kit prepared by using the PCR primers for detecting the tobacco potato Y virus disease early warning genes Ntab0224260 and Ntab0691000 also comprises primers for detecting a reference gene L25, and the specific primer sequences are as follows:

L25-F：5’-CCCCTCACCACAGAGTCTGC-3’，

L25-R：5’-AAGGGTGTTGTTGTCCTCAATCTT-3’。

the tobacco potato Y virus disease detection method using the qRT-PCR detection kit comprises the following steps:

extracting total RNA of a tobacco sample to be detected, and carrying out reverse transcription on the total RNA;

(II) carrying out qRT-PCR detection by using a tobacco leaf sample of a normally-grown uninfected tobacco strain as a control and using L25 as a reference gene and using an Ntab0224260-F/R, Ntab0691000-F/R primer pair to calculate the relative expression quantity of Ntab0224260 and Ntab 0691000;

(III) judging the potato virus Y infection condition of the sample to be detected according to the expression quantity condition in the step (III), specifically:

comparing with the control group, if the relative expression changes of Ntab0224260 and Ntab0691000 do not have statistical significance, the sample to be detected is not infected by the potato virus Y;

if the relative expression level of Ntab0224260 and Ntab0691000 is increased by less than 2 times, the detection and judgment are carried out again after the Ntab is kept for not less than 6 hours (if the expression level is not obviously changed, the potato virus Y is considered not to be infected, and if the expression level exceeds 1.5 times, the judgment is carried out by referring to the following standard);

if the relative expression level of the Ntab0224260 and the Ntab0691000 is increased by not less than 2 times, judging the disease stage of the potato Y virus disease according to the following condition, and then adopting corresponding control measures according to the disease stage;

。

in the potato Y virus infection process, under the condition that the optimal proliferation temperature is 25-28 ℃, the tobacco seedling infection can show symptoms after 3-7 days of PVY infection. That is, if the conventional pathological dissection means is adopted for identification and analysis, the initial judgment can be made only after the potato virus Y is infected for at least about 72 hours.

As for the early warning genes, the genes can be transcription factor genes or key enzyme genes in certain signal paths in plants, and therefore, the early warning genes have the characteristics of high response speed and more sensitive response to pathogenic fungi. Based on the characteristics, the inventor preliminarily screens and obtains a plurality of differential expression genes specifically responding to potato virus Y infection based on early-stage tobacco complete transcriptome chip expression profile data. The detection result of the real-time fluorescent quantitative PCR technology is further combined to show that the Ntab0224260 and Ntab0691000 genes can specifically respond to the potato Y virus infection, and have the characteristics of high response speed and sensitive response (from the example result, the Ntab0224260 and Ntab0691000 genes can respond to the potato Y virus infection in a short time (less than 6 h), and the morphological detection method is far ahead of the existing morphological detection method after 72 h), so that the method is suitable for being applied as an early warning gene of the potato Y virus disease.

In a word, the early warning gene provided by the application has the technical advantages of quick response and high sensitivity, and has convenient technical advantages due to the fact that the early warning gene is used for detecting tobacco genomes (in the prior art, pathogen genomes are mostly detected). The method can not only lay a certain technical foundation for monitoring and early prevention of the potato Y virus disease, but also provide reference and reference for prevention and control of other tobacco diseases, thereby having better application and scientific research values.

Drawings

FIG. 1 shows the results of detection of Ntab0224260 gene expression level, in which PVY-6 h, 1 d and 3 d represent the results after inoculation of PVY 6h, 1 d and 3 d, respectively, and PVY-Con: healthy tobacco plants (the following figures are similar in meaning and are not repeated);

FIG. 2 shows the result of detection of Ntab0691000 gene expression level;

FIG. 3 shows the result of detecting the expression level of Ntab0319080 gene;

FIG. 4 shows the result of detecting the expression level of the Ntab0224260 gene in CMV-diseased strain;

FIG. 5 shows the results of measuring the expression level of the Ntab0224260 gene in a blackleg-affected strain;

FIG. 6 shows the result of detecting the expression level of the Ntab0691000 gene in CMV-infected strain;

FIG. 7 shows the results of detecting the expression level of Ntab0691000 gene in a blackleg-diseased plant;

FIG. 8 is a phenotype of tobacco plants partially infected with potyvirus;

FIG. 9 shows the expression level of Ntab0224260 gene in tobacco infected with potato virus Y;

FIG. 10 shows the expression level of tab0691000 gene in tobacco plants infected with potyvirus.

Detailed Description

The technical solution of the present application is further explained with reference to the following examples. Before further description of the relevant experiments, a brief description of the background of some of the biological materials, reagents, etc. involved in the examples described below is provided below.

Biological material:

the common tobacco Honghuadajinyuan is planted in a greenhouse of the national tobacco gene research center of Zhengzhou tobacco institute under the conditions of temperature (23 +/-1) DEG C, relative humidity (60 +/-2)%, illumination culture for 16 h and dark culture for 8 h;

the synthesis and sequencing work of related primers is completed and provided by the biological engineering (Shanghai) corporation;

experimental reagent:

RNA reverse transcription kit, DL2000 DNA Marker and SYBR Green, etc., all purchased from Bao bioengineering (Dalian) Co., Ltd.

Example 1

The screening process of the tobacco potato virus Y early warning gene obtained in the present application is summarized as follows.

In the early research process aiming at the tobacco genome, based on the expression profile analysis result of Affymetrix tobacco whole genome chip, the significance analysis and MeV variance analysis of the normalized data are combined, P is less than or equal to 0.01, and the change of the expression values of a treatment group and a control group (after lg 2) is more than or equal to 2 times as the screening standard of the significant change (the expression is up-regulated) of the gene expression, and simultaneously, the prediction analysis of the gene function and the metabolic pathway by WEGO and KEGG are combined, so that 3 functional genes (Ntab 0224260, Ntab0691000 and Ntab 0319080) which obviously respond to the potato Y virus disease are preliminarily screened.

Based on the existing tobacco complete genome data, the gene sequences of Ntab0224260 and Ntab0691000 are finally determined as follows:

the sequence (176 bp) of the Ntab0224260 gene is shown as SEQ ID No.1 and specifically comprises the following steps:

GGGATTCCAAATTGCCCTCCAATTATCGGTATATTCTCGAGGAATTGCTGGCCATGAGTATTGCAGGCATGGGTAAAAAGGACATTTTTGCAAAGCTTTCCCGGCCCAATTCTTTTGATTCTGGCACAAAGGAGGTATGGATTGATCAGAATAATGGAGGGGTTTGTTTGGCAGTT

the sequence (157 bp) of the Ntab0691000 gene is shown as SEQ ID No.2, and specifically comprises the following steps:

TGAGGAGGCTCAAAGTTCGTCGCCGGAAAGTGTTAATGATGATGTTTATGTTAGAGACCAAGATGAAGATGAAGAGAAAGAAACCAATGAAAATGTTGAAAACAATAAATTCTGGGAAACTCAACATCAACTTTTACAAGCTGTACTATGCCGGACA。

in order to further determine the response of the 2 candidate genes to the potato Y virus disease (i.e., examine the susceptibility of the 2 candidate genes to the potato Y virus disease to determine whether the 2 candidate genes are suitable as early warning genes), the inventors further performed related experiments based on the real-time fluorescence quantitative PCR technology, and the detailed process is summarized as follows.

(I) design of primers

Based on the existing tobacco complete genome data and candidate genome sequences, the primer sequences for specific amplification in qRT-PCR are respectively designed aiming at different candidate genes as follows:

。

(II) simulating infection

The operation is carried out by referring to the methods in the tobacco virus disease rapid rubbing inoculation method (application No. 201210466245.4) and the tobacco virus disease sand paper rubbing inoculation method (application No. 200710077661.4), or specifically referring to the following steps:

(1) placing typical fresh diseased leaf tissues into a sterile mortar, adding 0.1 mol/L phosphate buffer solution with pH of 7.0, grinding, filtering by using sterile gauze, and finally fixing the volume according to the mass-to-volume ratio (W/V) of the diseased leaves to the phosphate buffer solution of 1: 30-40 to be used as inoculation liquid (note that the preparation is prepared as required);

(2) selecting healthy tobacco seedlings which are planted in the same batch and have consistent growth vigor and 5-6 true leaves for inoculation, and during specific operation: selecting 2 leaves of each tobacco seedling, uniformly spraying 600-mesh quartz sand, dispersing and dropwise adding 150-200 mu L inoculation liquid (PVY virus liquid) on each leaf, gently rubbing the surface of the leaf by using a sterile brush to cause slight damage to leaf epidermal cells, and finally spraying sterile water to wash residual liquid on the surface of the leaf;

(3) culturing the inoculated tobacco plant at 25 +/-1) DEG C and relative humidity of 60 +/-2%, and observing for 4-6 days to confirm the onset of disease.

As a control (to verify the specificity of the gene expression response), tobacco Cucumber Mosaic Virus (CMV) and phytophthora parasitica were inoculated to obtain tobacco CMV-diseased strain (see above procedure) and phytophthora parasitica-diseased strain, respectively. When the black shank bacterium is inoculated, the healthy tobacco plant Honghuadajinyuan is inoculated to infect the black shank referring to the artificial inoculation method of tobacco plant leaf axilla of the tobacco black shank (Linxiangyun, Chinese tobacco, 1982); specific operations can also be referred to as follows:

(1) collecting medulla part of tobacco plant with new disease (tobacco black shank) in field, keeping moisture at 25 + -1 deg.C for 2d (dense white hypha and sporangium can be observed under microscope), and cutting diseased tissue into hypha block as inoculation material;

(2) selecting healthy tobacco plants which are planted in the same batch and have consistent growth vigor and are in a vigorous long-term stage for inoculation, during specific operation, obliquely puncturing leaf axillary parts to be inoculated (axillary buds need to be cut off in advance) by using sterile pointed-end tweezers to reach medulla parts to form wounds, then completely plugging prepared mycelium blocks into the wounds by using the tweezers, and dripping a little clear water at the wounds to preserve moisture;

(3) the inoculated tobacco plants are placed at the temperature of (25 +/-1) ℃ for continuous culture, and the clean water is frequently sprayed on the wounds for continuous moisture preservation, so that the scab can appear in about one week under the normal condition.

(III) extracting total RNA and reverse transcribing into cDNA for use

And (3) inoculating the diseased plant in the step (II) for 6h, 1 d and 3 d respectively, taking a leaf as a sample, freezing by using liquid nitrogen, grinding into powder, extracting the total RNA by using a Trizol method, detecting the concentration and the purity of the extracted total RNA by using a NanoDrop 2000 ultramicro spectrophotometer, carrying out 1% agarose gel electrophoresis detection on the extract to judge the integrity of the extracted total RNA, and directly carrying out subsequent experiments or storing at-80 ℃ for later use after confirming that the extracted total RNA meets the requirements of subsequent use.

Further, referring to the specification of the RNA reverse transcription kit, the total RNA of the extracted diseased tobacco leaf is reversely transcribed into cDNA to be used as a template for subsequent qRT-PCR amplification.

(IV) Quantitative real-time fluorescent PCR (qRT-PCR) analysis

Taking the cDNA prepared in the step (three) as a template, and carrying out PCR amplification by using the specific PCR primer designed in the step (one); at the same time withL25And performing PCR amplification as an internal reference gene to detect and judge the change condition of the expression quantity of the candidate early warning gene.

To is directed atL25Internal reference gene, when PCR amplification is carried out, the primer sequence is designed as follows:

an upstream primer: 5'-CCCCTCACCACAGAGTCTGC-3' the flow of the air in the air conditioner,

a downstream primer: 5'-AAGGGTGTTGTTGTCCTCAATCTT-3', respectively;

during qRT-PCR amplification, a 20 mu L reaction system is designed as follows:

cDNA，2 µL（50 ng/µL）；

SYBR Green (Vazyme, Nanjing, China), 10 μ L;

upstream and downstream primers, each 0.5 μ L (10 μmol/L);

ddH₂O，7 µL。

in a fluorescent quantitative PCR apparatus (Bio-Rad, USA), the reaction conditions are as follows: at 95 ℃ for 3 min; at 95 deg.C, 20s, 60 deg.C, 20s, 40 cycles; storing at 4 deg.C;

each tissue sample was examined 3 times in duplicate, and the mean value was calculated using 2^-△△C _TThe relative expression was calculated (the relevant data were processed using statistical software SPSS 19.0 and subjected to One-way ANOVA; P < 0.05 indicates significant differences; P > 0.05 indicates no significant differences).

During the experiment, healthy tobacco plants were used as controls.

FIG. 1, FIG. 2 and FIG. 3 show the gene expression of 3 candidate early warning genes at different time intervals after the tobacco plant is infected with potyvirus. Specifically, the method comprises the following steps:

compared with a control group (PVY-Con), the Ntab0224260 and Ntab0691000 genes have a remarkable increase in expression level when inoculated with PVY for 6h, and the expression level is continuously increased (P < 0.05) along with the increase of the inoculation time (1 d, 3 d), which indicates that the two genes can respond in a short time (less than 6 h) when healthy tobacco plants are subjected to PVY invasion, and therefore, the genes can be used as candidate early warning genes of tobacco potato Y virus diseases;

compared with a control group (PVY-Con), the expression level of the Ntab0319080 gene is obviously reduced when the potato Y virus is inoculated for 6h, 1 d and 3 d, and the application of the Ntab0319080 gene as a tobacco potato Y virus disease early warning gene is not considered from the aspect of detection operability (the content is obviously increased to facilitate detection and judgment).

Further, the expression of two candidate early warning genes, Ntab0224260 and Ntab0691000, in the black shank and CMV strains is analyzed, and the results are shown in fig. 4, fig. 5, fig. 6 and fig. 7, specifically:

for the Ntab0224260 gene:

compared with a control group (CMV-Con), the expression level of the Ntab0224260 gene is very low in a tobacco strain of 4d after inoculation of CMV (P < 0.05), and is increased in tobacco strains of 10 d and 15 d after inoculation, but is still significantly lower than that of the control group (P < 0.05); compared with a control group (HJB-Con), the Ntab0224260 gene has very low expression level (P < 0.05) in tobacco strains inoculated with the phytophthora parasitica hypha 4d, has increased expression level in tobacco strains inoculated with 10 d and 15 d, and is still obviously lower than that of the control group (P < 0.05); based on the results, the gene is shown to have certain response to CMV and blackleg infection, but still has better specificity to PVY detection judgment based on the excessive expression angle from the detection operability angle;

for the Ntab0691000 gene:

compared with a control group (CMV-Con), the Ntab0691000 gene has very low expression level (P < 0.05) in tobacco strains 4d and 10 d after CMV inoculation, has increased expression level in tobacco strains 15 d after the inoculation, and is still lower than the control group (P < 0.05); compared with a control group (HJB-Con), the Ntab0691000 gene has very low expression level (P < 0.05) in tobacco strains inoculated with the black shank hypha 4d, has increased expression level in tobacco strains inoculated with 10 d and 15 d, and is still lower than the control group (P < 0.05); based on the results, it was shown that the gene has a certain response to CMV and blackleg infection, but from the viewpoint of detection operability, the gene still has a good specificity for detection judgment of PVY based on overexpression.

In view of the above results, both the Ntab0224260 and the Ntab0691000 genes can specifically, especially rapidly respond to the potato Y virus infection, so that a timely early warning signal can be sent for early prevention of the tobacco potato Y virus disease, and a good technical basis is laid for accurate identification and prevention of subsequent diseases.

Example 2

On the basis of embodiment 1, in order to facilitate the practical detection application of the early warning gene, the inventor further prepares a detection kit by combining other consumables and reagents, thereby facilitating the relative detection work to be conveniently and rapidly carried out. Among the detect reagent box, mainly be experimental reagent, also can design simultaneously and contain a plurality of instrument consumptive materials, specifically:

the instrument consumables include: the kit comprises a pipette tip (without DNase and RNase) with the specification of 10 mu L, 200 mu L and 1000 mu L, a plurality of centrifuge tubes (without DNase and RNase) with the specification of 1.5 mL, a plurality of mortars, a plurality of pairs of disposable latex gloves, a Marker pen 1 rod, a plurality of 96-well plates (without DNase and RNase) for fluorescent quantitative PCR;

the experimental reagent comprises:

reagent for RNA extraction:

trizol, chloroform, isopropanol, 75% ethanol (In DEPC-treated water), RNase-free water;

reagents for RNA reverse transcription:

5 XSupermix for qPCR (containing all reagents required for reverse transcription SuperRT, RNase Inhibitor, oligo (dT)18 Primer, Random Primer (N9), dNTPs, Buffer), gDNA Remover, RNase-free Water;

qRT-PCR detection reagent:

SYBR Green fluorescent dyes;

the upstream primer and the downstream primer of the Ntab0224260 gene, the upstream primer and the downstream primer of the Ntab0691000 gene and the upstream primer and the downstream primer of the L25 reference gene are respectively 10 mu ml/L.

For specific detection applications, the following operation steps can be referred to.

(I) extracting total RNA from sample to be detected

Taking tobacco leaves of a tobacco plant to be detected as a sample to be detected, freezing the sample by liquid nitrogen, and then sampling the sample into a 50-100 mg mortar and grinding the sample into powder;

transferring the milled sample to a 1.5 mL centrifuge tube, adding 1 mL Trizol (the dosage proportion of Trizol is that 1 mL Trizol is added into every 50-100 mg of powder, and the sample amount does not exceed 10% of the volume of Trizol so as to reduce the probability of DNA pollution), and standing for 5 min at room temperature to completely separate the nucleoprotein complex;

then, adding 0.2 mL of chloroform into the centrifuge tube, covering, violently shaking for 15 s, and standing for 2-3 min at room temperature;

centrifuging at 12000 rpm for 15 min at 4 deg.C (three layers after centrifugation, RNA only exists in the uppermost colorless aqueous phase); transferring the upper water phase to a new centrifugal tube of 1.5 mL, adding isopropanol of 0.5 mL, and standing for 10 min at room temperature;

centrifuging at 12000 rpm for 10 min at 4 deg.C, carefully discarding the supernatant, and washing the precipitate with 1 mL of 75% ethanol;

centrifuging at 12000 rpm for 5 min at 4 deg.C, carefully sucking off the supernatant, and standing at room temperature for 5-10 min to dry RNA (note that it cannot be dried excessively);

and finally, adding 50-70 mu L of RNase-free water to fully dissolve RNA, and carrying out subsequent detection judgment, experimental application or storing at-80 ℃ for later use.

During detection, a NanoDrop 2000 ultramicro spectrophotometer is used for detecting the concentration and purity of the extracted total RNA (A260/A280 is between 1.8 and 2.0, the purity is high, and the subsequent use requirement can be met), and 1% agarose gel electrophoresis detection is carried out to judge the integrity of the extracted total RNA.

(II) reverse transcription of RNA into cDNA

Reverse transcription of the RNA extracted in the step (I) into cDNA is performed by using an RNA reverse transcription reagent, and a specific 20 mu L reaction system is designed as follows:

total RNA, 1. mu.g;

5× SuperMix for qPCR，4 μL；

gDNA Remover，1 μL；

RNase-free Water, added to 20. mu.L;

after gentle mixing, the reaction was carried out at 42 ℃ for 15 min, and then heated to 85 ℃ for 5s to inactivate SuperRT and gDNA Remover; the product after reaction is directly used for subsequent qRT-PCR detection.

(III) detection of early warning gene relative expression in sample to be detected by utilizing qRT-PCR

To be provided withL25As an internal reference gene, qRT-PCR is utilized to early-warning geneNtab0224260、Ntab0691000Detecting the relative expression level of (a); in qRT-PCR detection, a 20-mu L reaction system is designed as follows:

preparing a cDNA template of 2 muL (50 ng/muL);

SYBR Green，10 µL；

upstream and downstream primers, each 0.5 μ L (10 μmol/L);

ddH₂O，7 µL；

the reaction conditions are as follows: at 95 ℃ for 3 min; 95 ℃, 20s, 60 ℃, 20s, 40 cycles; storing at 4 deg.C;

based on the detection results, use 2^-△△C _TThe relative expression amount is calculated.

(IV) specific judgment

When the incidence condition of the potato Y virus disease of the sample to be detected is specifically judged, the specific judgment standard is considered as follows:

as shown in fig. 1 and fig. 2, compared with the control group (PVY-Con), the expression level of the Ntab0224260 gene was significantly increased 6 hours after PVY inoculation, which is 2.11 times higher than that of the control group; the expression level of the vaccine after 1 d inoculation is 5.12 times of that of the control group; the expression quantity of the vaccine after 3 d inoculation is 3.23 times that of the control group;

compared with a control group (PVY-Con), the expression level of the Ntab0691000 gene is remarkably increased after 6 hours of PVY inoculation and is 2.16 times higher than that of the control group; the expression level of the gene is 4.63 times of that of the control group after inoculation for 1 d; the expression level after 3 d inoculation is 3.46 times of that of the control group. Therefore, in summary, the judgment criteria for the stage of the potato virus Y disease can be determined according to the gene expression level as follows:

。

in order to further verify the accuracy of the above judgment standard and the accuracy and reliability of detection by using the two early warning genes, taking a tobacco plant sample of an actual potato virus Y disease as an example (named as PVY tobacco plants 1, 2 and 3 respectively, the main appearance phenotype shows that the color of the leaf of the disease plant is abnormal, a plurality of yellow brown spots appear, the vein is changed into yellow, the disease plant often extends to the middle vein and stem, tissues on two sides of the vein are green zonal spots, mosaic mottle is formed, the leaf is shrunk and curled, therefore, the potato virus Y virus can be judged to start infecting and growing in tobacco leaves, and partial phenotype reality is shown in figure 8), the inventors detect the expression conditions of the Ntab0224260 gene and the Ntab0691000 genes in the sample material, and specific results are shown in figures 9 and 10. Specifically, the method comprises the following steps:

in fig. 9, the expression level of Ntab0224260 gene was significantly increased (P < 0.05) in tobacco strains infected with potyvirus disease compared to the control group (Con), and the expression levels of Ntab0224260 gene in PVY tobacco strains 1, 2, and 3 were 23.91-fold, 17.67-fold, and 28.05-fold, respectively, that of the control group; the combination of the above criteria can also be used for judging that the potato virus Y starts to infect and grows in the tobacco leaves, which further indicates that the establishment of the above criteria is more reasonable and accurate;

in fig. 10, the expression level of Ntab0691000 gene was significantly increased in tobacco plants infected with potyvirus (P < 0.05) compared to the control group (Con), and the expression levels of Ntab0691000 gene in PVY tobacco plants 1, 2, and 3 were 21.19-fold, 31.23-fold, and 36.15-fold, respectively, compared to the control group; in combination with the above criteria, it can also be determined that the potyvirus has begun to infect and grow within the tobacco leaves, which further illustrates that the establishment of the above criteria is more reasonable and accurate.

By combining the judgment standard and the judgment result, the Ntab0224260 and Ntab0691000 genes selected by the application have continuity, stability and reliability in the early warning effect when being applied as early warning genes of the Y virus diseases of the tobacco and the potato, and the relevant judgment standard also has stronger reference values, so that a certain technical basis can be laid for the prevention and control of the Y virus diseases of the potato.

SEQUENCE LISTING

<110> Zhengzhou tobacco institute of China tobacco general Co

<120> tobacco PVY early warning gene Ntab0691000 and application thereof

<130> none

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 176

<212> DNA

<213> Nicotiana tabacum

<400> 1

gggattccaa attgccctcc aattatcggt atattctcga ggaattgctg gccatgagta 60

ttgcaggcat gggtaaaaag gacatttttg caaagctttc ccggcccaat tcttttgatt 120

ctggcacaaa ggaggtatgg attgatcaga ataatggagg ggtttgtttg gcagtt 176

<210> 2

<211> 157

<212> DNA

<213> Nicotiana tabacum

<400> 2

tgaggaggct caaagttcgt cgccggaaag tgttaatgat gatgtttatg ttagagacca 60

agatgaagat gaagagaaag aaaccaatga aaatgttgaa aacaataaat tctgggaaac 120

tcaacatcaa cttttacaag ctgtactatg ccggaca 157

Claims (6)

1. The tobacco PVY early warning gene Ntab0691000 is characterized in that the base sequences are respectively shown as SEQ ID No.2, and the gene is as follows:

TGAGGAGGCTCAAAGTTCGTCGCCGGAAAGTGTTAATGATGATGTTTATGTTAGAGACCAAGATGAAGATGAAGAGAAAGAAACCAATGAAAATGTTGAAAACAATAAATTCTGGGAAACTCAACATCAACTTTTACAAGCTGTACTATGCCGGACA。

2. the application of the tobacco PVY early warning gene Ntab0691000 in preventing and treating tobacco potato virus Y as claimed in claim 1, wherein the gene is used as the early warning gene for indicating the infection condition of the potato virus Y.

3. The PCR primer for detecting the tobacco PVY early warning gene Ntab0691000 in the claim 1 is characterized in that the specific primer sequence is as follows:

Ntab0691000-F：5’- TGAGGAGGCTCAAAGTTCGT -3’，

Ntab0691000-R：5’- TGTCCGGCATAGTACAGCTT -3’。

4. a qRT-PCR detection kit prepared by using the PCR primers for detection of claim 3.

5. The qRT-PCR detection kit as claimed in claim 4, which comprises primers for detecting reference gene L25, wherein the specific primer sequences are as follows:

L25-F：5’-CCCCTCACCACAGAGTCTGC-3’，

L25-R：5’-AAGGGTGTTGTTGTCCTCAATCTT-3’。

6. the method for detecting the tobacco potato virus Y by using the PCR primer of claim 3 is characterized by comprising the following steps:

extracting total RNA of a tobacco sample to be detected, and carrying out reverse transcription on the total RNA;

(II) taking a tobacco leaf sample of a normally growing uninfected tobacco strain as a control, taking L25 as a reference gene, carrying out qRT-PCR detection by utilizing an Ntab0691000-F/R primer pair, and calculating the relative expression quantity of the Ntab 0691000;

(III) judging the potato virus Y infection condition of the sample to be detected according to the expression quantity condition in the step (III), specifically:

compared with the control group, if the relative expression change of Ntab0691000 has no statistical significance, the sample to be detected is not infected by the potato virus Y;

if the relative expression quantity of the Ntab0691000 is increased by less than 2 times, the Ntab0691000 needs to stay for not less than 6 hours and then is detected again;

if the relative expression level of the Ntab0691000 is not less than 2 times, judging the attack stage of the potato Y virus disease according to the following condition, and then adopting corresponding control measures according to the attack stage;

。

Images