WO2014072353A1

WO2014072353A1 - Method and kit for detecting potato viruses

Info

Publication number: WO2014072353A1
Application number: PCT/EP2013/073187
Authority: WO
Inventors: François CRUTZEN; Claude BRAGARD
Original assignee: Université Catholique de Louvain
Priority date: 2012-11-07
Filing date: 2013-11-06
Publication date: 2014-05-15

Abstract

The invention provides methods and kits for detecting potato viruses in a potato plant.In particular, the invention provides for reverse-transcriptase polymerase chain reaction (RT- PCR)-based methods for simultaneously detecting one or more potato virus, preferably selected from Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus A (PVA), Potato virus M (PVM), and Potato virus S (PVS), and potato actin mRNA as internal control for the RT-PCR. The invention further provides for kits of parts useful in these methods and comprising one or more primer pairs for amplifying viral RNA of one or more potato virus and a primer pair for amplifying potato actin mRNA by RT- PCR, and optionally comprising probes for detecting the amplicons.

Description

Method and kit for detecting potato viruses

Field of the invention

The invention relates to the field of plant pest detection. In particular, the invention provides methods and kits for detecting potato viruses in a potato plant. Background of the invention

Potato (Solanum tuberosum) crops are frequently infected with viruses, which leads to reduced yield and quality tubers. Among the most common viruses affecting potato crops are: Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus A (PVA), Potato virus M (PVM), and Potato virus S (PVS) (Singh, 1999. Genome 42: 592- 604). These viruses can occur in single or as mixed infections within the potato crop.

The introduction and propagation of potato viruses in European countries is strictly regulated by the European directives 97/46/CE and 2000/29/CE. Hence, there is a need for tests to identify infected potato tubers.

Most systems available utilize a combination of field-based inspections for visual symptoms and serological testing using enzyme-linked immunosorbent assay (ELISA) (Singh and Singh, 1996. J. Virol. Methods 60: 47-57). However, these methods are time consuming and expensive.

Multiplex RT-PCR has been introduced as a means to reduce cost and increase efficiency. For example, duplex RT-PCR detection of PLRV and PVY has been reported (Singh et al., 2000. J. Virol. Methods 86: 121 -129). Multiplex RT-PCR detection of five potato viruses (PVA, PVS, PVX, PVY and PLRV) has also been reported (Nie and Singh, 2000. J. Virol. Methods 86: 179-185 and Zhiyou Du, et al, 2006, Plant Disease, 90: 185- 189). However, these methods rely on agarose gel electrophoresis of amplicons, which is not well suited for high-throughput applications.

Multiplex real-time RT-PCR further reduces the cost of virus detection and facilitates high- throughpout virus detection. Mortimer-Jones et al. (2009. J. Virol. Methods 161 : 289-296) developed a real-time multiplex, single tube RT-PCR for simultaneous detection of PLRV, PVX, PVS and Tomato spotted wilt virus (TSWV) in potato and tomato. Agindotan et al. (2006. J. Virol. Methods 142: 1 -9) developed a real-time multiplex RT-PCR method using TaqMan® chemistry for simultaneous detection of four potato viruses: PLRV, PVA, PVX and PVY. However, these multiplex real-time RT-PCRs do not include any reference gene or internal control. Also, the primers developed by Agindotan et al. targeting PVY might fail to detect some viral strains of PVY as nucleotide variation in the primer annealing sites has been observed following multiple genome alignments.

The inclusion of an internal control in the real-time RT-PCR may help in guaranteeing the efficiency of the RNA extraction, RT and PCR steps and thereby increasing the reliability of the test. Ideally, the conditions of the plant should not influence dramatically the expression of such internal control. However, a study by Nicot el al. (2005. J. Exp. Botany 56: 2907-2914) shows that the expression of so-called housekeeping genes which are frequently used in real-time RT-PCR can vary in potato plants upon exposure to various biotic (e.g. late blight) or abiotic (e.g. cold and salt) stresses.

Accordingly, there persists a need in the art for tools for detecting potato viruses, and in particular for fast, sensitive and reliable high-throughput techniques, which allow for simultaneously detecting multiple potato viruses at reduced cost.

Summary of the invention

As shown in the examples, the inventors have unexpectedly found that the expression level of the potato PoAc97 gene for actin remains stable despite a viral infection and that the mRNA of said PoAc97 is detected within the same range of Cq of the viruses to be detected, i.e. at between 20 and 35, more particularly between 25 and 32 PCR cycles (Cq), which is a good intermediate range of detection for the different viral targets, arguing in favour of its use as an internal control, in particular an internal control for reverse- transcription polymerase chain reaction (RT-PCR) detecting one or more potato virus. In addition, the inventors have developed primers and probes specific to each of PLRV, PVX, PVY, PVA, PVM, and PVS, which were shown to allow for multiplex real-time RT- PCR. Hence, the inventors realised a sensitive, cost-effective and reliable tool for simultaneously detecting multiple potato viruses. The inventors have designed a highly sensitive test which enables the detection of as few as 3 DNA copies of potato virus, corresponding to a sensitivity in the femtogram (fg, 10^"15g) range, particularly of about 0,5 femtogram of potato virus.

Accordingly, an aspect of the invention relates to the use of PoAc97 gene for actin as an internal control (or reference gene) in potato. In particular, the invention provides for the use of the PoAc97 as an internal control for reverse-transcription polymerase chain reaction (RT-PCR) in potato, more particularly RT-PCR detecting one or more potato virus in potato. The use of PoAc97 gene for actin as an internal control in potato is particularly advantageous because the potato PoAc97 gene for actin is expressed constitutively. Another further advantage of using PoAc97 gene for actin is that the mRNA of said PoAc97 is detected at between 20 and 35, more particularly between 25 and 32 PCR cycles (Cq), whatever the viral status, the variety or growing conditions of the analysed potato. In addition the range of detection of PoAc97 mRNA is comprised within that of the potato viruses detected in the present application; said range of detection is comprised between 17 and 34 Cq. Therefore, the expression level of the potato actin PoAc97 constitutes a good reference of detection for the different viral targets in potato, which is particularly advantageous because an over- or under-expression of the internal control might interfere with the detection of the potato virus.

For example, PoAc97 may be used for the quantification of viral nucleic acid present in potato or as a positive control for the RT-PCR. In preferred embodiments PoAc97 is used as an internal positive control for the RT-PCR.

In a preferred embodiment, PoAc97 is used as an internal control for RT-PCR detecting one or more potato virus selected from the group comprising: Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus A (PVA), Potato virus M (PVM), and Potato virus S (PVS). More preferably, all 6 of said potato viruses are detected. Even more preferably, PLVR, PVX and PVY are detected. Alternatively, PVA, PVM and PVS are detected.

In preferred embodiments of the uses disclosed herein, the RT-PCR is multiplex RT-PCR. Also in preferred embodiments, the RT-PCR is real-time RT-PCR.

Another aspect of the invention relates to a method for determining the presence or absence of one or more potato virus in a potato plant comprising:

a) simultaneously amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of said one or more potato virus by RT-PCR using a RNA extract from said potato plant;

b) detecting the amplicons of step a),

wherein the presence of one or more potato virus in a potato plant can be concluded when the amplicons of said viral RNA of one or more potato virus and said potato actin mRNA are detected, and wherein the absence of one or more potato virus in a potato plant can be concluded when only the amplicon of said potato actin mRNA is detected.

Amplification and detection of potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is included in the methods disclosed herein as an internal positive control for the RT-PCR, i.e. for controlling performance of the RNA extraction, RT and PCR steps. This means that the outcome of the RT-PCR, in particular the presence or absence of amplicons of viral RNA of one or more potato virus, is only reliable when the amplicon of the potato actin mRNA is also detected.

Hence, the RT-PCR in the methods disclosed herein is a multiplex RT-PCR, whereby at least potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of one potato virus are reverse transcribed to produce a mixture that contains at least potato actin cDNA and viral cDNA of the potato virus, and then particular target sequences from at least these cDNA molecules are simultaneously amplified in a single reaction mixture by using at least a primer pair for amplifying the potato actin mRNA and a primer pair for amplifying the viral RNA of the potato virus.

In the methods disclosed herein, amplification of potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of one or more potato virus and detection of the amplicons may be performed separately, e.g. by analyzing the amplicons by agarose gel electrophoresis, or simultaneously, e.g. by real-time RT-PCR. In preferred embodiments, the amplification of the potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and the viral RNA of one or more potato virus and the detection of the amplicons are performed simultaneously by real-time RT-PCR.

Real-time RT-PCR has in general higher sensitivity than conventional RT-PCR and hence, it allows for detecting lower amount of viral nucleic acid.

Also in preferred embodiments, the potato actin mRNA and the viral RNA of more than one potato virus are simultaneously amplified by multiplex RT-PCR.

In the multiplex RT-PCR of these embodiments, potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and multiple viral RNA of more than one potato virus are reverse transcribed to produce a mixture that contains potato actin cDNA and multiple viral cDNA of the potato viruses, and then particular target sequences from these cDNA molecules are simultaneously amplified in a single reaction mixture by using a primer pair for amplifying the potato actin mRNA and multiple primer pairs for amplifying each of the viral RNA of the potato viruses.

Such multiplex RT-PCR allows for amplifying viral RNA of more than one potato virus in a single run and hence, is cost-effective as compared to performing multiple singleplex reactions each amplifying viral RNA of one potato virus. In preferred embodiments, the methods disclosed herein provide for determining the presence or absence of one or more potato virus selected from the group comprising: Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus A (PVA), Potato virus M (PVM), and Potato virus S (PVS), in a potato plant.

For example, disclosed herein are methods for determining the presence or absence of PLRV; PVX; PVY; PVA; PVM; or PVS in a potato plant, as well as methods for determining the presence or absence of PLRV and PVX; PLRV and PVY; PVX and PVY; PVA and PVM; PVA and PVS; or PVM and PVS; and also methods for determining the presence or absence of PLRV, PVX and PVY; or PVA, PVM and PVS.

A particularly preferred embodiment relates to a method for determining the presence or absence of PLRV, PVX, and PVY in a potato plant comprising:

a) simultaneously amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of PLRV, PVX, and PVY by multiplex RT-PCR using a RNA extract from said potato plant;

b) detecting the amplicons of step a),

wherein the presence of PLRV, PVX, and/or PVY in a potato plant can be concluded when the amplicons of said viral RNA of PLRV, PVX and/or PVY and said potato actin mRNA are detected, and wherein the absence of PLRV, PVX, and/or PVY in a potato plant can be concluded when the amplicon of said potato actin mRNA is detected and not the amplicon(s) of said viral RNA of PLRV, PVX, and/or PVY.

Another particularly preferred embodiment relates to a method for determining the presence or absence of PVA, PVM, and PVS in a potato plant comprising:

a) simultaneously amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of PVA, PVM, and PVS by multiplex RT-PCR using a RNA extract from said potato plant;

b) detecting the amplicons of step a),

wherein the presence of PVA, PVM, and/or PVS in a potato plant can be concluded when the amplicons of said viral RNA of PVA, PVM, and/or PVS and said potato actin mRNA are detected, and wherein the absence of PVA, PVM, and/or PVS in a potato plant can be concluded when the amplicon of said potato actin mRNA is detected and not the amplicon(s) of said viral RNA of PVA, PVM, and/or PVS.

The inventors searched for and tested primers and primer pairs so as to select ones particularly advantageous in the uses, methods and kits disclosed herein. In preferred embodiments, at least one primer of the primer pair for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is intron-spanning.

According to the invention a preferred feature of the primer pair for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is that it comprises at least one intron-spanning site. This provides a primer pair that will only bind to a sequence in which the introns have been spliced out, such as e.g. mRNA or cDNA, thereby avoiding the amplification of the corresponding actin encoding gene and ensuring the exclusive amplification of actin mRNA or cDNA. One or both of the forward and reverse primers may comprise one or more intron-spanning site.

Figure 1 C shows the intron-spanning sites, represented by an asterisk (^*), in potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin,. Accordingly, preferred primers and primer pairs for amplifying potato actin mRNA are configured to target the intron- spanning site of a sequence of the potato actin mRNA selected from the group comprising or consisting of:

aaaagatgacccagattatgtttgagactttcaataccccagctatgtatgttgctattcaggctgtactctcactgtatgccagtg gtcgtaccaccg^*gtattgtgttggactctggtgatggt (SEQ ID NO: 1 ),

atggcagacggagaggatattcagccccttgtctgtgacaatggaactggaatggtcaag^*gctgggtttgctggagatgatg ctccacgagctgtatttcctagtattgttggccgtccc (SEQ ID NO: 29), and

aggaaatacagtgtctggattggaggctctatcttggcttccctcagcaccttccagcag^*atgtggattgcaaaggcagagta tgacgaatctggtccttctattgtccacaggaagtgc (SEQ ID NO: 30),

more preferably the sequence of the potato actin mRNA of SEQ ID NO: 1 ,

or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence, wherein the intron-spanning site is indicated by an asterisk (^*).

In further preferred embodiments, the primer pair for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is configured to amplify between about 50 and about 300 bases, more preferably between about 100 and about 150 bases of a sequence of the potato actin mRNA selected from the group comprising: SEQ ID NO:1 , SEQ ID NO: 29, and SEQ ID NO: 30, more preferably the sequence of the potato actin mRNA of SEQ ID NO: 1 , or of variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence.

With the view of simultaneously amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of one or more potato virus, primers for amplification of potato actin mRNA and primers for amplification of viral RNA of one or more potato virus preferably display substantially the same or satisfactorily similar annealing temperatures, more preferably an annealing temperature of between about 49°C and about 69°C, yet more preferably between about 54°C and about 64°C, even more preferably about 58°C, 59°C or 60°C.

Also preferably, primers for amplification of potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and primers for amplification of viral RNA from one or more potato virus have a length of between about 9 and about 50 nucleotides, more preferably between about 18 and about 25 nucleotides.

In particularly preferred embodiments, the primer pair for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is the primer pair 5' CCAGATTATGTTTGAGACTTTC 3' (SEQ ID NO: 8) and 5' GAGTCCAACACAATACCG 3' (SEQ ID NO: 9), or variants or derivatives of said primer pair.

With regard to primers and primer pairs for amplifying viral RNA, the inventors have searched for primers and primer pairs targeting highly conserved sequences of the viral genomes, such that different viral strains may be detected using said primers and primer pairs.

Accordingly, preferred primers and primer pairs for amplifying viral RNA of one or more potato virus are configured to target a respective sequence of the viral genome of one or more potato virus selected from Table 1 , or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence.

Table 1 : Sequence regions of the viral genome of PLRV, PVX, PVY, PVA, PVM, and PVS. Conserved sequences between worldwide collected viral strains are underlined and varying positions are in bold.

PLRV aatactcaaggcctaccatgagtataagatcacaagcatcttacttcagttcgtcagcgaggcctcttc

cacctcctccggttccatcgcttatgagttggacccccattgcaaagtatcatccctccagtcctacgtc

(SEQ ID NO: 2)

PVX tgctaactggcaagcacaaggtttcaagcctgagcacaaattcgctgcattcgacttcttcaatggagt

cactaacccagctgccatcatgcccaaagaggggcttatccggccaccgtctgaagctgaaatgaat gctgcccaaactgc (SEQ ID NO: 3)

PVY tgaaaccaatcgttgagaatgcaaaaccaacacttaggcaaatcatggcacatttctcagatgttgca

gaagcgtatatagaaatgcgcaacaaaaaggaaccatatatgccacgatatggttta (SEQ ID NO: 4)

PVA aagctattttggaagatttcaagcaataagacattcgcgaaggtactgcactgcgggtacaattgttgtc

aagccagaaaggcacgtagacttaggaggaatctacgctacatcctatca (SEQ ID NO: 5)

PVM aacattgtgtgcctggtatctcttacaatgtgcgcgtggcgcaatttattgatgaaggagtaaccgaggtg

ataccttcagtcatcaacaagcgagagtagccattaaatcctatttaatatataacgtgtgctactataaat aaa (SEQ ID NO: 6)

In preferred embodiments, the one or more primer pairs for amplifying viral RNA of one or more potato virus are configured to amplify between about 50 and about 300 bases, preferably between about 100 and about 150 bases of the respective sequence of the viral genome of one or more potato virus selected from Table 1 , or of variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence.

In particularly preferred embodiments, the one or more primer pairs for amplifying viral RNA of one or more potato virus are the respective primer pairs selected from Table 2, or variants or derivatives of said primer pairs.

Table 2: Primer pairs for amplifying potato actin mRNA and viral RNA of PLRV, PVX, PVY, PVA, PVM and PVS.

The preferred primer pairs for use in the methods and kits disclosed herein are listed in Table 2. They entail inter alia the following advantages. The primers all display substantially the same or satisfactorily similar annealing temperatures, thus allowing the RT-PCR amplification of the different nucleic acids to be performed at the same temperature cycling conditions. The primers and primer pairs also show adequate specificity of amplification suitable for multiplex RT-PCR. This greatly facilitates the throughput of the methods and reduces the amount of labor, disposables and apparatus needed. In preferred embodiments of the methods disclosed herein, the amplicons are detected by means of a probe, more preferably a fluorescently labeled probe, such as e.g. a Taqman® probe.

The inventors searched for probes that specifically detect the amplicons of a RT-PCR using the primer pairs described above.

In preferred embodiments, the amplicon of the potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and the amplicon of the viral RNA of one or more potato virus are detected using probes comprising a sequence identical to or complementary to the respective sequence of the potato actin mRNA and the viral RNA of one or more potato virus selected from Table 3, or to variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98% or 99% sequence identity to said sequence, or to fragments thereof comprising between about 10 and about 40 bases, preferably between about 20 and about 30 bases, such as 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 bases of the said sequence or variants.

Table 3: Probe targets

Preferably, the probes display an annealing temperature of between about 59°C and about 79°C, yet more preferably between about 64°C and about 74°C, even more preferably about 68°C, 69°C or 70°C.

In particularly preferred embodiments, the amplicon of the potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and the amplicon of the viral RNA of one or more potato virus are detected using the respective probes selected from Table 4, or variants or derivatives of said probes.

Table 4: Probes for detecting the amplicon of potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and the amplicon of the viral RNA of PLRV, PVX, PVY, PVA, PVM, and PVS.

In preferred embodiments of the methods disclosed herein, the RNA is extracted from the leaves, tubers or sprouts of the potato plant.

Yet another aspect of the invention relates to a kit of parts for determining the presence or absence of one or more potato virus in a potato plant comprising:

- one or more primer pair for amplifying viral RNA of one or more potato virus,

- a primer pair for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin,.

In preferred embodiments, the invention provides for a kit of parts for determining the presence or absence of one or more potato virus selected from the group comprising: Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus A (PVA), Potato virus M (PVM), and Potato virus S (PVS), in a potato plant.

Preferred primer pairs for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of one or more potato virus are described above.

A particularly preferred embodiment relates to a kit of parts for determining the presence or absence of one or more of PLRV, PVX, and PVY in a potato plant comprising:

- one or more of the respective primer pairs selected from Table 2, or variants or derivatives of said primer pairs, and - the primer pair 5' CCAGATTATGTTTGAGACTTTC 3' (SEQ ID NO: 8) and 5' GAGTCCAACACAATACCG 3' (SEQ ID NO: 9), or variants or derivatives of said primer pair.

Another particularly preferred embodiment relates to a kit of parts for determining the presence or absence of one or more of PVA, PVM, and PVS in a potato plant comprising:

- one or more of the respective primer pairs selected from Table 2, or variants or derivatives of said primer pairs, and

- the primer pair 5' CCAGATTATGTTTGAGACTTTC 3' (SEQ ID NO: 8) and 5' GAGTCCAACACAATACCG 3' (SEQ ID NO: 9), or variants or derivatives of said primer pair.

In preferred embodiments, the kit of parts further comprises:

- one or more probe for detecting the viral RNA amplicon of one or more potato virus, and

- a probe for detecting the potato actin mRNA amplicon e.g. encoded by the potato PoAc97 gene for actin,.

Preferred probes for detecting the amplicon of potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and the amplicon of viral RNA of one or more potato virus are described above.

- one or more of the respective primer pairs selected from Table 2, or variants or derivatives of said primer pairs,

- the primer pair 5' CCAGATTATGTTTGAGACTTTC 3' (SEQ ID NO: 8) and 5' GAGTCCAACACAATACCG 3' (SEQ ID NO: 9), or variants or derivatives of said primer pair,

- one or more of the respective probes selected from Table 4, or variants or derivatives of said probes, and

- the probe 5' TTGCTATTCAGGCTGTACTCTCACT 3' (SEQ ID NO: 22), or variants or derivatives of said probe.

- one or more of the respective primer pairs selected from Table 2, or variants or derivatives of said primer pairs, - the primer pair 5' CCAGATTATGTTTGAGACTTTC 3' (SEQ ID NO: 8) and 5' GAGTCCAACACAATACCG 3' (SEQ ID NO: 9), or variants or derivatives of said primer pair,

- the probe 5' TTGCTATTCAG G CTGTACTCTCACT 3' (SEQ ID NO: 22), or variants or derivatives of said probe.

Also provided is the kit of parts for use in the herein-described methods.

Also disclosed herein are primer pairs for simultaneously amplifying viral RNA from PLRV, PVX and PVY consisting of the primer pairs from the following table, or variants or derivatives of said primer pairs:

Also disclosed herein are primer pairs for simultaneously amplifying viral RNA from PVA, PVM and PVS consisting of the primer pairs from the following table, or variants or derivatives of said primer pairs:

Aspect 1 : A method for determining the presence or absence of one or more potato virus in a potato plant comprising:

b) detecting the amplicons of step a),

wherein the presence of one or more potato virus in a potato plant can be concluded when the amplicons of said viral RNA of one or more potato virus and said potato actin mRNA are detected, and wherein the absence of one or more potato virus in a potato plant can be concluded when only the amplicon of said potato actin mRNA is detected. Aspect 2: The method according to aspect 1 , wherein said potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is amplified using a primer pair wherein at least one primer is intron-spanning. Aspect 3: The method according to any one of aspects 1 or 2, wherein said potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is amplified using a primer pair configured to amplify between about 50 and about 300 bases, preferably between about 100 and about 150 bases of the sequence of the potato actin mRNA of SEQ ID NO: 1 or of variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98% or 99% sequence identity to said sequence.

Aspect 4: The method according to any one of aspects 1 to 3, wherein said potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is amplified using the primer pair of 5' CCAGATTATGTTTGAGACTTTC 3' (SEQ ID NO: 8) and 5' GAGTCCAACACAATACCG 3' (SEQ ID NO: 9), or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pair, or derivatives of said primer pair or variants. Aspect 5: The method according to any one of aspects 1 to 4, wherein said viral RNA of one or more potato virus is amplified using one or more primer pairs configured to amplify between about 50 and about 300 bases, preferably between about 100 and about 150 bases of the respective sequence of the viral genome of one or more potato virus selected from the following table, or of variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence:

PLRV aatactcaaggcctaccatgagtataagatcacaagcatcttacttcagttcgtcagcgaggcctcttc cacctcctccggttccatcgcttatgagttggacccccattgcaaagtatcatccctccagtcctacgtc (SEQ ID NO: 2)

PVX tgctaactggcaagcacaaggtttcaagcctgagcacaaattcgctgcattcgacttcttcaatggagt cactaacccagctgccatcatgcccaaagaggggcttatccggccaccgtctgaagctgaaatgaat gctgcccaaactgc (SEQ ID NO: 3)

PVY tgaaaccaatcgttgagaatgcaaaaccaacacttaggcaaatcatggcacatttctcagatgttgca gaagcgtatatagaaatgcgcaacaaaaaggaaccatatatgccacgatatggttta (SEQ ID NO: 4)

PVA aagctattttggaagatttcaagcaataagacattcgcgaaggtactgcactgcgggtacaattgttgtc aagccagaaaggcacgtagacttaggaggaatctacgctacatcctatca (SEQ ID NO: 5)

PVM aacattgtgtgcctggtatctcttacaatgtgcgcgtggcgcaatttattgatgaaggagtaaccgaggtg ataccttcagtcatcaacaagcgagagtagccattaaatcctatttaatatataacgtgtgctactataaat aaa (SEQ ID NO: 6)

Aspect 6: The method according to any one of aspects 1 to 5, wherein said viral RNA of one or more potato virus is amplified using one or more of the respective primer pairs selected from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pairs, or derivatives of said primer pairs or variants:

Aspect 7: The method according to any one of aspects 1 to 6, wherein the amplicons are detected using probes comprising a sequence identical to or complementary to respectively, the sequence of the potato actin mRNA of SEQ ID NO: 1 or the respective sequence of the viral genome of one or more potato virus selected from the following table, or to variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence, or to fragments thereof comprising between about 10 and about 40 bases, preferably between about 20 and about 30 bases, such as 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 bases of the said sequence or variants:

PVM aacattgtgtgcctggtatctcttacaatgtgcgcgtggcgcaatttattgatgaaggagtaaccgaggtg ataccttcagtcatcaacaagcgagagtagccattaaatcctatttaatatataacgtgtgctactataaat

Aspect 8: The method according to any one of aspects 1 to 7, wherein the amplicons are detected using the respective probes selected from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said probes, or derivatives of said probes or variants:

Aspect 9: A kit for determining the presence or absence of one or more potato virus in a potato plant comprising:

- one or more primer pair for amplifying viral RNA of said one or more potato virus, and - a primer pair for specifically amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin,.

Aspect 10: The kit according to aspect 9, wherein the primer pair for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is the primer pair of SEQ ID NO: 8 and SEQ ID NO: 9, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pair, or derivatives of said primer pair or variants. Aspect 1 1 : The kit according to any one of aspects 9 or 10, wherein the one ore more primer pair for amplifying viral RNA of one or more potato virus is the respective primer pair selected from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or

99% sequence identity to said primer pairs, or derivatives of said primer pairs or variants:

Aspect 12: The kit according to any one of aspects 9 to 1 1 , further comprising:

- one or more probe for detecting the viral RNA amplicon of said one or more potato virus, and

- a probe for detecting the potato actin mRNA amplicon e.g. encoded by the potato PoAc97 gene for actin,. Aspect 13: The kit according to any one of aspects 9 to 12, wherein the one or more probe for detecting the viral RNA amplicon of one or more potato virus and the probe for detecting the potato actin mRNA amplicon e.g. encoded by the potato PoAc97 gene for actin, are the respective probes selected from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said probes, or derivatives of said probes or variants:

potato actin 5' TTG CTATTCAG G CTGTACTCTCACT 3' (SEQ ID NO: 22)

mRNA

PLRV 5' AG CATCTTACTTCAGTTCGTCAG C 3' (SEQ ID NO: 23)

PVX 5' CTGCATTCGACTTCTTCAATGGAGT 3' (SEQ ID NO: 24)

PVY 5' ACACTTAG G CAAATCATG G CACA 3' (SEQ ID NO: 25)

PVA 5' ACTGCACTGCGGGTACAATT 3' (SEQ ID NO: 26)

PVM 5' CTACTCTCGCTTGTTGATGACTGAA 3' (SEQ ID NO: 27)

PVS 5' CTAGCCGACACATGGTAGCAA 3' (SEQ ID NO: 28) Aspect 14: Primer pairs for simultaneously amplifying viral RNA from PLRV, PVX and PVY consisting of the primer pairs from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pairs, or derivatives of said primer pairs or variants:

Aspect 15: Use of PoAc97 as a reference gene or as an internal control in a method for detecting one or more potato virus in potato by reverse-transcription polymerase chain reaction (RT-PCR).

Aspect 16: The use according to aspect 15, wherein said reference gene is used as a positive control for said RT-PCR.

Aspect 17: The use according to any one of aspects 15 or 16, wherein said one or more potato virus is selected from the group comprising: Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus A (PVA), Potato virus M (PVM), and Potato virus S (PVS).

Aspect 18: The use according to any one of aspects 15 to 17, wherein said RT-PCR is real-time RT-PCR.

Aspect 19: The method according to any one of aspects 1 to 7, wherein the amplification of said potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and said viral RNA of one or more potato virus and the detection of said amplicons are performed simultaneously by real-time RT-PCR.

Aspect 20: The method according to any one of aspects 1 to 8, or 19, wherein said potato actin mRNA and said viral RNA of more than one potato virus are simultaneously amplified by multiplex RT-PCR, preferably

- wherein said potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of PLRV, PVX, and PVY are simultaneously amplified by multiplex RT-PCR, or - wherein said potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, and viral RNA of PVA, PVM, and PVS are simultaneously amplified by multiplex RT-PCR.

Aspect 21 : The method according to any one of aspects 1 to 8, 19, or 20, wherein the RNA is extracted from the leaves, tubers, or sprouts of said potato plant.

Aspect 22: The kit according to aspect 9, wherein at least one primer of the primer pair for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is intron- spanning.

Aspect 23: The kit according to any one of aspects 9 or 22, wherein the primer pair for amplifying potato actin mRNA e.g. encoded by the potato PoAc97 gene for actin, is configured to amplify between about 50 and about 300 bases, preferably between about 100 and about 150 bases of the sequence of the potato actin mRNA of SEQ ID NO: 1 , or of variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence.

Aspect 24: The kit according to any one of aspects 9, 10, 22, or 23, wherein the one or more primer pair for amplifying viral RNA of one or more potato virus is configured to amplify between about 50 and about 300 bases, preferably between about 100 and about 150 bases of the respective sequence of the viral genome of one or more potato virus selected from the following table, or of variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence:

PVS agagcctaatgctcaatccctaatttccaacgtcgccaccagcagctttcaagagagtgagaagg

ataacttcgcctggttttgctaccatgtgtcggctagcgccaaggaacaccttagtagagcaggaatt tacc (SEQ ID NO: 7)

Aspect 25: The kit according to aspect 12, wherein the probe is fluorescently labeled.

Aspect 26: The kit according to any one of aspects 12 or 25, wherein the one or more probe for detecting the viral RNA amplicon of one or more potato virus and the probe for detecting the potato actin mRNA amplicon e.g. encoded by the potato PoAc97 gene for actin, comprise a sequence identical to or complementary to respectively, the sequence of the potato actin mRNA of SEQ ID NO: 1 or the respective sequence of the viral genome of one or more potato virus selected from the following table, or to variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence, or to fragments thereof comprising between about 10 and about 40 bases, preferably between about 20 and about 30 bases, such as 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 bases of the said sequence or variants:

The above and additional aspects, preferred embodiments and features of the invention are described in the following sections and in the appended claims. Each aspect, embodiment or feature described herein may be combined with any other aspect(s), embodiment(s) or feature(s) unless clearly indicated to the contrary. In particular, any feature specified herein, and particularly any feature indicated as being preferred or advantageous, may be combined with any other feature(s) specified herein, and particularly with any other feature(s) indicated as being preferred or advantageous. The subject matter of appended claims is hereby specifically incorporated in this specification.

Brief descriptions of the figures:

FIG. 1 : mRNA-exclusive amplification for potato PoAc97 gene for actin. (A) Annealing positions of the forward and reverse primers St_Act_qF (a, SEQ ID NO: 8) and St_Act_qR (b, SEQ ID NO: 9) are indicated on the schematic representations of the encoding DNA sequence and the spliced mRNA sequence of potato PoAc97 gene for actin. Annealing position of another reverse primer (c, SEQ ID NO: 32) is also indicated on the schematic representation of the encoding DNA sequence. Former position in the DNA sequence is represented in the schematic representation of the spliced mRNA sequence for each of the three introns 11 , 12 and 13 by white bars. The 3' extremity of the reverse primer (b) is prevented to anneal on the DNA sequence due to the presence of the second intron (12). The other reverse primer (c) hybridizes partly in the second intron (12). (B) Independent RT-PCR and PCR performed on RNA extracts from potato leaves using the primer pair St_Act_qF (a, SEQ ID NO: 8) and St_Act_qR (b, SEQ ID NO: 9). The presence of PoAc97 gene in the RNA extract was checked by PCR using primers (a) and (c). L indicates a DNA ladder. (C) Spliced mRNA sequence of potato PoAc97 gene for actin (SEQ ID NO: 31 ). The former positions of the introns in the DNA sequence are indicated by asterisks (^*).

FIG. 2: Stability of potato PoAc97 expression. Boxplot representations (Cq in ordinate) of the expression level of the actin PoAc97 mRNA quantified by RT-qPCR in the leaves of potatoes from a bioassay (A) and from Belgian fields in 2012 (B). (A) In the bioassay, the quantity of the actin mRNA was followed in virus-infected (PLRV, PVX, PVY type N (PVY- N) or PVY type O (PVY-O)) and healthy (-C) potatoes. The number of samples analyzed (n=x) is specified for each treatment in the corresponding boxplot. (B) Five potato varieties (Bintje-Bin, Innovator-Inn, Kennebec-Ken, Nicola-Nic, Spunta-Spu) cropped at five different locations during the growing season 2012 were also analysed for the level of expression of PoAc97 at early July and early August. Three samples per variety and collection date were analysed (n=3), each one representing a pool of ten independent potato plants. Bold lines represent medians, boxes range from 0.25 to 0.75 quartile, whiskers include maximal and minimal values with a maximum of 1.5 times the interquartile range (IQR).

FIG. 3: Sensitivity of the multiplex qPCR detection. (A) Multiplex qPCR was performed on pools of ten-times diluted linearized plasmids containing a DNA copy of amplicons of targeted sequences of PVY type O (PVY-O), PVY type N (PVY-N), PVX, PLRV or potato actin mRNA amplified by RT-PCR using the corresponding primers from Table 5. The starting quantity was 3x10⁷ molecules per reaction. (B) Singleplex classical PCR was performed on ten-times diluted linearized plasmids containing a DNA copy of the potato actin mRNA amplicon amplified by RT-PCR using the primer pair St_Act_qF (SEQ ID NO: 8) and St_Act_qR (SEQ ID NO: 9).

Detailed description

As used herein, the singular forms "a", "an", and "the" include both singular and plural referents unless the context clearly dictates otherwise.

The terms "comprising", "comprises" and "comprised of" as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The term also encompasses "consisting of" and "consisting essentially of".

The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

Whereas the term "one or more", such as one or more members of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members.

The term "about" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of and from the specified value, in particular variations of +/-10% or less, preferably +/-5% or less, more preferably or less, and still more preferably +/-0.1 % or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" refers is itself also specifically, and preferably, disclosed.

All documents cited in the present specification are hereby incorporated by reference in their entirety.

Unless otherwise specified, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions may be included to better appreciate the teaching of the present invention. In an aspect, the invention provides for the use of actin as a reference gene or as an internal control for RT-PCR detecting one or more potato virus in potato.

The term "potato" generally refers to plants of the species Solanum tuberosum. The term encompasses several varieties, such as for example but without limitation Bintje, Kennebec, Spunta, etc.

As used throughout the specification, the term "PoAc97" denotes Solanum tuberosum PoAc97 gene encoding actin having nucleic acid sequence as annotated under NCBI Genbank (http://www.ncbi.nlm.nih.gov/) accession number X55751 (sequence version no. 1 entered on November 14, 2006, i.e., X55751.1 ).

PoAc97 actin isoform is but one among at least five identified potato actin isoforms, according to the prior art (Drouin and co-authors, 1990).

As used herein, the terms "reference gene" or "housekeeping gene" are synonyms and refer to a stable gene, whose expression level remains constant irrespective the experimental conditions, such as exposure to stress, e.g. viral infection, and which is expressed in all cells of the organism. The reference gene may be used for the quantification of a target nucleic acid, such as mRNA transcript or viral nucleic acid. The quantification of a target nucleic acid by RT-PCR may be performed by two approaches, referred to as absolute quantification and relative or comparative quantification. The absolute quantification strategy is based on the comparison between the amounts of target nucleic acids and a calibration curve of a nucleic acid of known quantity. The relative quantification calculates the amounts of target nucleic acids relative to the amount of mRNA transcript of a reference gene. A reference gene may also be useful as an internal positive control, also called "internal control", for the RT-PCR, i.e. a positive control for the RNA extraction step and RT-PCR performance. In the present invention, the reference gene is preferably used as an internal control or a positive control for the RT-PCR.

The one or more potato virus that is targeted in the uses, methods and kits disclosed herein is preferably selected from the group comprising: Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus A (PVA), Potato virus M (PVM), and Potato virus S (PVS). More preferably, PLRV, PVX and PVY are detected simultaneously using multiplex RT-PCR and PoAc97 as internal control. Alternatively, PVA, PVM and PVS are detected simultaneously using multiplex RT-PCR and PoAc97 as internal control. Further alternatively, PLRV, PVX, PVY, PVA, PVM and PVS could be detected simultaneously using multiplex RT-PCR and PoAc97 as internal control. The term "Potato leafroll virus (PLRV)" refers herein to a member of the genus Polerovirus and the family Luteoviridae. It is a positive sense RNA virus that infects potatoes and other members of the family Solanaceae. PLRV is transmitted by aphids, primarily the green peach aphid, Myzus persicae. Exemplary PLRV includes without limitation Potato leafroll virus strain CIP01 having nucleic acid sequence as annotated under NCBI Genbank accession number AF453392 (sequence version no. 1 entered on December 7, 2006, i.e., AF453392.1 ).

The term "Potato virus X (PVX)" refers herein to a plant pathogenic virus of the genus Potexvirus and the family Alphaflexiviridae. PVX is a positive sense RNA virus. It is found mainly in potato and is transmitted mechanically. Exemplary PVX includes without limitation Potato virus X strain TO having nucleic acid sequence as annotated under NCBI Genbank accession number AB196001 (sequence version no. 1 entered on July 24, 2010, i.e., AB196001.1 ).

The term "Potato virus Y (PVY)" refers herein to a plant pathogenic virus of the genus Potyvirus and the family Potyviridae. It is a positive sense RNA virus. PVY may be transmitted to potato plants mechanically or through aphid transmission. PVY may include different strains, such as e.g. PVY-N, PVY-O, and PVY-C, and the term encompasses the different strains. Potato infection by PVY-N results in leaf necrosis and mild or even no damage to the tubers (Crosslin et al. 2005. Serological and Molecular Detection of Tobacco Veinal Necrosis Isolates of Potato Virus Y (PVYN) from Potatoes Grown in the Western United States. Amer. J. Pot. Res., 82: 263-269). The ordinary strain of PVY is denoted as PVY-O. Infection of a potato plant with the PVY-0 strain results in mild tuber damage and does not cause leaf necrosis (Boonham et al. 2002. Biological and sequence comparisons of Potato virus Y isolates associated with potato tuber necrotic ringspot disease. PI. Path., 51 : 1 17-126.). Exemplary PVY includes without limitation Potato virus Y strain NTN having nucleic acid sequence as annotated under NCBI Genbank accession number AJ889866 (sequence version no. 1 entered on February 10, 2007, i.e., AJ889866.1 ).

The term "Potato virus A (PVA)" also referred to as "potato mild mosaic virus", "potato virus P", or "Solanum virus 3" denotes herein a positive sense RNA virus belonging to the genus Potyvirus and the family Potyviridae. Exemplary PVA includes without limitation Potato virus A having nucleic acid sequence as annotated under NCBI Genbank accession number AF543212 (sequence version no. 1 entered on April 4, 2004, i.e., AF543212.1 ). The term "Potato virus M (PVM)" also referred to as "Kartoffel-K-Virus", "Kartoffel- Rollmosaik-Virus", "potato paracrinkle virus", or "potato virus E" denotes herein a plant pathogenic virus of the genus Carlavirus and the family Betaflexiviridae. It is a positive sense RNA virus. Exemplary PVM includes without limitation Potato virus M having nucleic acid sequence as annotated under NCBI Genbank accession number EU604672 (sequence version no. 2 revised on June 29, 2008, i.e., EU604672.1 ).

The terms "Potato virus S (PVS)" or "pepino latent virus" are synonyms and refer to a plant pathogenic virus belonging to the genus Carlavirus and the family Betaflexiviridae. It is a positive sense RNA virus. Exemplary PVS includes without limitation Potato virus S having nucleic acid sequence as annotated under NCBI Genbank accession number AJ863509 (sequence version no. 1 entered on March 16, 2007, i.e., AJ863509.1 ).

The term "reverse-transcription polymerase chain reaction" or "RT-PCR" covers any method for the reverse transcription of RNA into its DNA complement (complementary DNA or cDNA) and the amplification of the resulting cDNA using PCR. The reverse transcription and the PCR of the RT-PCR may be performed separately, i.e. in separate tubes, or in a single step, i.e. in a single tube. The RNA template for RT-PCR may be messenger RNA (mRNA) or any other type of single-stranded RNA, including single- stranded viral RNA. Typically, one departs from a total RNA extract from a sample, i.e. a mixture comprising RNA, including single-stranded RNA, to perform RT-PCR.

Methods for extracting or isolating RNA from a sample are well known in the art. Any method may of course be used and lies within the knowledge of the skilled person. For example, RNA may be extracted from a sample through guanidinium thiocyanate-phenol- chloroform extraction or using a commercially available kit, such as e.g. the RNeasy® Plant mini kit (Qiagen, Hilden, Germany) for extracting total RNA from a plant sample. RNA may be extracted from different parts of the potato plant, including leaves, seeds, tuber, sap, sprouts etc. Preferably, RNA is extracted from the leaves, tubers or sprouts of the potato plant.

The term "reverse-transcription" generally denotes the reaction for the reverse transcription of single-stranded RNA into its complementary cDNA using a reverse transcriptase enzyme and one primer, especially an oligonucleotide primer, complementary to a target sequence of the RNA strand. Reverse transcriptases are known in the art. Any reverse transcriptase may of course be used in the methods of the invention and lies within the knowledge of the skilled person. For example but without limitation, the Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Promega) or the iScript™ reverse transcriptase (Bio-Rad) may be used in the methods dislosed herein. The RT primer may be the same as the reverse primer of a subsequent PCR.

The terms "polymerase-chain reaction" and "PCR" broadly cover any method for amplification of target nucleic acid sequences, especially target DNA sequences, using heat-stable DNA polymerase(s) and two primers, especially oligonucleotide primers, one complementary to the (+)-strand at one end of the sequence to be amplified and the other complementary to the (-)-strand at the other end. DNA polymerases are known in the art. Any DNA polymerase may of course be used in the methods of the invention and lies within the knowledge of the skilled person. For example but without limitation, GoTaq® Flexi DNA polymerase (Promega) or iTaq™ DNA polymerase (Bio-Rad) may be used in the methods disclosed herein.

As used herein, the term "intron spanning" in relation to an oligonucleotide, in particular a primer or a probe, relates to an oligonucleotide of which the 5' end and the 3' end are in different exons of the encoding gene such that the oligonucleotide only binds the sequence without introns, such as e.g. the corresponding spliced mRNA or cDNA, under the conditions employed. The intron-spanning oligonucleotide may comprise one or more bases at either site of the intron. An oligonucleotide, in particular a primer or probe, may span one or more introns.

The term "variant" with respect to an oligonucleotide or a polynucleotide denotes a nucleic acid sequence that includes one or more sequence variations vis-a-vis a reference sequence, such as, e.g., one or more deletion, insertion and/or substitution. Preferably, such variant oligonucleotide or polynucleotide would show at least 85%, more preferably at least 90%, even more preferably at least 95%, and yet more preferably at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the reference sequence, preferably over the whole length of said sequence. Sequence alignments and determination of sequence identity can be done, e.g., using ClustalW (Larkin et al., 2007. ClustalW and ClustalX version 2.0. Bioinformatics 23, 2947-2948) or using the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215: 403-10), such as the "Blast 2 sequences" algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250).

One shall further appreciate that the primers and probes disclosed herein or variants thereof may be derivatised. For example, said primers or probes or variants thereof may be labelled. Such derivatisation may for example entail introducing one or more label moiety and/or one or more accessory moiety (e.g., a quenching moiety, a FRET moiety, etc.), and optionally where required modifying the sequence of the primer or the probe to allow for the introduction and/or proper working of said moiety or moieties. A skilled person is generally knowledgeable about ways to modify primers and probes for purposes of labelling. The use of so-derivatised primers and/or probes can be particularly useful in real-time amplification reactions, such as real-time RT-PCR, and particularly where two or more differently labelled amplification products are to be followed in multiplexed amplification reactions.

With the term "multiplex RT-PCR" is meant herein a variant of RT-PCR, whereby multiple RNA molecules are reverse transcribed, either simultaneously or separately, to produce a mixture that contains multiple cDNA molecules, and then particular target sequences from the multiple cDNA molecules are simultaneously PCR amplified in a single reaction mixture by using more than one primer pair. Detection of the amplicons or amplification products in the methods disclosed herein may be carried out by any of the techniques common in the art. For example, amplicons may be detected using gel electrophoresis, such as, e.g., agarose or polyacrylamide gel electrophoresis, where amplification products are visualised using suitable DNA-binding dyes, such as, e.g., ethidium bromide.

Alternatively, amplicons may be detected by means of probes hybridising to specific sequences within the amplicons. For instance, an amplification product may be immobilised and denatured on a solid support and subsequently hybridised with a labelled probe. Otherwise, the amplification product may itself be labelled, e.g., by including a detectable label (e.g., a fluorophore) in one or both primers and/or by virtue of substrate nucleotides incorporated into the amplification product during amplification, and the so- obtained amplification product may be subsequently denatured and hybridised with specific (oligonucleotide) probes attached to a solid support. For instance, such set-up is suitable for use with probe arrays, e.g., microarrays.

In further exemplary techniques, amplification products may be detected using cloning and sequencing; direct sequencing; oligonucleotide-mediated pyrosequencing (Ahmadian et al. 2000. Anal Biochem 280: 103-1 10); chromatography, e.g., DHPLC, oligonucleotide ligation assays (Landegren et al. 1988. Science 241 : 1077; Eggerding et al. 1995. Hum Mutat 5: 153-165; Nickerson et al. 1990. PNAS 87: 8923-8927); RNAse Protection Assay; etc. The term "real-time RT-PCR" is intended to mean RT-PCR which makes it possible to monitor the evolution of the RT-PCR (see, e.g., Real-Time PCR: An Essential Guide, eds. Edwards et al., Horizon Scientific Press, 2004; Marras SAE et al. 2006. Real-time assays with molecular beacons and other fluorescent nucleic acid hybridization probes. Clin Chim Acta 363: 48-60; for discussion of various real-time PCR platforms).

By means of example and not limitation, real-time RT-PCR as intended herein encompasses fully conventional systems, such as, e.g., the TaqMan™ system developed by Applied Biosystems, which relies on the release and detection of a fluorogenic probe during each round of DNA amplification (Holland et al. 1991 . Detection of specific polymerase chain reaction product by utilizing the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase. PNAS 88: 7276-80). The method uses the 5' exonuclease activity of the DNA polymerase during primer extension to cleave a dual-labelled, fluorogenic probe hybridised to the target DNA between the PCR primers. Prior to cleavage, a reporter fluorophore, such as hexachlorofluorescein (HEX), TexasRed, 6- carboxyfluorescein (FAM), or Cy5, at the 5' end of the probe is quenched by e.g. a Black Hole Quencher (BHQ) through fluorescent resonance energy transfer (FRET). Following digestion, the fluorophore is released. The resulting fluorescence measured in real-time during the log phase of product accumulation is proportional to the number of copies of the target sequence.

Further real-time RT-PCR detection systems may be based on molecular beacons. Molecular beacons are single-stranded polynucleotide probes that possess a stem-and- loop hairpin structure. The loop portion is a probe sequence complementary to a sequence within an amplicon to be detected, and the stem is formed by short complementary sequences located at the opposite ends of the molecular beacon. The molecular beacon is labelled with a fluorophore (e.g., 6-FAM) at one end and a quencher (e.g., TAMRA) at the other end. When free in solution, the stem keeps the fluorophore and the quencher in close proximity, causing the fluorescence of the fluorophore to be quenched by FRET. However, when bound to its complementary target, the probe-target hybrid forces the stem to unwind, separating the fluorophore from the quencher, and restoring the fluorescence. Accordingly, when the quantity of an amplicon increases during amplification, this can be monitored as an increase in the fluorescence of the corresponding beacon (see, e.g., Manganelli et al. 2001. Real-time PCR using molecular beacons. Methods Mol Med 54: 295-310; Marras SAE. 2006. Selection of fluorophore and quencher pairs for fluorescent nucleic acid hybridization probes. Methods Mol Biol 335: 3- 16; Marras SAE et al. 2006. Real-time assays with molecular beacons and other fluorescent nucleic acid hybridization probes. Clin Chim Acta 363: 48-60 for further discussion of molecular beacons detection).

A further exemplary technique for real-time RT-PCR amplification and detection system is the Light Upon Extension (LUX™) system commercialised by Invitrogen (Carlsbad, CA) and described in detail in Nazarenko et al. 2002 (Nucleic Acids Research 30: e37) and Nazarenko et al. 2002 (Nucleic Acids Research 30: 2089-2095). This system employs primer pairs in which usually one of the primers of said primer pair is labelled by a fluorophore (such as, e.g., FAM or JOE or Alexa Fluor 546). The particular structure of the "free" primer quenches the signal of the fluorophore bound thereto, whereas the fluorophore's signal intensity increases when the primer assumes an extended conformation once incorporated into the amplification product. The sequence of the primers must be tailored to perform with the LUX™ technology, e.g. following instructions of the above publications of Nazarenko et al. 2002 or using software tools provided by Invitrogen on www.invitrogen.com/lux.

For description of additional ways to detect and evaluate amplification products in realtime (e.g., using adjacent probes; Light-up probes; Duplex scorpion primers; Amplifluor primers; and further alternative fluorescent hybridisation probe formats see, e.g., Marras SAE et al. 2006. Real-time assays with molecular beacons and other fluorescent nucleic acid hybridization probes. Clin Chim Acta 363: 48-60, esp. section 6 and references therein).

The invention will now be illustrated by means of the following examples, which do not limit the scope of the invention in any way.

Examples

Example 1 : Materials and methods

1.1 Design of primers and probes

Regarding PLRV, PVX, and PVY, highly conserved sequences were identified through multiple alignments of full-length genomes available on the National Centre for Biotechnology Information (NCBI) database, in particular the viral genomic sequences as available under the Genbank accession numbers AF453392 (PLRV), AB196001 (PVX) and AJ889866 (PVY), by using ClustalW2 (Larkin et al., 2007. ClustalW and ClustalX version 2.0. Bioinformatics 23, 2947-2948). Using Beacon Designer™ (PREMIER Biosoft, USA), primers and TaqMan® probes specific to each virus species were designed within those hot spots of conservation. Another set of primers and TaqMan® probe targeting the spliced mRNA transcript of potato PoAc97 gene for actin (as available under Genbank accession number X55751 ) was also developed. To avoid any PCR amplification of the encoding DNA, the annealing position of the reverse primer was selected to overlap the splicing position of the second intron (I2) in the PoAc97 gene (Drouin and Dover, 1990. J. Mol. Evol. 31 (2), 132-150) (Fig. 1A).

Primers length and annealing temperature were set to 18-25 nucleotides (nt) and 59±5 °C, respectively, and amplicon size was limited to 100-150 base pairs (bp). TaqMan® probes length and annealing temperature was ranged between 20-27 nt and 69±5 °C, respectively. The specificity of each primer pair was tested by Primer-BLAST (NCBI).

Primers and TaqMan® probes were synthesized by Eurogentec (Liege, Belgium).

Table 5: Primers and probes

* indicates the position of the second intron I2 in the spliced potato PoAc97 mRNA; ¹ position on the viral genomic sequence; ²position on the spliced potato PoAc97 mRNA; BHQ stands for Black Hole Quencher; HEX, Texas Red, FAM and Cy5 are fluorophores.

A common annealing temperature was determined for all four primer pairs following RT- PCR with a gradient of temperature. RNA extracts from Nicotiana tabacum cv. xanthi infected with PVY-N, PVY-0 or PVX and Solanum tuberosum infected with PLRV were used. The RT step was carried out as described in 1 .2. 2.5 μΙ of RT product was subsequently mixed with 13.13 μΙ sterile water, 2.5 μΙ MgCI₂ 25 mM, 0.5 μΙ of each corresponding forward and reverse primer (PVY_qF/qR, PVX_qF/qR, PLRV_qF/qR or St_Act_qF/qR) 20 μΜ, 0.75 μΙ dNTPs 10 mM, 5 μΙ Green GoTaq® Flexi Buffer five-time concentrated and 0.125 μΙ GoTaq® Flexi DNA Polymerase 5 u/μΙ (Promega, Madison, USA). Samples were then left at 94 °C for 2 min, 40 cycles at 94 °C for 30 sec, 50-60 °C (gradient of temperature) for 30 sec and 72 °C for 30 sec, with a final step at 72 °C for 5 min. The RT and PCR steps were performed in a MJ MiniTM Personal Thermal Cycler (Bio-Rad, Hercules, USA). 58°C was determined as optimal annealing temperature after running the RT-PCR products on an electrophoresis gel (TBE one-time concentrated, 1 .2 % agarose).

7.2 cDNA synthesis (RT reaction conditions)

For synthesizing cDNA, 10-50 ng of RNA extract was mixed with reverse primer 20 μΜ (PVY_qR, PVX_qR, PLRV_qR and/or St_Act_qR, 1 μΜ final concentration for each individual primer) and DEPC water up to 10 μΙ final volume and first heated at 65°C for 10 min. 3.75 μΙ DEPC water, 2 μΙ dNTPs 10 mM, 0.25 μΙ M-MLV Reverse Transcriptase 200 u/μΙ and 4 μΙ M-MLV RT buffer five-time concentrated (Promega) were then added to the samples that were left for 60 min cDNA synthesis at 42 °C. The RT reaction was performed in a MJ MiniTM Personal Thermal Cycler (Bio-Rad). 1.3 qPCR standards

Targeted sequences of the viral genome of PLRV, PVY-N, PVY-O, PVX and potato actin mRNA were amplified by RT-PCR using the respective primers from Table 5 and following the protocol described in 1 .1 above. Amplicons were cloned into pGEM®-T vector (Promega) and the resulting constructs were transformed into Escherichia coli strain DH5- alpha, purified with the Qiaprep Spin Miniprep kit (Qiagen, Hilden, Germany) and checked by sequencing (Macrogen, Seoul, Korea).

Serial dilutions of circular plasmids were used as standards for qPCR reactions (five standards per run). Linear constructs were preferred to determine the multiplex qPCR sensitivity. With this view, aliquots of the five plasmids were linearized with Spel restriction enzyme (Promega), purified using the MSB® Spin PCRapace (Invitek, Berlin, Germany) and quantified with the Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA).

1.4 Bioassays, virus-infected versus healthy potatoes and RNA extraction Three potato varieties, Bintje, Kennebec and Spunta (Binst, Grimbergen, Belgium), were selected for the bioassay as representative from the major Belgian seed and stock markets. Five plants of each variety were inoculated with PVY-N, PVY-0 (two serotypes of PVY), PVX or PLRV, by means of Myzus Persicae (Viridaxis, Gilly, Belgium) for the latter and mechanically for the three others. The aphids were left for five days either on Physalis floridana infected with PLRV (DSMZ, Braunschweig, Germany) or on healthy potatoes cv Bintje. Thirty aphids were then transferred on each potato plant to get both PLRV-infected and healthy plants (three negative controls). Regarding PVY-N, PVY-0 and PVX, viral strains collected in Belgian crops (kindly provided by V. Genin) were mechanically inoculated on potatoes from Nicotiana tabacum cv. xanthi infected leaves grinded in phosphate buffer 0.01 M. Three mock-inoculated plants served as negative controls (-C).

PLRV-infected and non-infected potatoes were kept in a conditioned room for one month at 21 -22 °C with twelve hours dark and light periods during night and day, respectively, before harvest. Mechanically-inoculated plants and mock-inoculated controls were grown in the greenhouse for twenty-eight days at 15-20 °C with eight and sixteen hours dark and light periods during night and day, respectively.

Harvested leaves of potato plants were first kept at -20 °C for some days before sampling 150 mg for each potato plant. These samples were then kept for one-two month at -80°C before performing extractions of total RNAs with the RNeasy® Plant mini kit (Qiagen), following the manufacturer's instructions. RNA concentration and purity were assessed with the Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific).

The presence or absence of each virus in RNA extracts was checked by singleplex realtime RT-PCR. The RT step was carried out as described in 1 .2 above on 10 ng total RNA. The real-time PCR was performed on 2 μΙ of cDNA, mixed with 0.3 μΙ of each corresponding forward and reverse primers 20 μΜ from Table 5, 0.1 -0.2 μΙ of the adequate fluorogenic probe 20 μΜ, 10 μΙ iTaqTM Universal Probes Supermix (Bio-Rad) and sterile water up to 20 μΙ final volume. Samples were then left in a CFX96 real-time cycler (Bop-Rad) at 95 °C for 30 sec and 40 cycles at 95 °C for 5 sec and 58 °C for 30 sec.

1.5 Potato leaves from the fields

The level of expression of PoAc97 mRNA was also assessed in the leaves of potato plants from the fields. During the growing season 2012, leaves were collected in the fields of five different farms in the Walloon Region, Belgium, which cropped five distinct and major potato varieties (Bintje, Innovator, Kennebec, Nicola or Spunta). Three plots of one hundred square meters were determined for each of the five fields and ten potato plants were followed per plot. Leaves were collected twice, in early July and August, and samples from the same plot were pooled (one leaf per plant, ten leaves per plot) before the RNA extractions were performed as described in 1 .4 above. RNA extracts were kept at -80°C until being analysed.

1.6 Quantification of potato PoAc97 mRNA

Expression of PoAc97 mRNA was quantified by RT-qPCR. The impact of a viral infection on the stability of expression of PoAc97 mRNA in potato leaves was investigated through the bioassay described in 1.4 above. The RT step was performed on 10 ng of total RNA extract and with the St_Act_qR reverse primer following the protocol described in 1 .2 above. 1 μΙ of RT reaction product was subsequently mixed with 0.35 μΙ of each St_Act_qF and St_Act_qR 20 μΜ, 10 μΙ iQ SYBR Green Supermix (Bio-Rad) and 8.3 μΙ sterile water for quantifying the PoAc97 cDNA. Samples were run in a CFX96 real-time cycler (BioRad) at 95 °C for 3 min, then 40 cycles at 95 °C for 30 sec, 58 °C for 30 sec and 72 °C for 30 sec. An additional step of 0.5 °C temperature increment for 5 sec from 55 °C to 95 °C was added following the qPCR for the melt curve analysis. Optimal single thresholds were selected to determine the Cq.

The level of expression of the PoAc97 mRNA was further tested in potato samples collected in the fields as described in 1.5 above. The RT step was performed on 50 ng of total RNA extract and with the St_Act_qR reverse primer following the protocol described in 1 .2 above. The actin mRNA was then quantified by real-time PCR using the iTaqTM Universal Probes Supermix as described in 1 .4 above.

Boxplots were performed with the R program to compare the Cq variations of the potato actin PoAc97 between the different conditions (R Development Core Team, 2012).

1.7 Multiplex qPCR reaction conditions

Template DNA or cDNA was added to a reaction mix containing 0.3 μΙ of each forward and reverse primer 20 μΜ and 0.2 μΙ of TaqMan probe 20 μΜ, 10 μΙ iQ Multiplex Powermix (Bio-rad), DNA and sterile water up to 20 μΙ final volume. Samples were left in a CFX96 real-time cycler (BioRad) first for 3 min at 95 °C, then forty cycles at 95°C for 15 sec followed by 1 min at 58 °C.

Example 2: Exclusive amplification of potato actin mRNA The inability of primers St_Act_qF and St_Act_qR targeting potato actin mRNA to amplify the corresponding encoding DNA (PoAc97) was tested. RT-PCR were performed following the conditions described in Example 1.1 on RNA extracts from healthy S. tuberosum cv. Bintje, Kennebec and Spunta using primers St_Act_qF and St_Act_qR from Table 5. The presence of PoAc97 in the RNA extracts was checked by PCR using St_Act_qF and another reverse primer annealing partially to the second intron of the PoAc97 gene (5'-TTTTCTTACCGGTGGTACG-3\ SEQ ID NO: 32) (Fig. 1A).

As checked by classical RT-PCR (Fig. 1 B) and qPCR (Table 6), a preliminary step of reverse transcription was evidenced to be necessary for amplifying the potato actin mRNA using the primers St_Act_qF and St_Act_qR.

Example 3: Potato PoAc97 mRNA as internal control

To examine whether the level of expression of PoAc97 was affected by viral infection, its mRNA was quantified by real-time RT-qPCR in both healthy and virus-infected plants in a bioassay. A single peak was identified in the melt curve analysis (data not shown), also arguing in favor of the exclusive amplification of PoAc97 mRNA and not the encoding genomic DNA containing introns. The boxplots in Fig. 2 A illustrate the little variations recorded for the quantity of potato PoAc97 mRNA between virus-infected and healthy potato plant samples. Furthermore, the level of expression of the potato actin mRNA was tested in potato leaves collected in the fields during the growing season 2012. Singleplex RT-qPCR were performed to quantify the PoAc97 mRNA in the leaves of five potato varieties cropped at five different locations in the Walloon Region in Belgium. As presented on Fig. 2B, the potato actin was detected within the range of 26-32 Cq when considering all five potato varieties and two collection dates (July and August).

These results support the use of this target as an internal control for the multiplex detection of potato viruses by real-time RT-PCR.

Example 4: Comparison of single- and multiplex qPCR

The four couples of primers and probes were used separately or combined in qPCR runs to compare the efficiencies of single- and multiplex qPCR, respectively. The individual and simultaneous detection of PVY-N, PVY-O, PVX, PLRV and potato actin mRNA were tested on pooled standards by qPCR following the protocol of Example 1 .7. Five ten-times dilutions of combined DNA were added to the qPCR reaction mix containing either one or more of the primers and probe couples from Table 5. Optimal single thresholds were selected automatically or manually, but the same threshold was selected in both conditions for each target. Comparable qPCR results were obtained when the four primers and probes couples were combined or used separately, in multiplex and singleplex reactions, respectively. For all targeted PVY-N, PVY-O, PLRV, PVX and potato actin mRNA, standard curves from both running conditions exhibited similar efficiencies, R² and slopes. Mean Cq variations (ACq) between samples run in singleplex and multiplex qPCR raised maxima 0.23 (± 0.07), 0.35 (± 0.05), 0.25 (± 0.05), 0.19 (± 0.08) or 0.07 (± 0.06) for PVY-N, PVY-O, PLRV, PVX and actin, respectively.

Example 5: Sensitivity of the multiplex qPCR

The sensitivity of the multiplex qPCR was assessed on pools of ten-times-diluted linearized standards. 10^"1 ng to 10^"8 ng combined DNA were added to the qPCR reaction mix containing all four primers and probe couples. The number of targeted molecules ranged therefore from 3x10⁷ in the most concentrated standard (10^"1 ng linear plasmid) to 3 DNA copies in the most diluted (10^"8 ng linear plasmid), according to the formula: number of DNA molecules = DNA quantity (g) x 6.022 x 10²³ (Avogadro's constant) / 660 (average molecular weight in Daltons of a base pair) x 3100 (average length in nucleotides of linearized plasmids) (cf. Real-Time PCR Brochure 07/2010, Critical Factors for Successful Real-Time PCR, Qiagen for exemplary conditions). The same serial dilutions of the potato PoAc97 standard were used in a classical PCR (as described in Example 1 .1 ) to compare the detection threshold with that of the multiplex qPCR.

The multiplex qPCR performed on serial dilutions of linearized plasmids detected from 3x10⁷ (~ 13 Cq) to 3 copies (~ 38 Cq) of targeted DNA sequences (Fig. 3A), which corresponds to a detection sensitivity of potato virus in the femtogram range, particularly of about half a femtogram.

As also evidenced on Fig. 3, no difference in the qPCR sensitivity was observed when detecting PVY-N or PVY-O strains, using primers and probes specific for PVY.

When used in a classical PCR, the primers targeting potato actin mRNA detected up to thirty DNA molecules (Fig. 3B). No band was however visible on the electrophoresis gel when only three DNA copies of the potato actin mRNA were added in the tube.

Example 6: Validation of the quadriplex real-time RT-PCR on virus-infected potato plant samples

RNA extracts from single virus-infected potatoes (cv. Spunta) were combined to test the robustness of the multiplex real-time RT-PCR for all possible target combinations as shown in Table 6. For the RT step 50 ng of each RNA extract were mixed with 1 μΙ of each of the reverse primers 20 μΜ from Table 5. 2 μΙ of RT products were subsequently used for the multiplex qPCR performed as described above in 1.7. Another multiplex qPCR, without any preliminary RT step, was carried out on an RNA extract from a healthy potato plant to confirm the mRNA-exclusive amplification of potato actin mRNA.

The Cq variations between the different virus mixes raised maxima 0.3, 0.5 and 0.6 units for the PVY, PVX, and PLRV, respectively (Table 6). In all cases, the Cq values were slightly reduced by the simultaneous detection of different targets. The data presented in Table 6 for PVY were obtained with the PVY-N type and similar results were observed with PVY-0 (data not shown).

Table 6: Comparison of uniplex, duplex and triplex virus detection with multiplex RT-qPCR.

^* The maximum ACq for potato actin mRNA was only considered for single combinations.

Claims

1 . A method for determining the presence or absence of one or more potato virus in a potato plant comprising:

a) simultaneously amplifying potato actin mRNA, preferably encoded by the PoAc97 gene, and viral RNA of said one or more potato virus by RT-PCR using a RNA extract from said potato plant;

b) detecting the amplicons of step a),

2. The method according to claim 1 , wherein said potato actin mRNA is amplified using a primer pair wherein at least one primer is intron-spanning.

3. The method according to any one of claims 1 or 2, wherein said potato actin mRNA is amplified using a primer pair configured to amplify between about 50 and about 300 bases, preferably between about 100 and about 150 bases of the sequence of the potato actin mRNA of SEQ ID NO: 1 or of variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98% or 99% sequence identity to said sequence.

4. The method according to any one of claims 1 to 3, wherein said potato actin mRNA is amplified using the primer pair of SEQ ID NO: 8 and SEQ ID NO: 9, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pair, or derivatives of said primer pair or variants.

5. The method according to any one of claims 1 to 4, wherein said viral RNA of one or more potato virus is amplified using one or more primer pairs configured to amplify between about 50 and about 300 bases, preferably between about 100 and about 150 bases of the respective sequence of the viral genome of one or more potato virus selected from the following table, or of variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence: PLRV aatactcaaggcctaccatgagtataagatcacaagcatcttacttcagttcgtcagcgaggcctcttc cacctcctccggttccatcgcttatgagttggacccccattgcaaagtatcatccctccagtcctacgtc (SEQ ID N0: 2)

PVS agagcctaatgctcaatccctaatttccaacgtcgccaccagcagctttcaagagagtgagaagg

6. The method according to any one of claims 1 to 5, wherein said viral RNA of one or more potato virus is amplified using one or more of the respective primer pairs selected from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pairs, or derivatives of said primer pairs or variants:

7. The method according to any one of claims 1 to 6, wherein the amplicons are detected using probes comprising a sequence identical to or complementary to respectively, the sequence of the potato actin mRNA of SEQ ID NO: 1 or the respective sequence of the viral genome of one or more potato virus selected from the following table, or to variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said sequence, or to fragments thereof comprising between about 10 and about 40 bases, preferably between about 20 and about 30 bases, such as 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 bases of the said sequence or variants: PLRV aatactcaaggcctaccatgagtataagatcacaagcatcttacttcagttcgtcagcgaggcctcttccacctcctccggtt ccatcgcttatgagttggacccccattgcaaagtatcatccctccagtcctacgtc (SEQ ID NO: 2)

PVX tgctaactggcaagcacaaggtttcaagcctgagcacaaattcgctgcattcgacttcttcaatggagtcactaacccagct gccatcatgcccaaagaggggcttatccggccaccgtctgaagctgaaatgaatgctgcccaaactgc (SEQ ID NO: 3)

PVY tgaaaccaatcgttgagaatgcaaaaccaacacttaggcaaatcatggcacatttctcagatgttgcagaagcgtatatag aaatgcgcaacaaaaaggaaccatatatgccacgatatggttta (SEQ ID NO: 4)

PVA aagctattttggaagatttcaagcaataagacattcgcgaaggtactgcactgcgggtacaattgttgtc

aagccagaaaggcacgtagacttaggaggaatctacgctacatcctatca (SEQ ID NO: 5)

PVM aacattgtgtgcctggtatctcttacaatgtgcgcgtggcgcaatttattgatgaaggagtaaccgaggtgataccttcagtcat caacaagcgagagtagccattaaatcctatttaatatataacgtgtgctactataaataaa (SEQ ID NO: 6)

PVS agagcctaatgctcaatccctaatttccaacgtcgccaccagcagctttcaagagagtgagaaggataacttcgcctggtttt gctaccatgtgtcggctagcgccaaggaacaccttagtagagcaggaatttacc (SEQ ID NO: 7)

8. The method according to any one of claims 1 to 7, wherein the amplicons are detected using the respective probes selected from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said probes, or derivatives of said probes or

variants:

9. A kit for determining the presence or absence of one or more potato virus in a potato plant comprising:

- one or more primer pair for amplifying viral RNA of said one or more potato virus, and

- a primer pair for specifically amplifying potato actin mRNA preferably encoded by the PoAc97 gene.

10. The kit according to claim 9, wherein the primer pair for amplifying potato actin mRNA is the primer pair of SEQ ID NO: 8 and SEQ ID NO: 9, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pair, or derivatives of said primer pair or variants.

1 1 . The kit according to any one of claims 9 or 10, wherein the one ore more primer pair for amplifying viral RNA of one or more potato virus is the respective primer pair selected from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pairs, or derivatives of said primer pairs or variants:

12. The kit according to any one of claims 9 to 1 1 , further comprising:

- a probe for detecting the potato actin mRNA amplicon.

13. The kit according to any one of claims 9 to 12, wherein the one or more probe for detecting the viral RNA amplicon of one or more potato virus and the probe for detecting the potato actin mRNA amplicon, are the respective probes selected from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said probes, or derivatives of said probes or variants:

potato actin 5' TTGCTATTCAGGCTGTACTCTCACT 3' (SEQ ID NO: 22)

mRNA

PLRV 5' AG CATCTTACTTCAGTTC GTCAG C 3' (SEQ ID NO: 23)

PVX 5' CTGCATTCGACTTCTTCAATGGAGT 3' (SEQ ID NO: 24)

PVY 5' ACACTTAG G CAAATCATG G CACA 3' (SEQ ID NO: 25)

PVA 5' ACTGCACTGCGGGTACAATT 3' (SEQ ID NO: 26) PVM 5' CTACTCTCGCTTGTTGATGACTGAA 3' (SEQ ID NO: 27)

PVS 5' CTAGCCGACACATGGTAGCAA 3' (SEQ ID NO: 28)

14. The kit according to any one of claims 9 to 13 for simultaneously amplifying viral RNA from PLRV, PVX and PVY consisting of the primer pairs from the following table, or variants thereof having at least about 80%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% sequence identity to said primer pairs, derivatives of said primer pairs or variants:

15. Use of PoAc97 as an internal control in a method for detecting one or more potato virus in potato by reverse-transcription polymerase chain reaction (RT-PCR).