CN110029183A - A kind of primer, detection method and kit for identifying tobacco PVY resistance - Google Patents
A kind of primer, detection method and kit for identifying tobacco PVY resistance Download PDFInfo
- Publication number
- CN110029183A CN110029183A CN201810026574.4A CN201810026574A CN110029183A CN 110029183 A CN110029183 A CN 110029183A CN 201810026574 A CN201810026574 A CN 201810026574A CN 110029183 A CN110029183 A CN 110029183A
- Authority
- CN
- China
- Prior art keywords
- primer
- tobacco
- pvy
- pvy resistance
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000208125 Nicotiana Species 0.000 title claims abstract description 74
- 235000002637 Nicotiana tabacum Nutrition 0.000 title claims abstract description 74
- 238000001514 detection method Methods 0.000 title claims abstract description 30
- 238000012408 PCR amplification Methods 0.000 claims abstract description 22
- 239000000463 material Substances 0.000 claims abstract description 18
- 101150101308 eIF4E1 gene Proteins 0.000 claims description 15
- 238000011144 upstream manufacturing Methods 0.000 claims description 14
- 239000002773 nucleotide Substances 0.000 claims description 11
- 125000003729 nucleotide group Chemical group 0.000 claims description 11
- 238000010367 cloning Methods 0.000 claims description 7
- 239000003153 chemical reaction reagent Substances 0.000 claims description 6
- 238000004925 denaturation Methods 0.000 claims description 6
- 230000036425 denaturation Effects 0.000 claims description 6
- 239000000499 gel Substances 0.000 claims description 6
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 4
- 238000000137 annealing Methods 0.000 claims description 3
- 239000012153 distilled water Substances 0.000 claims description 3
- 238000012772 sequence design Methods 0.000 claims description 2
- 238000009395 breeding Methods 0.000 abstract description 22
- 230000001488 breeding effect Effects 0.000 abstract description 22
- 238000000034 method Methods 0.000 abstract description 16
- 108090000623 proteins and genes Proteins 0.000 abstract description 7
- 230000004907 flux Effects 0.000 abstract description 3
- 238000007689 inspection Methods 0.000 abstract description 2
- 241000723762 Potato virus Y Species 0.000 description 46
- 241000196324 Embryophyta Species 0.000 description 10
- 238000012360 testing method Methods 0.000 description 9
- 235000019504 cigarettes Nutrition 0.000 description 7
- 230000009182 swimming Effects 0.000 description 7
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- 230000003321 amplification Effects 0.000 description 4
- 201000010099 disease Diseases 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 210000003462 vein Anatomy 0.000 description 4
- 241000700605 Viruses Species 0.000 description 3
- 210000001367 artery Anatomy 0.000 description 3
- 238000011835 investigation Methods 0.000 description 3
- 238000012797 qualification Methods 0.000 description 3
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 2
- 239000010931 gold Substances 0.000 description 2
- 229910052737 gold Inorganic materials 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 239000003595 mist Substances 0.000 description 2
- 210000003205 muscle Anatomy 0.000 description 2
- 230000017074 necrotic cell death Effects 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- 239000002574 poison Substances 0.000 description 2
- 231100000614 poison Toxicity 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 235000002566 Capsicum Nutrition 0.000 description 1
- 240000008574 Capsicum frutescens Species 0.000 description 1
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 235000007688 Lycopersicon esculentum Nutrition 0.000 description 1
- 102000005877 Peptide Initiation Factors Human genes 0.000 description 1
- 108010044843 Peptide Initiation Factors Proteins 0.000 description 1
- 108700005079 Recessive Genes Proteins 0.000 description 1
- 102000052708 Recessive Genes Human genes 0.000 description 1
- 241000208292 Solanaceae Species 0.000 description 1
- 240000003768 Solanum lycopersicum Species 0.000 description 1
- 244000061458 Solanum melongena Species 0.000 description 1
- 235000002597 Solanum melongena Nutrition 0.000 description 1
- 244000061456 Solanum tuberosum Species 0.000 description 1
- 235000002595 Solanum tuberosum Nutrition 0.000 description 1
- 208000036142 Viral infection Diseases 0.000 description 1
- 239000001390 capsicum minimum Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004043 dyeing Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 239000003147 molecular marker Substances 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 230000000474 nursing effect Effects 0.000 description 1
- 230000003071 parasitic effect Effects 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 231100000241 scar Toxicity 0.000 description 1
- 230000014621 translational initiation Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biological gene detection fields, and in particular to a kind of primer, detection method and kit for identifying tobacco PVY resistance, the sequence of the primer pair is as shown in SEQ ID NO:1 and SEQ ID NO:2, the method for inspection are as follows: is directed to tobaccoeIF4E1A pair of of specific primer is designed in gene order specific regions, using tobacco bred DNA to be detected as template, is translated and is detected by PCR amplificationeIF4E1Gene；Primer and its detection method of the invention has many advantages, such as that easy to operate, result is reliable, detection speed is fast, flux is high, the Breeding Process of anti-PVY breeding material can be significantly speeded up, shorten breeding cycle, improves breeding efficiency, apply also for tobacco germplasm and kind PVY Resistance Identification.
Description
Technical field
Biological gene detection field, and in particular to a kind of primer, detection method and reagent for identifying tobacco PVY resistance
Box.
Background technique
PVY virus belongs to systematicness dip dyeing virus, and main parasitic is on plant of Solanaceae such as tobacco, tomato, capsicum, eggplant etc.
Crop.According to statistics according to imperfect number, -2015 years 2012 China tobaccos are 1,160,000 mu accumulative by the harm of PVY virus, yield of tobacco
More than 17000 tons, economic loss is more than 2.75 hundred million yuan for loss.There is no the means of effective treatment PVY, the anti-PVY of breeding at present
Kind be most economical, most effective measure.
In the anti-PVY breeding process of tradition, PVY Resistance Identification method is mainly crop field inoculated identification and greenhouse inoculated identification.
The two methods are cumbersome, heavy workload, and qualification cycle is long, is influenced by planting environment, and uncontrollable factor is more, and are inoculated with
The success or not of virus also directly affects qualification result, and then influences the judgement to tobacco bred PVY resistance.
At present in production the anti-source of PVY virosis that mainly utilizes from burley tobaccos VAM (Virgin A Mutant),
Resistance controls (va) by single recessive gene.For the resistance locus, develop both at home and abroad relevant molecular labeling (RAPD,
SCAR).But these labels and the genetic distance of PVY resistance are farther out, judge that resistance error is larger using flag data.2015,
The va assignment of genes gene mapping in No. 21 linkage group of tobacco and is obtained gene order by the method for map based cloning by Julio etc..It should
Gene is a susceptible gene, is eukaryotic translation initiation factor eIF4E1, and potato Y disease can be limited after loss of function
Poison belongs to the intercellular movement of virus, and then increases the PVY resistance of plant.
Summary of the invention
In view of the defects existing in the prior art, the present invention provide it is a kind of identify the primer of tobacco PVY resistance, detection method and
Kit detects different tobacco bred PVY resistances using the susceptible gene eIF4E1 sequence design specific primer of PVY；The present invention
Resistance Identification method do not influenced by growth conditions and developmental stage, can detection rapidly and efficiently be based on the control of eIF4E1 gene
The PVY resistance of system accelerates breeding process, improves breeding efficiency.
An object of the present invention is to provide a kind of primer for identifying tobacco PVY resistance, and the second purpose, which is to provide to utilize, is somebody's turn to do
Primer carries out amplification purpose nucleotide sequence, the detection method then identified, the third purpose is that one kind is drawn containing this altogether
The kit of object, primer of the invention and its detection method have easy to operate, result is reliable, detection speed is fast, flux is high etc.
Advantage can significantly speed up the Breeding Process of anti-PVY breeding material, shorten breeding cycle, improve breeding efficiency, can also apply
In tobacco germplasm and kind PVY Resistance Identification.
An object of the present invention is to be achieved through the following technical solutions:
The primer of the identification tobacco PVY resistance, the primer are for detecting the susceptible gene eIF4E1 sequence of tobacco PVY
It is designed specific primer, including upstream primer PVY1F and downstream primer PVY1R；
Wherein, the upstream primer PVY1F nucleotide sequence is as shown in SEQ ID NO:1；
Are as follows: 5 '-AACCACCCAAGCAAGTTAGT-3 '；
The downstream primer PVY1R nucleotide sequence is as shown in SEQ ID NO:2:
Are as follows: 5 '-ATTTTATCCCCCTTATTTCG-3 '.
The sequence of eIF4E1 gene order of the present invention specific regions is as follows:
AACCACCCAAGCAAGTTAGTTGTGGGAGCAGACTTTCATTGTTTTAAGCATAAAATTGAGCCAAAGTGG
GAAGATCCTGTATGTGCGAATGGAGGGAATTGGACAATGAGCTTTAGTAAGGGTAAATCTGATACCAGCTGGCTATA
CACGGTATGCTGAGGATATTTTAATCCAGTTCTTAATGTTAGGGCGCAGTCTCGTAAAGTTATTTTCCCCTTTGATA
TTATTTCAACTCTTATTTTCTCATTTGGGATTATTGTAGCTGCTGGCAATGATTGGACATCAATTCGATCATGGAGA
GGAAATTTGTGGAGCAGTAGTTAGCGTCCGAAATAAGGGGGATAAAAT
In above-mentioned eIF4E1 gene order specific regions, before draw underscore sequence be upstream primer PVY1F；Afterwards
The reverse complementary sequence that underlined sequences are drawn in face is downstream primer PVY1R.
The second object of the present invention is to be achieved through the following technical solutions:
A kind of detection method for identifying tobacco PVY resistance, comprising the following steps:
S1, the DNA for being detected tobacco-containing material is extracted；
S2, by the DNA of detected tobacco-containing material described in step S1 be template, using specific primer to DNA profiling
PCR amplification is carried out, DNA cloning product is obtained；
S3, DNA cloning product is detected using agarose gel electrophoresis, when 348bp occurs in gel in pcr amplification product
When corresponding electrophoretic band, the detected tobacco-containing material is free of eIF4E1 gene, has PVY resistance；When pcr amplification product exists
When not occurring the corresponding electrophoretic band of 348bp in gel, the detected tobacco-containing material, which does not have, is based on the control of eIF4E1 gene
The PVY resistance of system；
Wherein specific primer described in step S2 uses above-mentioned primer i.e.: drawing including upstream primer PVY1F and downstream
Object PVY1R；
Wherein, the upstream primer PVY1F nucleotide sequence is as shown in SEQ ID NO:1；
Are as follows: 5 '-AACCACCCAAGCAAGTTAGT-3 '；
The downstream primer PVY1R nucleotide sequence is as shown in SEQ ID NO:2:
Are as follows: 5 '-ATTTTATCCCCCTTATTTCG-3 '.
The second object of the present invention can also be achieved through the following technical solutions:
In the detection method of above-mentioned identification tobacco PVY resistance, the reaction system of PCR amplification described in step S2 is as follows:
2×Power Taq PCR MasterMix 10μl；
10 μM of 1 μ l of upstream primer；
10 μM of 1 μ l of downstream primer；
Distilled water is mended to 20 μ l.
Further, the reaction condition of PCR amplification described in step S2 is as follows:
95 DEG C of initial denaturation 2min；
95 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 recycle；
Last 72 DEG C of extensions 7min.
Further, the template of DNA described in step S2 is 50-100ng in the dosage of the reaction system of PCR amplification.
The third object of the present invention is achieved through the following technical solutions:
A kind of kit for identifying tobacco PVY resistance, the kit includes: PCR reaction reagent and primer；The primer
For the primer of identification tobacco PVY resistance described above, it may be assumed that including upstream primer PVY1F and downstream primer PVY1R；
Wherein, the upstream primer PVY1F nucleotide sequence is as shown in SEQ ID NO:1；
Are as follows: 5 '-AACCACCCAAGCAAGTTAGT-3 '；
The downstream primer PVY1R nucleotide sequence is as shown in SEQ ID NO:2:
Are as follows: 5 '-ATTTTATCCCCCTTATTTCG-3 '.
Compared with prior art, the primer of identification tobacco PVY resistance provided by the present invention and its detection method and reagent
Box has the advantages that
The primer of identification tobacco PVY resistance provided by the present invention is designed based on eIF4E1 gene specific sequence, by straight
The PVY resistance for detecting the presence or absence of susceptible gene eIF4E1 to judge tobacco bred is connect, with the reported related molecular marker of document
It compares, testing result is more accurate reliable.The primer and its detection method and reagent of identification tobacco PVY resistance provided by the invention
Box can shorten breeding process, improve breeding efficiency, while quick, high throughput applied to tobacco germplasm and kind PVY
Resistance Identification.
Detailed description of the invention
Fig. 1 is the amplification in the 30 parts of tobacco breds to be measured identified using detection method, wherein swimming
Road M is DL500DNA Ladder；
The first row, are as follows: after swimming lane M be 1-15 parts of tobacco breds to be measured detection track, swim from left to right
Road be followed successively by CV88, CV87, FC8, VAM, anti-88, CV91, C151, CV58, middle cigarette 103, build wave 1, NC55, cloud and mist 87, in
Cigarette 100, NC82, Hongda tobacco；
Second row, are as follows: after swimming lane M be 16-30 parts of tobacco breds to be measured detection track, swim from left to right
Road be followed successively by K326, TN86, TN90, V2, small gold 1025, Speight-G28, great Bai muscle 599, middle cigarette 15,9201, NC567,
K346, Coker176, Yun yan85, No. 1 dark green, middle cigarette 98.
Specific embodiment
Below by specific embodiment and in conjunction with attached drawing, invention is further described in detail.Following case study on implementation is only
The present invention is further detailed, should not be construed as limiting the invention.
A kind of primer for identifying tobacco PVY resistance of embodiment 1
The primer of the identification tobacco PVY resistance, including upstream primer PVY1F and downstream primer PVY1R；
Wherein, the upstream primer PVY1F nucleotide sequence is as shown in SEQ ID NO:1；
Are as follows: 5 '-AACCACCCAAGCAAGTTAGT-3 '；
The downstream primer PVY1R nucleotide sequence is as shown in SEQ ID NO:2:
Are as follows: 5 '-ATTTTATCCCCCTTATTTCG-3 '.
A kind of detection method for identifying tobacco PVY resistance of embodiment 2
The following steps are included:
S1, the DNA for being detected tobacco-containing material is extracted；
S2, by the DNA of detected tobacco-containing material described in step S1 be template, using specific primer to DNA profiling
PCR amplification is carried out, the template consumption of DNA is 50-100ng, obtains DNA cloning product；Wherein the specific primer uses
The primer for the identification tobacco PVY resistance that embodiment 1 provides；
S3, DNA cloning product is detected using agarose gel electrophoresis, when 348bp occurs in gel in pcr amplification product
When corresponding electrophoretic band, the detected tobacco-containing material is free of eIF4E1 gene, has PVY resistance；When pcr amplification product exists
When not occurring the corresponding electrophoretic band of 348bp in gel, the detected tobacco-containing material, which does not have, is based on the control of eIF4E1 gene
The PVY resistance of system；
Wherein, specific primer described in step S2 uses primer described in embodiment 1.
Wherein, the reaction system of PCR amplification described in step S2 is as follows:
2×Power Taq PCR MasterMix 10μl；
10 μM of 1 μ l of upstream primer；
10 μM of 1 μ l of downstream primer；
Distilled water is mended to 20 μ l.
The reaction condition of PCR amplification described in step S2 is as follows:
95 DEG C of initial denaturation 2min；
95 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 recycle；
Last 72 DEG C of extensions 7min.
A kind of kit for identifying tobacco PVY resistance of embodiment 3
The kit includes the primer and PCR reaction reagent of identification tobacco PVY resistance described in embodiment 1；The examination
The detection method of agent box such as embodiment 2.
Test example 1 verifies identification result
Subjects: the artificial group of F2, source are as follows: with disease-resistant variety VAM be male parent, susceptible variety K326 is hybridization of female parent
The seed of F1 generation is obtained, then is selfed to obtain F2 group by F1.
The phenotypic evaluation of tobacco F2 generation individual:
F2 seed is sowed, is placed in artificial climate room, 25 DEG C of cultures carry out being transplanted in small flower after seedling grows up
Face, obtains F2 for 282 plants of single plant, seedling it is long to the 5-6 leaf phase when take blade 0.1g, with liquid nitrogen flash freezer, -80 DEG C of preservations, for mentioning
Take DNA.It after sampling, carries out manually connecing poison using the method for frictional inoculation, PVY virus is the downright bad strain 9703-5 (public
Can be obtained from Tobacco Institute, Chinese Academy of Agricultural Science), Disease investigation is carried out after being inoculated with 21d.Without floral leaf, arteries and veins band and leaf when investigation
The PVY symptom such as arteries and veins necrosis is denoted as disease-resistant (R)；The PVY symptoms such as floral leaf, arteries and veins band and vein necrosis are showed when investigation, are denoted as susceptible
(S)；Obtain the phenotypic data of 282 single plants of F2.
Test result: identifying that the detection method of tobacco PVY resistance identifies 282 single plants of F2 by embodiment 2, right
PCR product carries out agarose gel electrophoresis, and testing result is 79 plants of anti-PVY plant pcr amplification products without 348bp size
Band, 203 plants of sense PVY plant pcr amplification products have the band of 348bp size.Testing result and Resistance Identification result are complete
It is consistent, illustrates that primer designed by the present invention can be used for the identification of PVY resistance in artificial constructed tobacco group, do not amplify
348bp band is anti-PVY material.Found by test example 1, primer of the invention and its detection method have it is easy to operate,
As a result reliable, the Breeding Process of anti-PVY breeding material can be significantly speeded up, breeding cycle is shortened, breeding efficiency is improved, may be used also
Applied to tobacco germplasm and kind PVY Resistance Identification.
2 qualification test of test example
Resistance Identification is carried out to 30 tobacco breds to be measured using kit described in embodiment 3.
Subjects: material source: tobacco bred saves that (public can be from from Tobacco Institute, Chinese Academy of Agricultural Science
Tobacco Institute, Chinese Academy of Agricultural Science obtains).Tobacco bred to be measured is seeded in seedlings nursing plate, is placed in artificial climate room,
25 DEG C of cultures take blade 0.1g when seedling seedling length to the 5-6 leaf phase, and with liquid nitrogen flash freezer, -80 DEG C are saved, for extracting DNA,
The extraction of tobacco sample DNA is carried out using routine CTAB method.
PCR amplification is carried out to the DNA of kind to be detected using kit of the invention, the reaction system of PCR amplification and anti-
Answer program with embodiment 2.Agarose gel electrophoresis is carried out to PCR product, amplification is as shown in Figure 1, for using present invention inspection
The amplification in 30 parts of tobacco breds to be measured that survey method is identified, wherein swimming lane negative control is water, and swimming lane M is
DL500DNA Ladder；
The first row in Fig. 1, DNA profiling dosage are 50ng, and swimming lane is followed successively by CV88, CV87, FC8, VAM, resists from left to right
88, CV91, C151, CV58, middle cigarette 103, build wave 1, NC55, cloud and mist 87, Zhongyan-100, NC82, Hongda tobacco；
Second row in Fig. 1, DNA profiling dosage are 100ng, and swimming lane is followed successively by K326, TN86, TN90, V2, small from left to right
Gold 1025, Speight-G28, great Bai muscle 599, middle cigarette 15,9201, NC567, K346, Coker176, Yun yan85, dark green 1
Number, middle cigarette 98.
According to the testing result of Fig. 1, arranged into table 1, as a result see Table 1 for details；
Table 1
From table 1 it follows that the advantages that kit detection speed disclosed by the invention is fast, flux is high, it can be greatly
Accelerate the Breeding Process of anti-PVY breeding material, shorten breeding cycle, improves breeding efficiency, apply also for tobacco germplasm
With kind PVY Resistance Identification.
Sequence table
<110>Tobacco Institute, Chinese Academy of Agricultural Science
<120>a kind of primer, detection method and kit for identifying tobacco PVY resistance
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
aaccacccaa gcaagttagt 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
attttatccc ccttatttcg 20
Claims (6)
1. a kind of primer for identifying tobacco PVY resistance, which is characterized in that the primer is for detecting the susceptible base of tobacco PVY
Because eIF4E1 sequence design obtains specific primer, including upstream primer PVY1F and downstream primer PVY1R；
Wherein, the upstream primer PVY1F nucleotide sequence is as shown in SEQ ID NO:1；
The downstream primer PVY1R nucleotide sequence is as shown in SEQ ID NO:2.
2. a kind of detection method for identifying tobacco PVY resistance, which comprises the following steps:
S1, the DNA for being detected tobacco-containing material is extracted；
S2, by the DNA of detected tobacco-containing material described in step S1 be template, using specific primer to DNA profiling carry out
PCR amplification obtains DNA cloning product；
S3, DNA cloning product is detected using agarose gel electrophoresis, is corresponded to when 348bp occurs in gel in pcr amplification product
Electrophoretic band when, the detected tobacco-containing material be free of eIF4E1 gene, have PVY resistance；When pcr amplification product is in gel
In when there is not the corresponding electrophoretic band of 348bp, the detected tobacco-containing material does not have to be controlled based on eIF4E1 gene
PVY resistance；
Specific primer described in step S2 is the primer of identification tobacco PVY resistance described in claim 1.
3. the detection method of identification tobacco PVY resistance according to claim 2, which is characterized in that described in step S2
The reaction system of PCR amplification is as follows:
2×Power Taq PCR MasterMix 10μl；
10 μM of 1 μ l of upstream primer；
10 μM of 1 μ l of downstream primer；
Distilled water is mended to 20 μ l.
4. the detection method of identification tobacco PVY resistance according to claim 2, which is characterized in that described in step S2
The reaction condition of PCR amplification is as follows:
95 DEG C of initial denaturation 2min；
95 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 recycle；
Last 72 DEG C of extensions 7min.
5. the detection method of identification tobacco PVY resistance according to claim 2, which is characterized in that described in step S2
The template of DNA is 50-100ng in the dosage of the reaction system of PCR amplification.
6. a kind of kit for identifying tobacco PVY resistance, which is characterized in that the kit includes: PCR reaction reagent and draws
Object；The primer is the primer of identification tobacco PVY resistance described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810026574.4A CN110029183A (en) | 2018-01-12 | 2018-01-12 | A kind of primer, detection method and kit for identifying tobacco PVY resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810026574.4A CN110029183A (en) | 2018-01-12 | 2018-01-12 | A kind of primer, detection method and kit for identifying tobacco PVY resistance |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110029183A true CN110029183A (en) | 2019-07-19 |
Family
ID=67234667
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810026574.4A Pending CN110029183A (en) | 2018-01-12 | 2018-01-12 | A kind of primer, detection method and kit for identifying tobacco PVY resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110029183A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996277A (en) * | 2020-08-31 | 2020-11-27 | 中国烟草总公司郑州烟草研究院 | Tobacco PVY early warning gene Ntab0691000 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820465A (en) * | 2013-12-16 | 2014-05-28 | 云南省烟草农业科学研究院 | Tobacco recessive PVY (Potato Virus Y) resistance gene eIF4E-1 and application thereof |
| CN103898228A (en) * | 2014-04-15 | 2014-07-02 | 云南省烟草农业科学研究院 | Molecular marker for identifying potato virus Y (PVY) resistance of tobacco |
-
2018
- 2018-01-12 CN CN201810026574.4A patent/CN110029183A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820465A (en) * | 2013-12-16 | 2014-05-28 | 云南省烟草农业科学研究院 | Tobacco recessive PVY (Potato Virus Y) resistance gene eIF4E-1 and application thereof |
| CN103898228A (en) * | 2014-04-15 | 2014-07-02 | 云南省烟草农业科学研究院 | Molecular marker for identifying potato virus Y (PVY) resistance of tobacco |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996277A (en) * | 2020-08-31 | 2020-11-27 | 中国烟草总公司郑州烟草研究院 | Tobacco PVY early warning gene Ntab0691000 and application thereof |
| CN111996277B (en) * | 2020-08-31 | 2022-06-03 | 中国烟草总公司郑州烟草研究院 | Tobacco PVY early warning gene Ntab0691000 and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755482B (en) | SSR molecular marker III for identifying progeny plants of Gala apples and application thereof | |
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN105483217B (en) | A kind of molecule labelling method for identifying rice east wild type cytoplasmic male sterility source | |
| CN105063185A (en) | Closely-linked marker of spike length major QTL (quantitative trait loci) and application of closely-linked marker | |
| CN107881256B (en) | Single nucleotide polymorphism marker site, primer pair, kit and application for identifying bitter kernel/sweet kernel characteristics of peach fruit | |
| CN113151553A (en) | Molecular marker coseparated with gene Clbl of watermelon plant few lateral branches and application | |
| CN111733274A (en) | SNP locus, primer set and method for identifying cauliflower Zhe nong piny flower 80-day variety | |
| CN103866038B (en) | For detecting tobacco to the N gene-specific primer of TMV resistance to, detection method and test kit | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN109735648A (en) | A kind of method and its dedicated kit for screening different mass of 1000 kernel wheats | |
| CN110777218B (en) | Molecular marker linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN105886651B (en) | A kind of and the associated functional label of rape seedling drought resistance and its application | |
| CN108441566A (en) | A kind of detection method of goat ATBF1 gene insertion/deletions and its application | |
| CN110029183A (en) | A kind of primer, detection method and kit for identifying tobacco PVY resistance | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN104561353B (en) | InDel marker in close linkage with cabbage fertility as well as detection method and application of InDel marker | |
| CN102690814B (en) | Molecule marker SIsv0491 closely linked with millet bristle color gene | |
| CN108239675B (en) | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof | |
| CN108531636B (en) | Molecular marker TJcM01 for identifying melon unisexual flower and application thereof | |
| CN107619875B (en) | Insertion deletion marker locus for identifying watermelon fruit shape, primer and application | |
| CN110468229A (en) | Rice wide spectrum high resistance to hoja blanca gene Xa45's (t) isolates molecular labeling Hxjy-1 | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN102690813B (en) | Molecule marker SIsv0701 closely linked with millet bristle color gene | |
| CN108048599A (en) | A kind of molecular labeling and application with rape lateral root number main effect QTL site RtA07-2 close linkages | |
| CN108950050B (en) | Detection primer and kit for cytoplasmic male sterility restoring gene Rf (DW)10 of Dongfu-type rice, application and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190719 |
|
| RJ01 | Rejection of invention patent application after publication |