CN111961744B - Tobacco black shank early warning gene Ntab0278480 and application thereof - Google Patents

Abstract

The invention belongs to the technical field of tobacco genome analysis and tobacco cultivation, and particularly relates to a tobacco black shank early warning gene and application thereof. The base sequence of the tobacco black shank early warning gene Ntab0278480 is shown in SEQ ID No.2, and the gene is used as the early warning gene for indicating the infection condition of the black shank. The early warning gene provided by the application has the technical advantages of quick response and high sensitivity, and has convenient technical advantages due to the fact that the early warning gene is used for detecting tobacco genomes (in the prior art, pathogenic bacterium genomes are mostly detected). The method and the device can lay a certain technical foundation for monitoring and early prevention of the black shank, and provide reference and reference for prevention and control of other tobacco diseases, so that the method and the device have good application and scientific research values.

Description

Tobacco black shank early warning gene Ntab0278480 and application thereof

Technical Field

The invention belongs to the technical field of tobacco genome analysis and tobacco cultivation, and particularly relates to a tobacco black shank early warning gene and application thereof.

Background

In tobacco cultivation, tobacco diseases are caused by various microorganisms such as fungi, bacteria and viruses, and meanwhile, insects with piercing-sucking mouthparts such as aphids can transmit pathogens to tobacco to cause the tobacco to generate diseases. And because the microorganisms are small and the propagation ways of tobacco diseases are various, the research on the occurrence and prevalence rules of tobacco diseases is difficult. In the prior art, indexes such as disease indexes are generally adopted to reflect the occurrence, development and prevalence rules of diseases, but the evaluation method usually needs to judge the occurrence or prevalence of the diseases until the diseases are attacked or even begin to spread, and the subsequent prevention and treatment are often delayed. Theoretically, if pathogens infect tobacco in the early stage, the pathogens can be detected in time and give an early warning, so that a good foundation can be laid for follow-up disease tracking, disease development and epidemic trend judgment, and sufficient time can be obtained for controlling large-scale disease spreading.

The tobacco black shank is a soil-borne fungal disease, also called tobacco epidemic disease, is one of the most devastating diseases in the world tobacco production, is also a main disease which harms the tobacco production of China, and occurs in the domestic main tobacco production area, and the main symptoms after the disease occurrence are as follows: the tobacco is dwarfed, the root and stem base are necrotic, the leaves are yellow and wilted, the average incidence rate is 3-12%, and can reach more than 50% in serious cases. The tobacco black shank can reduce the activity of the root system of the tobacco plant, the transportation of water and nutrient substances is blocked, the yield and the quality of the tobacco leaves are directly or indirectly influenced, and serious economic loss is caused.

Research shows that the tobacco black shank has various transmission ways, the main primary infection sources are soil with bacteria, manure and irrigation water, and the secondary infection sources are tobacco seedlings with diseases, and sporangium and zoospore generated by the tobacco seedlings are transmitted by rainwater or irrigation water to cause re-infection. Because the disease has wide spread range and various spread ways, and the proliferation and transfer speed in the tobacco plant body is fast, the prevention in advance and early warning are the key points for preventing and treating the disease.

In the existing research, most of molecular biology detection technologies for tobacco fungal diseases are designed and developed specific primers based on ribose internal transcribed spacer (rDNA-ITS) sequences, and then detection and judgment are carried out by utilizing a PCR amplification technology. Of course, specific primers are designed according to the result of the comparison of certain specific conserved gene sequences to perform PCR amplification, detection and judgment on the type of the infected fungi. However, most of these methods are based on the identification of diseases by the self-gene of the identified pathogenic fungi, and in practical application, the identification by PCR method can be performed only when the tobacco is infected with the pathogenic fungi and the genome of the pathogenic fungi can be extracted, so that the methods are very limited in application. Therefore, how to more quickly identify the pathogenic fungi suffered by the tobacco has very important technical significance for controlling related diseases.

Disclosure of Invention

Aiming at the tobacco black shank, the early warning genes which can quickly respond in the early stage of black shank infection are provided, so that a good technical basis is laid for the early prevention of the black shank.

The technical solution adopted in the present application is detailed as follows.

The base sequences of tobacco black shank early warning genes Ntab0295850 and Ntab0278480 are respectively shown in SEQ ID No.1 and SEQ ID No.2, and the method comprises the following steps:

the Ntab0295850 gene sequence (237 bp, SEQ ID No. 1) is as follows:

GGCTATGGAAATGTATCGGCGAATCATCGGAACATGAACAAGAGGATGATGGAGTTTTTGAAAAAGAGTTGGATTCCTAAAATTGGAGAAGTGAAAATGGAAAGAGAGAAAGTGCATAAACATATGATTAAAGAGAGGATTAGAAGAGAAAAGCAGAAGCAGAGTTATTTGGATTTGCATAAATTGCTCCCAATGGGAACCAAGGGTGAGAAGAATGCTATAGTCCAAACAGCAGCA；

the Ntab0278480 gene sequence (191 bp, SEQ ID No. 2) is as follows:

GTTTAGAACTCGGCAGCGTTTCGATACGTTCGTACGCTTTCGATATCGTCAGAGACGAAATAAGAAATCGGCTCATTCCACTTTTAGAAAGTAACCAGAATGGCACCGTTTTGGATTTGCAAGATGTTTTTAGGCGATTCTCGTTTGATAGTATATGTAAATTCTCTTTTGGAATGGATCCGGGTTGCTTG。

the tobacco black shank early warning genes Ntab0295850 and Ntab0278480 are applied to the prevention and treatment of the tobacco black shank and serve as early warning genes for indicating the infection condition of the black shank.

PCR primers for detecting the tobacco black shank early warning genes Ntab0295850 and Ntab0278480,

Ntab0295850-F：5’-GGCTATGGAAATGTATCGGCG-3’，

Ntab0295850-R：5’-TGCTGCTGTTTGGACTATAGC-3’；

Ntab0278480-F：5’-GTTTAGAACTCGGCAGCGTT-3’，

Ntab0278480-R：5’-CAAGCAACCCGGATCCATTC-3’。

the qRT-PCR detection kit prepared by using the PCR primers for detecting the tobacco black shank early warning genes Ntab0295850 and Ntab0278480 further comprises primers for detecting a reference gene L25, and the specific primer sequences are as follows:

L25-F：5’-CCCCTCACCACAGAGTCTGC-3’，

L25-R：5’-AAGGGTGTTGTTGTCCTCAATCTT-3’。

the tobacco black shank detection method using the qRT-PCR detection kit comprises the following steps:

extracting total RNA of a tobacco sample to be detected, and carrying out reverse transcription on the total RNA;

(II) carrying out qRT-PCR detection by using a tobacco leaf sample of a normally-grown uninfected tobacco strain as a control and using L25 as a reference gene and using a Ntab0295850-F/R, Ntab0278480-F/R primer pair, and calculating the relative expression amounts of Ntab0295850 and Ntab 0278480;

(III) judging the black shank infection condition of the sample to be detected according to the expression quantity condition in the step (III), specifically:

if the relative expression changes of Ntab0295850 and Ntab0278480 are not statistically significant compared to the control group, it indicates that the test sample is not infected with Heiphitus nigra;

if the relative expression quantity of Ntab0295850 and Ntab0278480 is increased by less than 1.5 times, the detection and judgment are carried out again after the Ntab0295850 and the Ntab0278480 stay for not less than 6 hours (if the expression quantity is not obviously changed, the black shank is considered not to be infected, and if the expression quantity exceeds 1.5 times, the judgment is carried out by referring to the following standard);

if the relative expression quantity of the Ntab0295850 and the Ntab0278480 is increased by not less than 1.5 times, judging the attack stage of the black shank according to the following condition, and then adopting corresponding control measures according to the attack stage;

。

for the study on the infection of the black shank, according to the existing study report, the black shank block is inoculated to the tobacco leaf, pathogenic bacteria can start to invade the leaf epidermis from the tobacco pores after 16 hours, hyphae of the pathogenic bacteria can grow into the mesophyll tissue of the leaf after 20-24 hours, the quantity of the hyphae is gradually increased after 30-48 hours, the density of the hyphae is further increased after 56-72 hours, and the harm to the tobacco leaves is aggravated. That is, if the conventional pathological dissection means is adopted for identification and analysis, the primary judgment can be carried out only after the phytophthora parasitica is infected for 16 hours.

As for the early warning genes, the genes can be transcription factor genes or key enzyme genes in certain signal paths in plants, and therefore, the early warning genes have the characteristics of high response speed and more sensitive response to pathogenic fungi. Based on the characteristics, the inventor preliminarily screens and obtains a plurality of differential expression genes which are specifically responsive to the infection of the phytophthora parasitica based on the expression profile data of the prophase tobacco complete transcriptome chip. The detection result of the real-time fluorescent quantitative PCR technology is further combined to show that the Ntab0295850 and Ntab0278480 genes can specifically respond to the infection of the phytophthora parasitica, and have the characteristics of high response speed and sensitive response (from the example result, the Ntab0295850 and Ntab0278480 genes can respond to the infection of phytophthora parasitica hyphae in a short time (less than 6 h), and the time is far ahead of the time (16 h) when the existing phytophthora parasitica begin to invade from tobacco stomata into the leaf epidermis), so that the gene is suitable for being applied as an early warning gene of the phytophthora parasitica.

In a word, the early warning gene provided by the application has the technical advantages of quick response and high sensitivity, and has convenient technical advantages due to the fact that the early warning gene is used for detecting tobacco genomes (in the prior art, pathogen genomes are mostly detected). The method and the device can lay a certain technical foundation for monitoring and early prevention of the black shank, and provide reference and reference for prevention and control of other tobacco diseases, so that the method and the device have good application and scientific research values.

Drawings

FIG. 1 shows the results of detection of the Ntab0295850 gene expression level, wherein 6h, 1d, and 3d in the figure represent the results of detection after inoculation with phytophthora parasitica hyphae 6h, 1d, and 3d, respectively, Con: healthy tobacco plants (the following figures are similar in meaning and are not repeated);

FIG. 2 shows the results of detection of the expression level of Ntab0278480 gene;

FIG. 3 shows the results of detection of the expression level of Ntab0146890 gene;

FIG. 4 shows the result of detecting the expression level of Ntab0329770 gene;

FIG. 5 shows the result of detecting the expression level of the Ntab0295850 gene in a CMV-infected strain;

FIG. 6 shows the result of detecting the expression level of the Ntab0295850 gene in a PVY-infected strain;

FIG. 7 shows the result of detecting the expression level of the Ntab0278480 gene in a CMV-infected strain;

FIG. 8 shows the results of detecting the expression level of the Ntab0278480 gene in a PVY-infected strain;

FIG. 9 shows the phenotype variation of tobacco plants partially infected with blackleg;

FIG. 10 shows the expression level of Ntab0295850 gene;

FIG. 11 shows the expression level of Ntab0278480 gene.

Detailed Description

The technical solution of the present application is further explained with reference to the following examples. Before further description of the relevant experiments, a brief description of the background of some of the biological materials, reagents, etc. involved in the examples described below is provided below.

Biological material:

the common tobacco Honghuadajinyuan is planted in a greenhouse of the national tobacco gene research center of Zhengzhou tobacco institute under the conditions of temperature (23 +/-1) DEG C, relative humidity (60 +/-2)%, illumination culture for 16h and dark culture for 8 h;

the synthesis and sequencing work of related primers is completed and provided by the biological engineering (Shanghai) corporation;

experimental reagent:

RNA reverse transcription kits, DL2000 DNA Marker, SYBR Green, etc., were purchased from Bao bioengineering (Dalian) Co., Ltd.

Example 1 this example first outlines the screening procedure for the tobacco black shank early warning gene obtained in this application as follows.

In the early research process aiming at the tobacco genome, based on the expression profile analysis result of Affymetrix tobacco whole genome chip, combined with the significance analysis and the MeV variance analysis of the normalized data, selecting the expression value of a treatment group and a control group with the P less than or equal to 0.01 and the change of the expression value more than or equal to 2 times (after lg 2) as the screening standard of the significant change (the expression up-regulation) of the gene expression, and combined with the prediction analysis of WEGO and KEGG on the gene function prediction and the metabolic pathway, primarily screening to obtain 4 functional genes (Ntab 0146890, Ntab0295850, Ntab0278480 and Ntab 9770) which obviously respond to black shank.

Based on the existing tobacco complete genome data, the gene sequences of Ntab0295850 and Ntab0278480 are finally determined as follows:

the sequence (237 bp) of the Ntab0295850 gene is shown as SEQ ID No.1, and the details are as follows:

GGCTATGGAAATGTATCGGCGAATCATCGGAACATGAACAAGAGGATGATGGAGTTTTTGAAAAAGAGTTGGATTCCTAAAATTGGAGAAGTGAAAATGGAAAGAGAGAAAGTGCATAAACATATGATTAAAGAGAGGATTAGAAGAGAAAAGCAGAAGCAGAGTTATTTGGATTTGCATAAATTGCTCCCAATGGGAACCAAGGGTGAGAAGAATGCTATAGTCCAAACAGCAGCA；

the sequence (191 bp) of the Ntab0278480 gene is shown as SEQ ID No.2, and specifically comprises the following steps:

GTTTAGAACTCGGCAGCGTTTCGATACGTTCGTACGCTTTCGATATCGTCAGAGACGAAATAAGAAATCGGCTCATTCCACTTTTAGAAAGTAACCAGAATGGCACCGTTTTGGATTTGCAAGATGTTTTTAGGCGATTCTCGTTTGATAGTATATGTAAATTCTCTTTTGGAATGGATCCGGGTTGCTTG。

in order to further determine the response of the 4 candidate genes to the blackleg (i.e., examine the sensitivity of the candidate genes to the blackleg to determine whether the candidate genes are suitable as early warning genes), the inventors further performed related experiments based on the real-time fluorescence quantitative PCR technology, and the specific process is briefly described as follows.

(I) design of primers

Based on the existing tobacco complete genome data and candidate genome sequences, the primer sequences for specific amplification in qRT-PCR are respectively designed aiming at different candidate genes as follows:

。

(II) simulating infection

Referring to the tobacco plant leaf axillary artificial inoculation method for tobacco black shank (Linxiangyun, Chinese tobacco, 1982), healthy tobacco plant safflower large golden dollars are inoculated to infect the black shank, so that candidate early warning genes are verified; specific operations can also be referred to as follows:

(1) collecting medulla part of tobacco plant with new disease (tobacco black shank) in field, keeping moisture at 25 + -1 deg.C for 2d (dense white hypha and sporangium can be observed under microscope), and cutting diseased tissue into hypha block as inoculation material;

(2) selecting healthy tobacco plants which are planted in the same batch and have consistent growth vigor and are in a vigorous long-term stage for inoculation, during specific operation, obliquely puncturing leaf axillary parts to be inoculated (axillary buds need to be cut off in advance) by using sterile pointed-end tweezers to reach medulla parts to form wounds, then completely plugging prepared mycelium blocks into the wounds by using the tweezers, and dripping a little clear water at the wounds to preserve moisture;

(3) the inoculated tobacco plants are placed at the temperature of (25 +/-1) ℃ for continuous culture, and the clean water is frequently sprayed on the wounds for continuous moisture preservation, so that the scab can appear in about one week under the normal condition.

As a control, to ensure the specificity of the candidate early warning genes of the present application (i.e., specificity in response to blackleg, but not in response to other diseases), the inventors inoculated healthy tobacco plants with Cucumber Mosaic Virus (CMV) and Potato Virus Y (PVY), respectively, at the same time to verify the specificity of the candidate gene early warning responses.

In the specific inoculation, the operation is carried out by referring to the methods in the tobacco virus disease rapid friction inoculation method (application No. 201210466245.4) and the tobacco virus disease sand paper friction inoculation method (application No. 200710077661.4), or specifically referring to the following steps:

(1) placing typical fresh diseased leaf tissues into a sterile mortar, adding 0.1 mol/L phosphate buffer solution with pH of 7.0, grinding, filtering by using sterile gauze, and finally fixing the volume according to the mass-to-volume ratio (W/V) of the diseased leaves to the phosphate buffer solution of 1: 30-40 to be used as inoculation liquid (note that the preparation is prepared as required);

(2) selecting healthy tobacco seedlings which are planted in the same batch and have consistent growth vigor and 5-6 true leaves for inoculation, and during specific operation: selecting 2 leaves for each tobacco seedling, uniformly spraying 600-mesh quartz sand, dispersing and dropwise adding 150-200 mu L inoculation liquid on each leaf, gently rubbing the surface of each leaf back and forth by using a sterile brush to cause slight damage to leaf epidermal cells, and finally spraying and washing residual liquid on the surface of each leaf by using sterile water;

(3) culturing the inoculated tobacco plant at 25 +/-1) DEG C and relative humidity of 60 +/-2%, and observing for 4-6 days to confirm the onset of disease.

(III) extracting total RNA and reverse transcribing into cDNA for use

And (3) taking leaves as samples after 6h, 1d and 3d inoculation of the diseased plants in the step (II), freezing by liquid nitrogen, grinding into powder, extracting total RNA by adopting a Trizol method, detecting the concentration and purity of the extracted total RNA by using a NanoDrop 2000 ultramicro spectrophotometer, carrying out 1% agarose gel electrophoresis detection on the extract to judge the integrity of the extracted total RNA, and directly carrying out subsequent experiments or storing at-80 ℃ for later use after confirming that the integrity of the extracted total RNA meets the requirements of subsequent use.

Further, referring to the specification of the RNA reverse transcription kit, the total RNA of the extracted diseased tobacco leaf is reversely transcribed into cDNA to be used as a template for subsequent qRT-PCR amplification.

(IV) Quantitative real-time fluorescent PCR (qRT-PCR) analysis

Taking the cDNA prepared in the step (three) as a template, and carrying out PCR amplification by using the specific PCR primer designed in the step (one); at the same time withL25And performing PCR amplification as an internal reference gene to detect and judge the change condition of the expression quantity of the candidate early warning gene.

For the purpose ofL25Internal reference gene, setting primer sequence during PCR amplificationThe method comprises the following steps:

an upstream primer: 5'-CCCCTCACCACAGAGTCTGC-3' the flow of the air in the air conditioner,

a downstream primer: 5'-AAGGGTGTTGTTGTCCTCAATCTT-3', respectively;

during qRT-PCR amplification, a 20 mu L reaction system is designed as follows:

cDNA，2 µL（50 ng/µL）；

SYBR Green (Vazyme, nanjing, china), 10 μ L;

upstream and downstream primers, each 0.5 μ L (10 μmol/L);

ddH₂O，7 µL。

in a fluorescent quantitative PCR apparatus (Bio-Rad, USA), the reaction conditions are as follows: at 95 ℃ for 3 min; at 95 deg.C, 20s, 60 deg.C, 20s, 40 cycles; storing at 4 ℃;

each tissue sample was tested in duplicate 3 times, and the mean was calculated using 2^-△△C _TRelative expression was calculated (relevant data were processed using statistical software SPSS 19.0 and analyzed for One-way ANOVA; P < 0.05 indicates significant differences; P > 0.05 indicates no significant differences).

During the experiment, healthy tobacco plants were used as controls.

FIG. 1, FIG. 2, FIG. 3 and FIG. 4 show the gene expression of 4 candidate early warning genes at different time intervals after the tobacco plant is infected with Tirthia species. Specifically, the method comprises the following steps:

compared with a control group (Con), the expression levels of the Ntab0295850 and the Ntab0278480 genes are remarkably increased when inoculated with phytophthora parasitica mycelium for 6h, and are continuously increased along with the increase of inoculation time (1 d, 3 d) (P < 0.05), which indicates that the two genes can respond in a short time (less than 6 h) when healthy tobacco plants are attacked by phytophthora parasitica, and the two genes initially have the potential of serving as candidate early warning genes of phytophthora parasitica;

when the Ntab0146890 gene is inoculated with black shank hypha for 6h, the expression level is not increased significantly (P is more than 0.05), but the expression level begins to be increased gradually (P is less than 0.05) along with the increase of inoculation time (1 d and 3 d), which shows that the gene does not respond in a short time (less than 6 h) when a healthy tobacco strain is attacked by black shank pathogenic bacteria, and the application of the gene as an early warning gene of the tobacco black shank is temporarily not considered from the aspect of the requirement of the response speed of the early warning gene;

the Ntab0329770 gene has no obvious change in gene expression level within 6 h-1 d of inoculation, and is obviously reduced only in 3d, and the results show that the gene does not respond timely when a healthy tobacco plant is attacked by phytophthora parasitica, and is obviously not suitable for being used as an early warning gene.

Further, the expression of two candidate early warning genes, Ntab0295850 and Ntab0278480, in CMV and PVY strains were analyzed, and the results are shown in fig. 5, fig. 6, fig. 7 and fig. 8, specifically:

for the Ntab0295850 gene:

compared with a control group (CMV-Con), the expression level of the Ntab0295850 gene in a CMV diseased strain at 4d is very low (P < 0.05), while the expression level in tobacco strains inoculated with 10 d and 15 d is increased but still significantly lower than that of the control group (P < 0.05); similarly, the result that the Ntab0295850 gene was expressed at 4d in the PVY diseased strain at a lower level (P < 0.05) and was elevated in the tobacco strains inoculated with 10 d and 15 d, but still significantly lower than the control (P < 0.05) compared to the control (PVY-Con) indicates that the gene did not respond to CMV and PVY in time, i.e., that the gene was specific to blackleg infection.

For the Ntab0278480 gene:

compared with a control group (CMV-Con), the expression level of the Ntab0278480 gene in CMV diseased strains at 4d and 10 d is very low (P < 0.05), while the expression level in tobacco strains inoculated with 15 d is increased but still is significantly lower than that in the control group (P < 0.05); similarly, compared with the control group (PVY-Con), the Ntab0278480 gene has lower expression level (P < 0.05) in the tobacco strain at 4d in the PVY diseased strain, and has higher expression level in the tobacco strains inoculated with 10 d and 15 d but still is obviously lower than the control group (P < 0.05); this result indicates that the gene does not respond in time to CMV, PVY, i.e. that the gene is specific for the response to black shank infection.

In view of the above results, both the Ntab0295850 and Ntab0278480 genes can specifically, especially rapidly, respond to the infection of the black shank pathogen, so that a timely early warning signal can be sent out for early prevention of the black shank of tobacco, and a good technical basis is laid for accurate identification and prevention of subsequent diseases.

Example 2

On the basis of embodiment 1, in order to facilitate the practical detection application of the early warning gene, the inventor further prepares a detection kit by combining other consumables and reagents, thereby facilitating the relative detection work to be conveniently and rapidly carried out. Among the detect reagent box, mainly be experimental reagent, also can design simultaneously and contain a plurality of instrument consumptive materials, specifically:

the instrument consumables include: the kit comprises a pipette tip (without DNase and RNase) with the specification of 10 mu L, 200 mu L and 1000 mu L, a plurality of centrifuge tubes (without DNase and RNase) with the specification of 1.5 mL, a plurality of mortars, a plurality of pairs of disposable latex gloves, a Marker pen 1 rod, a plurality of 96-well plates (without DNase and RNase) for fluorescent quantitative PCR;

the experimental reagent comprises:

reagent for RNA extraction:

trizol, chloroform, isopropanol, 75% ethanol (In DEPC-treated water), RNase-free water;

reagents for RNA reverse transcription:

5 XSupermix for qPCR (containing all reagents required for reverse transcription SuperRT, RNase Inhibitor, oligo (dT)18 Primer, Random Primer (N9), dNTPs, Buffer), gDNA Remover, RNase-free Water;

qRT-PCR detection reagent:

SYBR Green fluorescent dyes;

the upstream and downstream primers of the Ntab0295850 gene, the upstream and downstream primers of the Ntab0278480 gene and the upstream and downstream primers of the L25 reference gene are respectively 10 mu ml/L.

For specific detection applications, the following operation steps can be referred to.

(I) extracting total RNA from sample to be detected

Taking tobacco leaves of a tobacco plant to be detected as a sample to be detected, freezing the sample by liquid nitrogen, and then sampling the sample into a 50-100 mg mortar and grinding the sample into powder;

transferring the milled sample to a 1.5 mL centrifuge tube, adding 1 mL Trizol (the dosage proportion of Trizol is that 1 mL Trizol is added into every 50-100 mg of powder, and the sample amount does not exceed 10% of the volume of Trizol so as to reduce the probability of DNA pollution), and standing for 5 min at room temperature to completely separate the nucleoprotein complex;

then, adding 0.2 mL of chloroform into the centrifuge tube, covering, violently shaking for 15 s, and standing for 2-3 min at room temperature;

centrifuging at 12000 rpm for 15 min at 4 deg.C (three layers after centrifugation, RNA only exists in the uppermost colorless aqueous phase); transferring the upper water phase to a new centrifugal tube of 1.5 mL, adding isopropanol of 0.5 mL, and standing for 10 min at room temperature;

centrifuging at 12000 rpm for 10 min at 4 deg.C, carefully discarding the supernatant, and washing the precipitate with 1 mL of 75% ethanol;

centrifuging at 12000 rpm for 5 min at 4 deg.C, carefully sucking off the supernatant, and standing at room temperature for 5-10 min to dry RNA (note that it cannot be dried excessively);

and finally, adding 50-70 mu L of RNase-free water to fully dissolve RNA, and carrying out subsequent detection judgment, experimental application or storing at-80 ℃ for later use.

During detection, a NanoDrop 2000 ultramicro spectrophotometer is used for detecting the concentration and purity of the extracted total RNA (A260/A280 is between 1.8 and 2.0, the purity is high, and the subsequent use requirement can be met), and 1% agarose gel electrophoresis detection is carried out to judge the integrity of the extracted total RNA.

(II) reverse transcription of RNA into cDNA

Reverse transcription of the RNA extracted in the step (I) into cDNA is performed by using an RNA reverse transcription reagent, and a specific 20 mu L reaction system is designed as follows:

total RNA, 1. mu.g;

5× SuperMix for qPCR，4 μL；

gDNA Remover，1 μL；

RNase-free Water, added to 20. mu.L;

after gentle mixing, the reaction was carried out at 42 ℃ for 15 min, and then heated to 85 ℃ for 5s to inactivate SuperRT and gDNA Remover; the product after reaction is directly used for subsequent qRT-PCR detection.

(III) detection of early warning gene relative expression in sample to be detected by utilizing qRT-PCR

To be provided withL25As an internal reference gene, qRT-PCR is utilized to early-warning geneNtab0295850、Ntab0278480Detecting the relative expression level of (a); in qRT-PCR detection, a 20-mu L reaction system is designed as follows:

preparing a cDNA template of 2 muL (50 ng/muL);

SYBR Green，10 µL；

upstream and downstream primers, each 0.5 μ L (10 μmol/L);

ddH₂O，7 µL；

the reaction conditions are as follows: at 95 ℃ for 3 min; 95 ℃, 20s, 60 ℃, 20s, 40 cycles; storing at 4 ℃;

based on the detection results, use 2^-△△C _TThe relative expression amount is calculated.

(IV) specific judgment

When the black shank infection condition of the sample to be detected is specifically determined, the specific determination standard is considered as follows:

referring to the results of the detection of the expression change content of the gene (as shown in fig. 1 and fig. 2), it can be seen that the expression level of the Ntab0295850 gene is significantly increased 6h after the inoculation of the phytophthora parasitica hyphae compared with the control group (Con), which is 2.61 times that of the control group; the expression level of the vaccine after 1d inoculation is 3.40 times of that of the control group; the expression quantity of the recombinant plasmid after 3d inoculation is 12.48 times that of the control group; compared with a control group (Con), the expression level of the Ntab0278480 gene is obviously increased after 6 hours of inoculation of the phytophthora parasitica mycelium, and is 1.59 times that of the control group; the expression level of the vaccine after 1d inoculation is 5.04 times of that of the control group; the expression level of the gene after 3d inoculation is 4.07 times of that of the control group. Therefore, overall, the determination criteria for determining the onset stage of blackleg according to the gene expression level are as follows:

。

in order to further verify the stability and reliability of the "early warning" effect of the two early warning genes, taking a tobacco plant sample after the actual infection of black shank as an example (named as HJB tobacco plants 1, 2 and 3 respectively, the main phenotype is represented by that black spots appear at the stem base, black spots appear on the stem, leaf spots on the bottom are wilted or even died, part of leaves are brownish yellow and necrotic, the edge is unclear and the leaf spots are in a "plaster" shape, so that the black shank pathogen can be judged to have started to infect and grow in the tobacco leaves, and part of phenotype reality is shown in fig. 9), the inventor detects the expression conditions of Ntab0295850 and Ntab0278480 genes in the sample material, and specific results are shown in fig. 10 and fig. 11. Specifically, the method comprises the following steps:

in fig. 10, the expression level of Ntab0295850 gene was significantly increased in tobacco strains infected with blackleg (P < 0.05) compared to the control group (Con), and the expression levels of Ntab0295850 gene in HJB tobacco strains 1, 2, and 3 were 11.87 times, 15.08 times, and 13.03 times, respectively, that of the control group; the judgment can also be carried out by combining the standards, and the phytophthora parasitica grows in the tobacco leaves at the moment, which further indicates that the establishment of the standards is more reasonable and accurate;

in fig. 11, compared with the control group (Con), the expression level of Ntab0278480 gene in tobacco plants infected with black shank is significantly increased (P < 0.05), and the expression levels of Ntab0278480 gene in HJB tobacco plants 1, 2, and 3 are 36.76 times, 25.72 times, and 60.50 times, respectively, compared with the control group, and it can be determined by combining the aforementioned criteria, and the black shank pathogen has grown in the tobacco leaf, which further indicates that the establishment of the criteria is more reasonable and accurate.

By combining the judgment standard and the judgment result, the Ntab0295850 and the Ntab0278480 genes selected by the application have continuity, stability and reliability in the early warning effect when being applied as the early warning gene of the black shank of tobacco, and the relevant judgment standard also has higher reference value, so that a certain technical basis can be laid for the prevention and control of the black shank.

SEQUENCE LISTING

<110> Zhengzhou tobacco institute of China tobacco general Co

<120> tobacco black shank early warning gene Ntab0278480 and application thereof

<130> none

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 237

<212> DNA

<213> Nicotiana tabacum

<400> 1

ggctatggaa atgtatcggc gaatcatcgg aacatgaaca agaggatgat ggagtttttg 60

aaaaagagtt ggattcctaa aattggagaa gtgaaaatgg aaagagagaa agtgcataaa 120

catatgatta aagagaggat tagaagagaa aagcagaagc agagttattt ggatttgcat 180

aaattgctcc caatgggaac caagggtgag aagaatgcta tagtccaaac agcagca 237

<210> 2

<211> 191

<212> DNA

<213> Nicotiana tabacum

<400> 2

gtttagaact cggcagcgtt tcgatacgtt cgtacgcttt cgatatcgtc agagacgaaa 60

taagaaatcg gctcattcca cttttagaaa gtaaccagaa tggcaccgtt ttggatttgc 120

aagatgtttt taggcgattc tcgtttgata gtatatgtaa attctctttt ggaatggatc 180

cgggttgctt g 191

Claims (6)

1. The tobacco black shank early warning gene Ntab0278480 is characterized in that the base sequence is shown as SEQ ID No.2, and specifically comprises the following steps:

GTTTAGAACTCGGCAGCGTTTCGATACGTTCGTACGCTTTCGATATCGTCAGAGACGAAATAAGAAATCGGCTCATTCCACTTTTAGAAAGTAACCAGAATGGCACCGTTTTGGATTTGCAAGATGTTTTTAGGCGATTCTCGTTTGATAGTATATGTAAATTCTCTTTTGGAATGGATCCGGGTTGCTTG。

2. the tobacco black shank early warning gene Ntab0278480 in claim 1 is used for the prevention and treatment of tobacco black shank, and is used as an early warning gene for indicating the infection condition of the black shank.

3. The PCR primer for detecting the tobacco black shank early warning gene Ntab0278480 of claim 1 is characterized in that the specific primer sequence is as follows:

Ntab0278480-F：5’-GTTTAGAACTCGGCAGCGTT-3’，

Ntab0278480-R：5’-CAAGCAACCCGGATCCATTC-3’。

4. a qRT-PCR detection kit prepared by using the PCR primers for detection of claim 3.

5. The qRT-PCR detection kit as claimed in claim 4, wherein the kit comprises primers for detecting the reference gene L25, and the specific primer sequences are as follows:

L25-F：5’-CCCCTCACCACAGAGTCTGC-3’，

L25-R：5’-AAGGGTGTTGTTGTCCTCAATCTT-3’。

6. the method for detecting tobacco black shank by using the PCR primer for detection as set forth in claim 3, characterized by comprising the steps of:

extracting total RNA of a tobacco sample to be detected, and carrying out reverse transcription on the total RNA;

(II) taking a tobacco leaf sample of a normally growing uninfected tobacco strain as a control, taking L25 as a reference gene, performing qRT-PCR detection by using a Ntab0278480-F/R primer pair, and calculating the relative expression quantity of Ntab 0278480;

the reference gene L25 is a gene obtained by PCR amplification by using the following primer sequences:

L25-F：5’-CCCCTCACCACAGAGTCTGC-3’，

L25-R：5’-AAGGGTGTTGTTGTCCTCAATCTT-3’；

(III) judging the black shank infection condition of the sample to be detected according to the expression quantity condition in the step (III), specifically:

compared with the control group, if the relative expression change of the Ntab0278480 does not have statistical significance, the test sample is not infected with the black shank;

if the relative expression quantity of the Ntab0278480 is increased by less than 1.5 times, the detection is determined again after the Ntab0278480 stays for not less than 6 hours;

if the relative expression level of the Ntab0278480 is increased by not less than 1.5 times, judging the onset stage of the blackleg according to the following conditions;

。

Images