CN111996130B

CN111996130B - Biocontrol bacterium for plant root rot and application thereof

Info

Publication number: CN111996130B
Application number: CN202010994829.3A
Authority: CN
Inventors: 郑小波; 杨波; 王源超; 张正光; 叶文武; 柳泽汉; 孙哲; 冯慧; 王晓莉
Original assignee: Nanjing Agricultural University
Current assignee: Hanxing Biotechnology (Nanjing) Co.,Ltd.
Priority date: 2020-09-21
Filing date: 2020-09-21
Publication date: 2022-02-01
Anticipated expiration: 2040-09-21
Also published as: CN111996130A

Abstract

The invention discloses a biocontrol bacterium for plant root rot and application thereof, wherein the biocontrol bacterium is named as pythium oligandrum Pyo34-3, and the preservation unit is as follows: china general microbiological culture Collection center (CGMCC) with a collection number of CGMCC NO. 20224; the application comprises the application in preventing and treating plant root rot caused by phytophthora sojae, pythium ultimum, fusarium oxysporum, phomopsis longipes and the like. The invention provides a beneficial microorganism capable of effectively preventing and treating plant root rot and application thereof.

Description

Biocontrol bacterium for plant root rot and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a biocontrol bacterium for plant root rot and application thereof.

Background

The root rot is a plant disease which occurs at the root of a plant and causes the underdevelopment of the root system of the plant, short and weak overground parts, light green leaves and obviously reduced branches and fructification. In the early stage of root rot, only individual rootlet and fibrous root are infected and gradually spread to the main root. After the main root is infected with diseases, the plant does not show symptoms in the early stage, and then the function of the plant for absorbing water and nutrients is gradually weakened along with the aggravation of the rotten degree of the root, and the leaf of the plant is wilted. When the disease is serious, the root bark is browned and separated from the marrow, the leaves are wilted, and the plant is suddenly fallen and died. Root rot is a serious disease in agricultural production in China, and occurs in almost every place and on various crops in China, and the yield is reduced or the crop is not harvested in serious areas.

Taking soybean root rot as an example, the soybean root rot is caused by various pathogenic bacteria, and at present, the pathogenic bacteria of the soybean root rot reported in China mainly include: phytophthora sojae (Phytophthora sojae), Pythium ultimum (Pythium ultimum), Fusarium oxysporum (Fusarium oxysporum), Fusarium solani (Fusarium solani), Fusarium graminearum (Fusarium graminearum), Rhizoctonia solani (Rhizoctonia solani), and the like. According to statistics, the yield of the soybeans is reduced by more than 30% every year due to root rot, and even the soybeans are completely harvested when the yield is severe. The soybean root rot is complex in pathogen species and can be infected compositely, so that the prevention and control difficulty of the soybean root rot is high.

The prevention and control of soybean root rot in the prior art mainly comprises the following modes: 1. the disease-resistant variety plants are used, but the resistance of the soybean variety is easy to lose due to the complex pathogenic population and quick virulence variation of pathogenic bacteria; 2. although the chemical agent can prevent and control the soybean root rot to a certain extent, the chemical agent can cause drug resistance of pathogenic bacteria when being used in a large amount. In addition, the overproof medicament residue can cause environmental pollution and harm human health.

In the environment around plants, many beneficial microorganisms exist, and the microorganisms do not only cause diseases to the plants, but also induce the plants to generate resistance, thereby improving the viability of the plants under biotic stress or abiotic stress. In addition, the microorganisms are derived from natural environment, so that the environment is not polluted, and the use of the microorganisms for preventing and treating plant diseases is beneficial to keeping ecological balance. Nowadays, more and more researchers are working on finding environmental probiotics as a biological control method for treating plant diseases.

In conclusion, the prior art is lack of a green and efficient environmental probiotic for preventing plant root rot.

Disclosure of Invention

Aiming at the problems, the invention discloses a beneficial microorganism capable of effectively preventing and treating plant root rot and application thereof.

In the first aspect of the invention, a biocontrol bacterium for plant root rot is provided, which is named as pythium oligandrum Pyo34-3, and the preservation unit is as follows: china general microbiological culture Collection center (CGMCC) with a collection number of CGMCC NO. 20224.

The CGMCC NO.20224 has been registered and preserved in China general microbiological culture Collection center (CGMCC for short) at 20 days 7 and 7 months 2020, the preservation number is CGMCC NO.20224, and the preservation address is No. 3 of Beijing West Lu No.1 of Chaoyang district in Beijing.

Preferably, the pythium oligandrum Pyo34-3 is selected from Jiangning district soybean field of Nanjing City.

Preferably, the plant root rot includes soybean root rot, tomato root rot, strawberry root rot and tobacco root rot.

In a second aspect of the invention, an engineering bacterium is provided, wherein the engineering bacterium comprises a nucleic acid fragment of the biocontrol bacterium pythium oligandrum Pyo 34-3.

Preferably, the base sequence of the nucleic acid fragment includes SEQ ID NO.1 and SEQ ID NO. 2;

SEQ ID NO.1： AACTTTCCACGTGAACCGTTATAACTATGTTCTGTGCTTCGTCGCAAGACTTGAGGCTGAACGAAGGTGAGTCTGCGTCTATTTTGGATGCGGATTTGCTGATGTTATTTTAAACACCTATTACTTAATACTGAACTATACTCCGAATACGAAAGTTTTTGGTTTTAACAATTAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAAATTAGAGATGGCAGAATGTGAGGTGTCTCGCGCTGTCTTTTTAAAGATGGTTCGAGTCCCTTTAAATGTACGTTGATTCTTTCTTGTGTCTGCGAATTGCGATGCTATGCTCTTTGTGATCGGTTTAGATTGCTTTGCGCTGGTGGGCGACTTCGGTTAGGACATATGGAAGCAACCTCAATTGGCGGTATGTTCGGCTTTGCCTGACGTTAAGCTAAGCGAGTGTAGTTTTCTGTCTTTTCCTTGAGGTGTACCTGTCGTGTGTGAGGTTGATTTAGGCTATATGGTTGCTTGGTTGTGTGGTTTAGCGTTTTCAGACGCCTGCTTCGGTAGGTAAAGGAGACAACACCAATTTGGGACTGAGAGTTTACTCTCTTTTTCACTTTGGACCTGATATCAGGTAAGACTACCCGCTGAACTTAAGCATATCATAAACGGGAAAAAGAAATAC

SEQ ID NO.2： AAAAGAAGTGTTTAAATTTCTATCTGTTAATAACATTGTAATAGCTCCAGCTAAAACAGGTAAAGTTAATAATAATAAGAAAGCTGTAATGAAAATAGCCCAAACGAATAAAGGTAATCTATGGAAACTTAAACCAGGAGCTCTCATATTATAAATAGTTGAAAGAAAATTAATAGCACCTAATAAAGATGAAATACCCGATAAATGTAAACTAAATATAGCTAAATCTACAGAAGGACCAGAGTGTGCTTGAACACTTGATAAAGGAGGATATACAGTCCAACCAGTACCAGCACCTGATTCAACTATAGCTGATGATACTAATAATAATAACGAAGGTGGTAATAACCAAAAACTAATATTATTCATTCTAGGAAAAGCCATATCTGGTGCACCAATCATTAAAGGAACAAACCAGTTACCGAAACCACCTATTAATACAGGCATAACCATGAAGAAAATCATAATAAAAGCATGTGCTGTAACAACAACATTATATAAATGATGATTTCCCATAAAAATTTGATTACCAGGTTGTGCTAATTCCATTCTAATTAAAACTGATAAAGTTGTACCAACAACACCTGAAAAAGCACCGAAGATTAAATATAAAGTACCAATATCTTTGTGGTTTGTTGAAAAAGCTT

preferably, the biocontrol bacterium is named as pythium oligandrum Pyo34-3, and the preservation unit comprises: china general microbiological culture Collection center (CGMCC) with a collection number of CGMCC NO. 20224.

Preferably, the plants include soybean, tomato, strawberry and tobacco.

In a third aspect of the invention, a composition is provided comprising pythium oligandrum Pyo34-3 or an engineered bacterium thereof.

Preferably, the plants include soybean, tomato, strawberry and tobacco.

In a fourth aspect of the invention, a plant root rot biocontrol microbial inoculum is provided, the active ingredients of which comprise one or more of hyphae, spores and secondary metabolites of pythium oligandrum Pyo34-3 in claim 1.

Preferably, the content of spores of pythium oligandrum Pyo34-3 is not less than 1 x 10⁶Per gram; more preferably, the content of spores of pythium oligandrum Pyo34-3 is not less than 1X 10⁸Per gram.

Preferably, the pythium oligandrum Pyo34-3 mycelium is prepared by inoculating pythium oligandrum Pyo34-3 into a V8 culture medium and culturing in a dark place.

Preferably, the biocontrol microbial inoculum comprises a biocontrol fertilizer and a biocontrol pesticide.

In a fifth aspect of the invention, a method for preparing a biocontrol microbial inoculum is provided, which comprises the following steps:

s1, mixing the soybean straw, the soybean meal and the vermiculite to prepare a substrate;

s2, adding hypha, spores or secondary metabolites of pythium oligandrum Pyo34-3 into the substrate;

s3, adding sterile water to ensure that the water content of the mixture obtained in the S2 is 50-80%;

and S4, hermetically culturing the product obtained in the step S3 for several days to obtain the biocontrol microbial inoculum.

Preferably, the method comprises the steps of:

a1: pythium oligandrum strain Pyo34-3 was inoculated into 20mL of 10% unfiltered V8 medium 9cm in diameter and cultured at 25 ℃ in the dark for 4 days until it grew on a petri dish.

A2: sterilizing the substrate (soybean straw: soybean flour: vermiculite = 100: 5: 10) at 121 deg.C for 20 min, cooling, and packaging into sterile solid fermentation bag with air holes. Each bag of the substrate was 1500 g.

A3: adding a culture medium full of pythium oligandrum Pyo34-3 into a matrix, adding sterile water to enable the water content in the matrix to reach 70%, sealing, and placing in a 28 ℃ incubator for dark culture for 15 d to obtain the solid fermentation microbial inoculum of pythium oligandrum Pyo 34-3.

In a sixth aspect of the invention, the invention provides application of the biocontrol bacterium, the engineering bacterium, the composition and the biocontrol bacterium agent in preventing and treating plant root rot.

In a seventh aspect of the invention, a method for controlling plant root rot is provided, which comprises applying the biocontrol bacterium, the engineering bacterium, the composition or the biocontrol bacterium agent provided by the invention to a plant growth environment.

Preferably, the plant growing environment is the plant seedling hypocotyl growing environment.

Preferably, the plant root rot disease comprises a plant disease caused by one or more of phytophthora sojae, pythium ultimum, fusarium oxysporum and phomopsis.

Preferably, the plants include soybean, tomato, strawberry and tobacco.

Compared with the prior art, the invention has the following advantages or beneficial effects: the biocontrol strain pythium oligandrum Pyo34-3 provided by the invention can obviously reduce the disease severity of plant root rot, the average biocontrol effect reaches 55.23%, and meanwhile, the plant yield can be obviously improved, and the average yield increase rate reaches 16.00%.

Drawings

FIG. 1 is a graph showing the effect of bacteria numbered 34-3 in example 1 on the induction of soybean resistance;

FIG. 2 is a graph showing the results of the effect of bacterium No. 34-3 in example 1 on soybean growth;

FIG. 3 is a graph showing the effect of the fungus Pythium oligandrum Pyo34-3 in example 2 on the root rot of a plant caused by P6497 soybean phytophthora;

FIG. 4 is a graph showing the effect of the fungus Pythium oligandrum Pyo34-3 on the root rot of Pythium ultimum in example 2;

FIG. 5 is a graph showing the effect of the fungus Pythium oligandrum Pyo34-3 in example 2 on the root rot of a plant caused by Fusarium oxysporum;

FIG. 6 is a graph showing the effect of the fungus Pythium oligandrum Pyo34-3 in example 2 on root rot of plants caused by Phomopsis.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

As used herein, the term "biocontrol bacteria" refers to beneficial microorganisms that can control plant diseases, mainly bacteria, fungi, actinomycetes.

As used herein, the term "engineered bacteria" refers to novel microorganisms processed by modern biotechnology, and is characterized by multiple functions, high efficiency and adaptability.

As used herein, the term "phytophthora sojae" is classified: kingdom of algae (Chromista), phylum Oomycota (Oomycota), order Peronosporales (Peronospoles), family Pythiaceae (Pythiacea), genus Phytophthora (Phytophthora). Mainly distributed in the united states, canada, brazil, argentina, japan, australia, uk, hungary, nigeria, india, china, egypt, israel, south africa, germany, switzerland new zealand, etc.

As used herein, the term "Pythium ultimum" belongs to the kingdom of algae (Chromista), the phylum Oomycota (Oomycota), the order Peronosporales (Peronosporales), the family Pythiaceae (Pythaceae), and the genus Pythium (Pythium), and the colonies are radial on the CMA. The hypha is developed and the branches are luxuriant, and the diameter is 2.3-9.8 mu m. Originally separated from the decayed cress seedlings in the United kingdom, the seedlings are reported to be widely distributed, inhabit in soil, and widely infect more than 150 economic plants such as soybean, kidney bean, pea, sweet potato, pine seedling, coffee, apple, orange, peach, cotton, chrysanthemum, dahlia, pumpkin, watermelon, sugarcane, alfalfa, tomato and the like to cause seedling withering, damping-off, root rot, foot rot, withering and other diseases.

As used herein, the term "Fusarium oxysporum" belongs to the family of fungi Imperfecti (Imperfecti fungi), the order Moniliales (Moniliales), the family Cinobospermaceae (Tuberculataceae), the genus Fusarium (Fusarium). Is a soil-borne pathogenic fungus distributed worldwide, has wide host range, and can cause blight of more than 100 plants such as melons, solanaceae, bananas, cotton, leguminous and flowers.

As used herein, the term "Phomopsis" belongs to the order Chimomycetales, the family Chimomycetaceae, and is widely distributed.

Example 1 screening of the fungus Pythium oligandrum Pyo34-3

1. Primary screening: isolation of potential biocontrol bacteria

1.1, obtaining a test material: a soybean plant with good growth vigor is selected from a field (a soybean field in Jiangning area of Nanjing city) which has root rot all the year round, and root tissues and rhizosphere soil of the soybean plant are taken.

1.2, separation and culture of soybean root microorganisms: cutting soybean root tissue, washing with sterile water for three times, cutting the washed root tissue into 0.5-1cm pieces with sterile scalpel, sucking water from the surface of root tissue with sterile absorbent paper, placing on V8 agar solid culture medium containing ampicillin, rifampicin and pentachloronitrobenzene, and culturing at 25 deg.C for 2 days.

1.3, separating and culturing soybean rhizosphere soil microorganisms: 0.25g of soil was removed with sterilized forceps, and the obtained mixture was placed on a V8 agar solid medium containing ampicillin, rifampicin and pentachloronitrobenzene, and cultured in an incubator at 25 ℃ for 2 days. After hyphae grow around the sample, hyphae pieces with a size of 2X 2 mm are cut and put into a new V8 solid culture medium with ampicillin, rifampicin and quintozene for culturing for 2 days again.

2. Infection of soybean yellow seedling by microbial culture

Transferring the soybean root microorganism culture obtained in the step 1.2 and the soybean rhizosphere soil microorganism culture obtained in the step 1.3 into a V8 solid culture medium respectively, and culturing in an incubator at 25 ℃ for 2 days. Beating the culture medium into a bacterial cake with the diameter of 0.5cm by using a sterilization puncher, inoculating the bacterial cake onto the hypocotyl of the soybean yellow croaker seedling, carrying out moisture preservation culture for three days, and observing the infection condition of microorganisms on the soybean, thereby screening out the strain which has no pathogenicity on the soybean.

3. Screening for strains capable of promoting Soybean growth

3.1 isolating strains which are not pathogenic to soybean from the roots of the well grown soybeans in step 2, inoculating the strains into a petri dish (containing 20ml of unfiltered V8 medium) with a diameter of 9cm, and culturing at 25 deg.C for 4 days.

3.2, cutting the strain plate obtained in the step 3.1 into small blocks of 0.5cm × 0.5cm respectively. Setting an experimental group and a control group, wherein the experimental group comprises: 2 small blocks of the same strain are uniformly mixed by using sterilized water, then the small blocks are added to a pot 2/3, 5 soybean seeds are sown, and then the soybean seeds are covered by vermiculite mixed with bacteria. The control group was: the V8 medium and sterilized water were mixed well, and then added to the pot 2/3, 5 soybean seeds were sown, followed by covering the soybean seeds. Each treatment was 3 replicates. After sowing for 10 days, the germination rate, plant height, root length, fresh weight and dry weight of the seedlings are counted.

And 3.3, counting the parameters of germination rate, plant height, root length, fresh weight and dry weight which are superior to those of the strain experimental group of the control group, and collecting corresponding strain small blocks.

4. Screening strains capable of inducing resistance of soybeans

4.1, respectively inoculating the small blocks of the strains obtained in the step 3.3 to soybean etiolation seedlings, taking off the small blocks of the strains after 3d, driving the small blocks of the strains into the phytophthora sojae cakes by using a puncher with the diameter of 1.5cm, rolling up the absorbent paper again, and wrapping the absorbent paper by using tin foil paper to expose soybean cotyledons. Incubated at 25 ℃ for 5 days under light.

4.2, in order to more accurately quantify the disease condition of the soybeans in each treatment, soybean seedlings with the disease level reduced are respectively taken 2.5cm of soybean tissues of 5cm above and below the inoculation point as the center, and 3 soybean tissues are taken for each treatment. Total DNA is extracted by using a plant genome DNA extraction kit, and a housekeeping gene CYP2 of soybean is used as an internal reference gene to carry out quantitative analysis on Actin of phytophthora sojae so as to compare the invasion amount of pathogenic bacteria in soybean tissues. Thereby screening out the strain which can induce the soybeans to generate resistance and resist the phytophthora sojae.

Wherein, the grading standard of the disease grade number is as follows: 0: the base of the seedling stem and the main root have no disease spots; 1: a small amount of scabs are arranged on the base part and the main root of the stem, and the area of the scabs is below 1/4; 2: the area of the lesion spots on the stem base and the main root accounts for about 1/4-1/2 of the total area of the stem base and the main root; 3: the area of the lesion spots on the base of the stem and the main root is about 1/2-3/4; 4: the lesion spots on the stem base and the main root are connected to form a stem winding phenomenon, but the root system is not necrotic; 5: root necrosis, wilting or death of the overground part.

Finally, a strain which is nonpathogenic to soybean, promotes the growth of soybean and can induce the resistance of soybean is obtained through screening, and the number of the strain is 34-3.

As shown in FIG. 1, the left panel is the roots of bean sprouts of the control group, and the right panel is the roots of bean sprouts of the experimental group inoculated with the bacteria numbered 34-3. The dark part of the graph is the lesion of the bacterial infection, and it can be seen that the plaque of the experimental group is obviously less than that of the control group, and the experimental group generates resistance.

As shown in FIG. 2, the left panel shows the bean seedlings of the control group, and the right panel shows the bean seedlings of the experimental group inoculated with the bacteria with the number of 34-3. As can be seen, the height and root length of the soybean seedlings inoculated with the strain numbered 34-3 are both obviously superior to those of the control group, so that the microbial culture numbered 34-3 can promote the growth of soybeans.

5. Molecular biological identification of the strains obtained by screening

5.1, placing the microbial culture obtained by purification in a V8 liquid culture medium, culturing for two days at 25 ℃, and centrifuging the culture solution to collect mycelium.

5.2, extracting the genome DNA of the collected mycelium by adopting a genome DNA rapid extraction kit of Shanghai Saibance gene technology Limited.

5.3 amplification of ITS2 (internal transcribed spacer 2) and COI1 (cytochrome oxidase subunit 1) genes of the genomic DNA obtained in step 5.2 by using PCR amplification kit of Dalibao Biotechnology Ltd.

5.4, after the PCR product obtained by amplification is subjected to 1% agarose gel electrophoresis, observing under an ultraviolet lamp, sending the PCR product with the target band to Nanjing Kingsry Biotech limited for sequencing, wherein the sequencing result is as follows: the ITS2 gene sequence of the strain obtained by screening in the step 4 is SEQ ID NO.1, and the COI1 gene sequence is SEQ ID NO. 2.

5.5, aligning the two sequences of SEQ ID NO.1 and SEQ ID NO.2 on the NCBI database website. The alignment results are shown in Table 1. From the results shown in Table 1, it is assumed that the biocontrol bacterium 34-3 of the present invention is Pythium oligadrum (Pythium oligadrum) which is named as the bacterium Pythium oligadrum Pyo 34-3.

TABLE 1

Example 2 Effect of the fungus Pythium oligandrum Pyo34-3 on root rot caused by different plants

The inventors of the present invention conducted a large number of experiments on the effect of the strain pythium oligandrum Pyo34-3 screened in example 1 on root rot caused by different plants, and explained the following examples of phytophthora sojae, pythium ultimum, fusarium oxysporum and phomopsis sp.

[ Phytophthora sojae ]

The test method for the influence of pythium oligandrum Pyo34-3 on the plant root rot caused by phytophthora sojae comprises the following steps:

r1, respectively inoculating pythium oligandrum strain Pyo34-3 and phytophthora sojae P6497 into a culture dish with the diameter of 9cm and containing 20mL of 10% unfiltered V8 culture medium, respectively culturing at 25 ℃ for 4d and 7d in a dark place, and allowing the culture dish to grow full of the strains;

r2, selecting a pot with the diameter of 12cm, and cutting the culture medium full of pythium oligandrum Pyo34-3 and phytophthora sojae P6497 into flat plates with the diameter of 0.5cm multiplied by 0.5 cm. Test set 2 groups, control group: 2V 8 plates of 0.5cm × 0.5cm and 2 plate pieces of 0.5cm × 0.5cm of Phytophthora sojae P6497 were added to each pot; the experimental groups were: 2 flat plates of 0.5cm by 0.5cm Pythium oligandrum Pyo34-3 and 2 flat plates of 0.5cm by 0.5cm Pythium sojae P6497 were added to each pot. Each set of 3 replicates;

r3, stirring 2 kinds of plate pieces uniformly with sterile water and sterilized vermiculite, adding to 1/3 pots, sowing 20 soybeans (variety: hyanfeng 47) in each pot, and then covering the soybeans with plate powder;

r4, irrigating each group of soybeans with sterile water, and counting the germination rate, plant height and fresh weight of the soybeans after sowing for 14 days, wherein the results are shown in figure 3 and table 2.

TABLE 2

Wherein, the numerical expression modes of the emergence rate, the plant height and the fresh weight in the table are as follows: mean ± standard error.

As can be seen from FIG. 3, the plant height, the number of buds, and the flourishing degree of the experimental group are obviously superior to those of the control group, and therefore, the pythium oligandrum Pyo34-3 has the effect of preventing or curing the plant root rot caused by phytophthora sojae P6497.

The emergence rate of the experimental group in table 2 was increased by about 50% compared to the control group, and the plant height and fresh weight were also significantly increased.

As can be seen from the results of FIG. 3 and Table 2, the separated biocontrol bacterium pythium oligandrum Pyo34-3 has a remarkable control effect on plant root rot caused by phytophthora sojae. Pyo34-3 can improve the emergence rate, plant height and fresh weight of soybean.

Pythium ultimum

The method of steps R1-R4 is adopted to detect the influence of the fungus pythium oligandrum Pyo34-3 on the plant root rot caused by pythium ultimum. In the experiment, phytophthora sojae P6497 was replaced by pythium ultimum Pyu 1. The test results are shown in fig. 4 and table 3.

TABLE 3

As can be seen from FIG. 4, the plant height, the number of buds, and the flourishing degree of the experimental group are obviously superior to those of the control group, and the pythium oligandrum Pyo34-3 has the effect of preventing or curing the plant root rot caused by pythium ultimum.

The emergence rates of the experimental group and the control group in the table 3 are 63.33 +/-10.41 and 8.33 +/-2.43 respectively, and the emergence rates of the experimental group and the control group are increased by times, and the plant height and the fresh weight are also obviously increased.

As can be seen from the results of FIG. 4 and Table 3, the biocontrol bacterium pythium oligandrum Pyo34-3 of the present invention has significant control effect on the plant root rot caused by pythium ultimum, and the Pyo34-3 treatment significantly improves the emergence rate, plant height and fresh weight of soybean.

Fusarium oxysporum

The method of steps R1-R4 is adopted to detect the influence of the fungus pythium oligandrum Pyo34-3 on the plant root rot caused by fusarium oxysporum. In the experiment, phytophthora sojae P6497 was replaced by fusarium oxysporum. The test results are shown in table 4 of fig. 5.

TABLE 4

As can be seen from FIG. 5, the plant height, the number of buds, and the flourishing degree of the experimental group are obviously superior to those of the control group, and the pythium oligandrum Pyo34-3 has the effect of preventing or curing the plant root rot caused by pythium ultimum.

The emergence rate, plant height and fresh weight of the experimental group in table 4 are all obviously superior to those of the control group.

As can be seen from the results of FIG. 5 and Table 4, the biocontrol bacterium pythium oligandrum Pyo34-3 of the present invention has significant control effect on plant root rot caused by Fusarium oxysporum, and the treatment of Pyo34-3 significantly improves the emergence rate, plant height and fresh weight of soybean.

[ Pseudophomopsis ]

The method of steps R1-R4 is adopted to detect the influence of the fungus pythium oligandrum Pyo34-3 on the plant root rot caused by phomopsis. In the experiment, phytophthora sojae P6497 was replaced by phomopsis. The test results are shown in fig. 6 and table 5.

TABLE 5

	Rate of emergence (100%)	Plant height (cm)	Fresh weight (g)
				Control group	53.33±2.89	15.17±2.69	4.30±0.19
Experimental group	81.67±2.89	21.97±3.13	5.95±0.96

As can be seen from FIG. 6, the plant height, the number of buds, and the flourishing degree of the experimental group are obviously superior to those of the control group, and the pythium oligandrum Pyo34-3 has the effect of preventing or curing the plant root rot caused by phomopsis.

In table 5, the emergence rate of the experimental group was increased by about 50% compared to the control group, the plant height of the experimental group was increased by about 40% compared to the control group, and the fresh weight was also significantly increased.

As can be seen from the results of FIG. 6 and Table 5, the biocontrol bacterium pythium oligandrum Pyo34-3 has a remarkable control effect on the root rot of plants caused by phomopsis, and the treatment of Pyo34-3 remarkably improves the emergence rate, plant height and fresh weight of soybeans.

EXAMPLE 3 field test of Pythium oligandrum Pyo34-3

Step one, inoculating pythium oligandrum strain Pyo34-3 into 20mL 10% unfiltered V8 culture medium with the diameter of 9cm, and culturing at 25 ℃ in a dark place for 4d until the culture dish is full.

And step two, sterilizing the substrate (soybean straw: soybean flour: vermiculite = 100: 5: 10) at the high temperature of 121 ℃ for 20 min, cooling, and filling into a sterile solid fermentation bag with air holes. Each bag of the substrate was 1500 g.

Step three, cutting a culture medium full of pythium oligandrum Pyo34-3 into small blocks of 0.5cm multiplied by 0.5cm, inoculating two blocks of the culture medium into each bag of the matrix, adding sterile water to enable the water content in the matrix to reach 70%, sealing the culture medium, and placing the culture medium in an incubator at 28 ℃ for dark culture for 15 days to obtain the solid fermentation inoculum of pythium oligandrum Pyo 34-3.

Step four, microscopic examination of the solid fermentation inoculum of pythium oligandrum Pyo34-3, wherein the number of oospores is 1 multiplied by 10⁸Per gram. Meanwhile, no mixed bacteria pollution is found in culture and microscopic examination, and the method meets the standard GB20287-2006 agricultural microbial inoculum.

And fifthly, planting soybeans in the field (white horse base of Nanjing agriculture university) by adopting an equidistant hole sowing cultivation method, wherein the row spacing is 70cm, the hole spacing is 15-20 cm, and 2-3 plants are planted in each hole. The soybean variety is Sudou 13. The experiment adopts completely random design, each treatment is 3 times of repetition, and the area of each repeated cell is 20m²(4m is multiplied by 5m), and protection rows are arranged among cells. In the process of soybean hole sowing, 100g of solid fermentation inoculum of pythium oligandrum Pyo34-3 is applied to each hole and is applied together with soybean seeds. The field experiments all used standard field management modes and no other bactericide was used.

And step six, counting the disease control condition of the plant root rot 30 days (soybean seedling stage) after sowing. And randomly taking 10 seedlings for each treatment, removing surface soil (0-5 cm) during sampling, digging out the plants with roots, keeping the root systems complete, and calculating the disease index of the root rot and the prevention effect of the root rot. Wherein, the disease index = (disease number of disease strains x disease number)/(total number of strains x highest disease value) × 100, and the control effect (%) = (disease index of control group-disease index of experimental group)/disease index of control group x 100. The results are shown in tables 6 and 7. Wherein the disease grade number is graded according to the method in step 4.2 of example 1.

TABLE 6

	Disease index (%)	Control effect (%)
			Control group	44.67±4.16	-
Experimental group	20.00±2.00	55.23

TABLE 7

	Plant height (cm)	Number of individual fruit pods	Bai Lili (g)	Yield (kg/mu)	Yield increase rate (100%)
						Control group	67.83±3.24	42.33±2.78	20.11±0.37	171.06±6.37	-
Experimental group	68.67±4.81	46.07±3.21	22.25±0.43	198.43±9.41	16.00%

From the results of the above tables 6 and 7, it can be seen that the biocontrol bacterium pythium oligandrum Pyo34-3 of the present invention can significantly reduce the disease severity of plant root rot, the average biocontrol effect thereof reaches 55.23%, and simultaneously, the soybean yield can also be significantly increased, and the average yield increase thereof reaches 16.00%.

The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.

Sequence listing

<110> Nanjing university of agriculture

<120> biocontrol bacterium for plant root rot and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 820

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aactttccac gtgaaccgtt ataactatgt tctgtgcttc gtcgcaagac ttgaggctga 60

acgaaggtga gtctgcgtct attttggatg cggatttgct gatgttattt taaacaccta 120

ttacttaata ctgaactata ctccgaatac gaaagttttt ggttttaaca attaacaact 180

ttcagcagtg gatgtctagg ctcgcacatc gatgaagaac gctgcgaact gcgatacgta 240

atgcgaattg cagaattcag tgagtcatcg aaattttgaa cgcatattgc actttcgggt 300

tatgcctgga agtatgcctg tatcagtgtc cgtacatcaa acttgccttt ctttttttgt 360

gtagtcaaaa ttagagatgg cagaatgtga ggtgtctcgc gctgtctttt taaagatggt 420

tcgagtccct ttaaatgtac gttgattctt tcttgtgtct gcgaattgcg atgctatgct 480

ctttgtgatc ggtttagatt gctttgcgct ggtgggcgac ttcggttagg acatatggaa 540

gcaacctcaa ttggcggtat gttcggcttt gcctgacgtt aagctaagcg agtgtagttt 600

tctgtctttt ccttgaggtg tacctgtcgt gtgtgaggtt gatttaggct atatggttgc 660

ttggttgtgt ggtttagcgt tttcagacgc ctgcttcggt aggtaaagga gacaacacca 720

atttgggact gagagtttac tctctttttc actttggacc tgatatcagg taagactacc 780

cgctgaactt aagcatatca taaacgggaa aaagaaatac 820

<210> 2

<211> 647

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaaagaagtg tttaaatttc tatctgttaa taacattgta atagctccag ctaaaacagg 60

taaagttaat aataataaga aagctgtaat gaaaatagcc caaacgaata aaggtaatct 120

atggaaactt aaaccaggag ctctcatatt ataaatagtt gaaagaaaat taatagcacc 180

taataaagat gaaatacccg ataaatgtaa actaaatata gctaaatcta cagaaggacc 240

agagtgtgct tgaacacttg ataaaggagg atatacagtc caaccagtac cagcacctga 300

ttcaactata gctgatgata ctaataataa taacgaaggt ggtaataacc aaaaactaat 360

attattcatt ctaggaaaag ccatatctgg tgcaccaatc attaaaggaa caaaccagtt 420

accgaaacca cctattaata caggcataac catgaagaaa atcataataa aagcatgtgc 480

tgtaacaaca acattatata aatgatgatt tcccataaaa atttgattac caggttgtgc 540

taattccatt ctaattaaaa ctgataaagt tgtaccaaca acacctgaaa aagcaccgaa 600

gattaaatat aaagtaccaa tatctttgtg gtttgttgaa aaagctt 647

Claims

1. The biocontrol strain for the plant root rot is named as pythium oligandrum Pyo34-3, and the preservation unit comprises: china general microbiological culture Collection center (CGMCC) with a collection number of CGMCC NO. 20224.

2. The biocontrol strain of plant root rot according to claim 1, wherein said plant root rot includes soybean root rot, tomato root rot, strawberry root rot, and tobacco root rot.

3. The biological control agent for the root rot of plants is characterized in that the active ingredients of the biological control agent comprise one or more of hyphae or spores of pythium oligandrum Pyo34-3 in claim 1.

4. The biocontrol microbial inoculum for root rot of plant as claimed in claim 3, wherein the content of spores of pythium oligandrum Pyo34-3 is not less than 1 x 10⁶Per gram.

5. The biocontrol microbial inoculum for plant root rot disease as claimed in claim 3, wherein the mycelium of pythium oligandrum Pyo34-3 is obtained by inoculating pythium oligandrum Pyo34-3 into V8 culture medium for culture.

6. A method for preparing the biocontrol microbial inoculum according to any one of claims 3-5, comprising the steps of:

s2, adding hypha or spore of pythium oligandrum Pyo34-3 into the substrate;

7. The biocontrol agent of claim 1 or 2, or any one of claims 3-5, for controlling plant root rot, wherein the plant root rot comprises a plant disease caused by one or more of phytophthora sojae, pythium ultimum, fusarium oxysporum, and phomopsis sp.

8. A method for controlling a plant root rot, comprising applying the biocontrol bacterium of claim 1 or 2, or the biocontrol bacterium agent of any one of claims 3 to 5 to a plant growing environment; wherein the plant root rot disease comprises plant diseases caused by one or more of phytophthora sojae, pythium ultimum, fusarium oxysporum and phomopsis longipes.