CN111848785A - Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules - Google Patents
Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules Download PDFInfo
- Publication number
- CN111848785A CN111848785A CN202010663713.1A CN202010663713A CN111848785A CN 111848785 A CN111848785 A CN 111848785A CN 202010663713 A CN202010663713 A CN 202010663713A CN 111848785 A CN111848785 A CN 111848785A
- Authority
- CN
- China
- Prior art keywords
- antibody
- phage
- liquid
- centrifuging
- precipitate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
- C07K16/085—Herpetoviridae, e.g. pseudorabies virus, Epstein-Barr virus
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/005—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/01—DNA viruses
- G01N2333/03—Herpetoviridae, e.g. pseudorabies virus
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Genetics & Genomics (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of virus antibodies, and discloses a feline herpesvirus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof, wherein the sequence is a heavy chain variable region amino acid sequence SEQ ID NO: 1 and the nucleotide sequence SEQ ID NO: 3; light chain variable region amino acid sequence SEQ ID NO: 2 and the nucleotide sequence SEQ ID NO: 4. the screening method of the sequence comprises the following steps: preparing a phage antibody; panning of a phage antibody library; identifying a cat source phage single-chain antibody resisting the feline herpesvirus by a PhageELISA method; sequencing the scFv bacterial liquid with positive PhageELISA identification result by a sequencing company to obtain the variable region sequences of the heavy chain and the light chain of the gene engineering antibody of the feline herpesvirus. The invention provides support for constructing the gene engineering antibody of the feline anti-herpesvirus cat with high affinity and low immunogenicity. Has important significance for promoting the development of the feline antibody drug.
Description
Technical Field
The invention belongs to the technical field of virus antibodies, and particularly relates to a virus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof.
Background
Currently, Feline herpesvirus type I (FHV-1) was first isolated and identified in 1958 by Crandell and Maurer USA in young local cats with respiratory disease, and the subject of this virus was identified as a cat, although infections were also found in felines such as lion and cheetah. The key infection routes of FHV-1 include oral, nasal and conjunctival infections, and the main latent site is the trigeminal nervous system. FHV-1 is similar to FCV in clinical symptoms, and both can cause respiratory disease in cats.
At present, the clinical treatment of the feline herpesvirus disease mainly relies on monoclonal antibodies, most of the commercially available antibodies are xenogeneic animal immune serum, although the feline herpesvirus disease can protect young animals and adult animals from infection, but continuous injection cannot be carried out, otherwise severe anaphylactic reaction can be caused, and animal death can be caused in severe cases. In addition, the traditional mouse-derived monoclonal antibody has stronger heterogeneity and immunogenicity to a non-mouse-derived antibody, and easily causes immunological rejection or anaphylactic reaction of a host when applied in vivo, so that the therapeutic effect of the mouse-derived monoclonal antibody is reduced, even serious consequences are generated in a diseased body, and the clinical application effect of the mouse-derived monoclonal antibody is greatly limited.
At present, the phage display technology is more and more widely applied, more humanized phage display antibody libraries are successfully constructed, and particularly, the development of some monoclonal antibody medicines enables the phage display technology to be better developed. At present, most of the immune phage libraries are constructed, and because the antibody level in an animal body is improved after immunization, the immune phage libraries are more favorable for screening antibodies aiming at specific antigens and have more advantages on subsequent diagnosis and treatment effects. At present, most of the monoclonal antibodies are monoclonal antibodies, and the phage antibody library aiming at the cat source avoids interference factors in the use process of the antibodies, and provides theoretical basis for diagnosis of the feline herpesvirus and preparation of the monoclonal antibodies for treatment.
Through the above analysis, the problems and defects of the prior art are as follows: at present, phage antibody libraries directed against feline sources have not been constructed.
The difficulty in solving the above problems and defects is: in order to obtain an antibody library with a certain scale, firstly, a complete set of antibody genes of organism origin are obtained by means of an RT-PCR technology, and at present, the reports about cat origin gene sequences are few, and multiple pairs of primer verification needs to be carried out on antibody light chain variable region sequences and antibody heavy chain variable region sequences.
The significance of solving the problems and the defects is as follows: is beneficial to screening the antibody aiming at the specific antigen and has more advantages on subsequent diagnosis and treatment effect.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a virus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof.
The invention is realized by a virus antibody sequence which is a heavy chain variable region amino acid sequence SEQ ID NO: 1 and the nucleotide sequence SEQ ID NO: 3; light chain variable region amino acid sequence SEQ ID NO: 2 and the nucleotide sequence SEQ ID NO: 4.
it is another object of the invention to provide a tetrapeptide chain molecule formed by disulfide bonding of the heavy and light chains of the viral antibody sequence.
It is another object of the present invention to provide an immunoglobulin molecule comprising said tetrapeptide chain molecule.
Another object of the present invention is to provide a method for detecting feline herpesvirus using the virus antibody sequence.
The invention also aims to provide a preparation method of the monoclonal antibody for treating the feline herpesvirus, and the preparation method of the monoclonal antibody for treating the feline herpesvirus uses the virus antibody sequence.
Another object of the present invention is to provide a method for screening for the viral antibody sequence, which comprises:
firstly, preparing a phage antibody;
step two, panning of a phage antibody library;
thirdly, identifying the cat source Phage single-chain antibody of the anti-feline herpesvirus by a Phage ELISA method;
and fourthly, sequencing the scFv bacterial liquid with positive Phage ELISA identification result by a sequencing company to obtain the variable region sequences of the heavy chain and the light chain of the gene engineering antibody of the feline herpesvirus.
Further, the first step includes: adding 1mL of phage primary antibody library into 3mL of XLI-Blue bacterial liquid with OD600 equal to 0.5, standing at 37 ℃ for 45min, adding 6mL of LB liquid culture medium containing Amp + (100 mu g/mL), adding glucose according to a ratio of 1:1000, continuing to culture, adding helper phage M13K07 when the bacterial liquid OD600 is equal to 0.5, standing at 37 ℃ in an incubator for 30min, culturing at 37 ℃ for 1h at 220rpm/min, centrifuging the bacterial liquid at 3500rpm for 10min, discarding supernatant, adding IPTG (1mol/L) and Kana (50 mu g/mL) into LB liquid culture medium with the same volume of Amp + (100 mu g/mL) and Kana (50 mu g/mL), adding IPTG (1mol/L), at 220rpm/min, and shaking at 37 ℃ for 6 h; centrifuging the culture medium at 12000rpm for 10-20min, collecting supernatant, adding PEG8000 at 1:4-1:5, mixing, adding PEG8000 at 4 deg.C overnight, centrifuging at 12000rpm for 10min, collecting precipitate, resuspending the precipitate with 1.5mL of 1 XPBS, adding PEG8000 at 1:4-1:5, homogenizing, centrifuging at 4 deg.C for 2-3h at 12000rpm for 10min, collecting precipitate, resuspending the precipitate with 300 μ L of 1 XPBS, calculating the phage amount input into the sieve, and selecting.
Further, the second step includes:
(1) coating: with 0.1M NaHCO3Diluting the purified feline herpesvirus into 96-hole enzyme-labeled plates with different concentrations of 2 mug/mL, 4 mug/mL and 8 mug/mL, wherein each hole is 100 mug L, and placing the plates in a refrigerator at 4 ℃ for overnight; after coating, discarding the liquid in the enzyme label plate with 96 holes, adding 100 mu L washing buffer solution PBST into each hole, and washing for 3 times;
(2) and (3) sealing: adding 250 mu L of sealing liquid into each hole, and sealing in a 37 ℃ incubator for 2 h;
(3) washing: add 100. mu.L PBST per hole, wash 3 times totally; washing each time, shaking for 1min at 400rpm by using a plate shaking instrument, vertically rotating the ELISA plate for one circle, and infiltrating the tube wall;
(4) adding a phage antibody: adding phage antibody into 100 μ L of each well, shaking at 400rpm/min for 5min, and incubating at room temperature for 1 h;
(5) washing: repeating the step (3);
(6) and (3) elution: adding 50 mu L of stop solution into each hole, shaking the plate shaking instrument at 1000rpm for 5min, adding 75 mu L of Tris-HCL into each 400 mu L of eluent for neutralization, adding 20 mu L of the liquid into 180 mu L of competent cells with OD600 equal to 0.5, infecting for 20min, coating 20 mu L of bacterial solution on an LB plate containing Amp + (100 mu g/mL), culturing at 37 ℃ overnight, calculating the output phage library amount, picking up a monoclonal colony, shaking the bacteria, carrying out PCR identification, and sending for sequencing;
(7) Adding 3mL of OD into 90% of the total amount of the primary phage antibody library600In competent cells of 0.5, after infection for 30min, 6mL of LB liquid was added, and ampicillin was added to a final concentration of 100 μ g/mL and glucose was added at a ratio of 1: 1000; OD of bacterial liquid to be treated600When the culture medium is equal to 0.5, 4 multiplied by 1010 helper phage M13K07 is added, after standing and incubation for 30min, shaking culture is carried out for 1h at 220rpm/min, centrifugation is carried out for 6min at 3500rpm/min, supernatant is discarded, the precipitate is resuspended by using LB liquid culture medium containing Amp + (100 mu g/mL) and Kana (50 mu g/mL) in the same volume, and shaking culture is carried out at 37 ℃ and 220rpm/min overnight; centrifuging the culture medium at 12000rpm for 10-20min, and collecting the supernatant; adding PEG8000 into the mixture at a ratio of 1:4-1:5, reversing and mixing uniformly, wherein a cloudy precipitate appears at the moment, centrifuging the mixture for 10min at 12000rpm after the mixture is cooled to 4 ℃ in a refrigerator, collecting the precipitate, re-suspending the precipitate with 1.5mL of 1 XPBS, adding PEG8000 into the mixture again according to a ratio of 1:4-1:5, reversing uniformly, centrifuging the mixture for 10min at 12000rpm after the mixture is cooled to 4 ℃ in a refrigerator for 2-3h, collecting the precipitate, and re-suspending the precipitate with 300 mu L of 1 XPBS to obtain a first round of single-chain antibody library;
(8) performing 3-4 rounds of phage panning, calculating the amount of phage library input and output each time, adding 50% glycerol into the phage library in the last round, and storing in a refrigerator at-80 deg.C.
Further, the third step includes:
(1) coating: the purified feline herpesvirus was treated with 0.1M NaHCO3Diluting to 8 mu g/mL coated 96-well enzyme label plate, setting BSA as a blank control, and setting M13K07 as a negative control;
(2) and (3) sealing: discarding the coating solution in a 96-well enzyme label plate, and incubating for 2h at 37 ℃ with 200 mu L of confining liquid in each well;
(3) washing: adding 200 μ L PBST into each well, washing for 3 times, and patting to dry;
(4) adding a phage single-chain antibody: 1:1 mixing phage single-chain antibody and PBST, adding 200 mu L of phage single-chain antibody into a 96-well enzyme label plate, and incubating for 2h at room temperature;
(5) washing: the same step (3);
(6) applying a second antibody: diluting an HRP-labeled anti-M13 antibody at a ratio of 1:5000, and incubating at 37 ℃ for 1 h;
(7) washing: the same step (3);
(8) color development: adding 50 μ L of TMB color developing solution into each well, covering with tinfoil paper, and reacting at 37 deg.C for 10 min;
(9) and (4) terminating: 50 μ L of 2mol/L H was added to each well2SO4Stopping the reaction, and detecting OD by an enzyme-linked immunosorbent assay450Numerical values.
Further, the construction of the cat-derived anti-feline herpesvirus single-chain antibody library comprises:
(1) separating peripheral blood lymphocytes of cats, performing vaccine immunization on 5 experimental cats, wherein each immunization is separated by 2 weeks, 3 times of immunization is performed, 2 weeks after 3 times of immunization, 5-10mL of fresh blood is uniformly mixed with whole blood and tissue diluent in a ratio of 1:1-1:2, adding cell separating medium into a 15mL centrifugal tube, slightly adding diluted anticoagulation blood with the same volume along the tube wall, centrifuging by a horizontal centrifuge at a rotation speed of 400-800 g for 15-25 min, and after centrifuging, dividing the liquid in the centrifugal tube into four layers which are respectively from top to bottom: a first layer: a plasma layer; a second layer: a layer of lymphocytes; and a third layer: separation liquid and fourth layer: sucking a second layer of milky lymphocytes into another 15mL centrifuge tube carefully by using a pipette, adding 10mL of cleaning solution for uniformly mixing, centrifuging for 10min at 250g, repeating for 2-3 times, discarding supernatant, resuspending the lymphocytes at the bottom of the tube by using cryopreservation solution containing 90% fetal calf serum, 10% DMSO and 1% double antibody, subpackaging the above suspension into 2mL cryopreservation tubes, placing the above cryopreservation tubes in a refrigerator at 4 ℃ for 30min, placing the above cryopreservation tubes in a refrigerator at-20 ℃ for 2h, placing the above cryopreservation tubes in a refrigerator at-80 ℃ overnight, and transferring the above cryopreservation tubes to liquid nitrogen sequentially for cryopreservation lymphocytes on the next day;
(2) And (3) extracting total RNA of the cat peripheral blood lymphocytes, transferring the PBMC in the frozen tube into a 1.5mL centrifuge tube, centrifuging at 1800rpm for 5min, discarding supernatant, leaving 50-100 mu L of supernatant at the bottom of the centrifuge tube, and re-suspending the bottom cells of the tube. Adding 1mL Trizol, repeatedly blowing with pipette, incubating at room temperature for 5min, adding 0.2mL chloroform, shaking by hand for 15s, incubating at room temperature for 2-3min, and freezing with centrifuge at 12000rpmThe solution was centrifuged at 4 ℃ for 15min, at which time the liquid separated into a lower organic phase containing DNA and protein, and an upper transparent layer containing RNA. Inclining the centrifuge tube at 45 degrees, transferring the transparent layer to another 1.5mL centrifuge tube, adding 0.5mL isopropanol, mixing, incubating at room temperature for 10min, centrifuging at 12000rpm for 10min, discarding the supernatant, adding 1mL 75% ethanol, washing with vortex oscillator, centrifuging at 7500rpm and 4 deg.C for 5min, discarding the supernatant, standing and drying the centrifuge tube on a clean bench for 5-10min, re-suspending and dissolving with at least 30 μ L DEPC water, and measuring concentration and A with an ultramicro spectrophotometer260And A280The ratio is preserved at minus 80 ℃;
(3) cat heavy chain variable region VHAnd light chain variable region VLThe amplification of (1) was performed using PrimeScript using the extracted total RNA as a templateTMII 1st Strand cDNA Synthesis Kit reverse transcription of total RNA into cDNA, PCR amplification of V using it as template HGenes and VLPreparing 1.5% agarose gel for nucleic acid electrophoresis detection and identification, observing the result in a gel imager, recovering gel, and purifying VHAnd VLFragment, using primer of Linker to make heavy chain variable region gene V by SOE-PCR gene engineering methodHRespectively linked with light chain variable region gene VLLight chain variable region gene VLAssembly into scFv genes to form VL-linker-VHPreparing 1.0% agarose gel, observing the result in a gel imager, recovering the gel, purifying the scFv gene fragment, and carrying out enzyme digestion and connection on the purified scFv gene product and a phage vector pComb3 XSS;
(4) constructing a single-chain antibody library, performing electric shock transformation on 20 mu L of the ligation product and 80 mu L of electrotransformation competent XLI-Blue under the conditions of 2.5KV and 800 omega, washing an electric rotating cup by using 1mLSOC culture medium, sucking the liquid into a 50mL centrifuge tube, rotating at 220rpm/min and 37 ℃, shaking the bacteria for 45min, respectively coating 10 mu L, 50 mu L and 100 mu L of bacteria liquid on a plate containing Amp + (100 mu g/mL), identifying the electrotransformation effect, adding 9mL of LB liquid culture medium containing Amp + (100 mu g/mL) into the centrifuge tube, and performing electric shock transformation on the mixture by using a reaction solution prepared by mixing the following components in a ratio of 1: 1000 adding glucose, 220rpm/min, 37 ℃, shaking to OD6000.5. Adding 20 μ L of helper phage M13K07 for rescue and infecting for 30min And (3) shaking the bacteria for 1h, centrifuging the bacteria liquid at 3000rpm for 6min, removing the supernatant, adding IPTG (isopropyl-beta-D-thiogalactoside) at a ratio of 1:1000 into LB liquid culture medium containing Amp + (100 mu g/mL) and Kana at 37 ℃ for 6h, and shaking the bacteria. Centrifuging the culture medium at 12000rpm/min for 10-20min, collecting supernatant, adding PEG8000 at 1:4-1:5, reversing and mixing, wherein cloudy precipitate appears, centrifuging at 12000rpm for 10min after 4 ℃ in a refrigerator, collecting precipitate, re-suspending the precipitate with 1.5mL1 XPBS, adding PEG8000 at a ratio of 1:4-1:5, reversing and mixing, centrifuging at 12000rpm for 10min after 2-3h at 4 ℃ in a refrigerator, collecting precipitate, re-suspending the precipitate with 300 uL 1 XPBS, adding 50% glycerol, mixing, standing at-20 ℃ for storage, and constructing a library for multiple times according to the method to establish the original library of the scFv phage antibody.
By combining all the technical schemes, the invention has the advantages and positive effects that: the variable region amino acid sequences and the nucleotide sequences of the heavy chain and the light chain of the feline herpesvirus-resistant humanized cat antibody provided by the invention provide support for constructing a high-affinity and low-immunogenicity canine herpesvirus-resistant genetic engineering antibody. Has important significance for promoting the development of the feline antibody drug. According to the invention, an immune cat is selected as a research object, peripheral blood of a sample is collected firstly, then PBMC is separated by means of a centrifuge, and finally expression of a cat source antibody gene is carried out on the surface of a phage vector based on a phage display method, so that a phage single-chain antibody library for the feline herpesvirus is obtained, and the same animal source of the antibody is realized.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments of the present application will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present application, and it is obvious for those skilled in the art that other drawings can be obtained from the drawings without creative efforts.
FIG. 1 is a flow chart of a method for screening viral antibody sequences provided in the examples of the present invention.
FIG. 2VHAnd (3) gene PCR amplification products.
FIG. 3 PCR amplification product of Kappa gene.
FIG. 4 PCR amplification product of Lamda gene.
FIG. 5 PCR amplification product of scFv gene.
FIG. 6 library size of single chain antibody gene library construction.
FIG. 7 anti-feline herpesvirus phage antibody binding activity.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
In view of the problems of the prior art, the present invention provides a viral antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and applications thereof, and the present invention is described in detail below with reference to the accompanying drawings.
The virus antibody sequence provided by the invention is a heavy chain variable region amino acid sequence SEQ ID NO: 1 and the nucleotide sequence SEQ ID NO: 3; light chain variable region amino acid sequence SEQ ID NO: 2 and the nucleotide sequence SEQ ID NO: 4.
as shown in FIG. 1, the method for screening virus antibody sequences provided by the invention comprises the following steps:
s101: preparing a phage antibody;
s102: panning of a phage antibody library;
s103: identifying a cat source Phage single-chain antibody of the anti-feline herpesvirus by a Phage ELISA method;
s104: sequencing scFv bacterial liquid with positive Phage ELISA identification result by sequencing company to obtain the variable region sequences of heavy chain and light chain of the gene engineering antibody of the feline herpes virus resistance.
The technical solution of the present invention is further described with reference to the following specific examples.
Example 1 construction of a library of feline-derived anti-feline herpesvirus single-chain antibodies
1. Isolation of feline peripheral blood lymphocytes
Vaccine immunization was performed on 5 experimental cats according to the international manual on animal immunization. The immunization was performed 3 times with 2 weeks interval. 2 weeks after 3 immunizations, cat peripheral blood was collected. 5-10mL of fresh blood is taken to be uniformly mixed with the whole blood and the tissue diluent in a ratio of 1:1-1: 2. Cell separation medium was added to a 15mL centrifuge tube and an equal volume of diluted anticoagulated blood was gently added along the tube wall. The horizontal centrifuge centrifuges at a rotation speed of 400g-800g for 15min-25min, after centrifugation, the liquid in the centrifuge tube is divided into four layers which are respectively from top to bottom: a first layer: a plasma layer; a second layer: a layer of lymphocytes; and a third layer: separation liquid and fourth layer: red blood cell layer. Carefully pipette the second layer of opalescent lymphocytes into another 15mL centrifuge tube, add 10mL of wash solution, mix well, centrifuge at 250g for 10 min. Repeat 2-3 times, abandon the supernatant. The lymphocyte at the bottom of the tube is resuspended by a freezing medium containing 90 percent fetal calf serum, 10 percent DMSO and 1 percent double antibody, the mixture is subpackaged into 2mL freezing tubes, the freezing tubes are placed for 30min at 4 ℃, the freezing tubes are placed for 2h at-20 ℃, the freezing tubes are placed overnight at-80 ℃, and the lymphocyte is frozen and stored in the liquid nitrogen sequentially the next day.
2. Extraction of total RNA from cat peripheral blood lymphocytes
The PBMC in the frozen tube were transferred to a 1.5mL centrifuge tube at 1800rpm, centrifuged for 5min, and the supernatant discarded. 50-100. mu.L of the supernatant was left at the bottom of the centrifuge tube and the tube bottom cells were resuspended. Adding 1mL Trizol, repeatedly and uniformly blowing by using a pipette gun, and incubating for 5min to room temperature. Adding 0.2mL chloroform, shaking vigorously by hand for 15s, incubating at room temperature for 2-3min, and centrifuging at 12000rpm and 4 deg.C for 15min in a refrigerated centrifuge, wherein the liquid can be divided into lower organic phase containing DNA and protein, and upper transparent layer containing RNA. The centrifuge tube was tilted 45 degrees and the clear layer was transferred to another 1.5mL centrifuge tube. Adding 0.5mL of isopropanol, mixing, incubating at room temperature for 10min, centrifuging at 12000rpm for 10min, and discarding the supernatant. 1mL of 75% ethanol was added and washed with a vortex shaker at 7500rpm, 4 ℃ and centrifuged for 5min, and the supernatant was discarded. Placing the centrifuge tube on a clean bench, standing for 5-10min, taking care not to dry RNA, resuspending and dissolving with at least 30 μ L DEPC water, measuring concentration and A with ultramicro spectrophotometer260And A280The ratio was stored at-80 ℃.
3. Cat heavy chain variable region (V)H) And light chain variable region (V)L) Amplification of
Using extracted total RNA as template and PrimeScriptTMII 1st Strand cDNA Synthesis Kit reverse transcription of total RNA into cDNA. Taking it as a template, the primer sequence SEQ ID NO: 5, VH and VL genes were PCR amplified. Preparing 1.5% agarose gel, detecting and identifying by nucleic acid electrophoresis, observing the result in a gel imager, recovering gel, and purifying V HAnd VLAnd (3) fragment. The heavy chain variable region gene V is processed by a SOE-PCR gene engineering method by using a primer of a LinkerHRespectively linked with light chain variable region gene VL(Lamda), light chain variable region Gene VL(Kappa) Assembly of scFv genes to form VL-linker-VHIn the form of (1). Preparing 1.0% agarose gel, observing the result in a gel imager, recovering the gel, and purifying the scFv gene fragment. And carrying out enzyme digestion and connection on the purified scFv gene product and a phage vector pComb3 XSS.
4. Construction of Single chain antibody library
20 μ L of the ligation product was transformed with 80 μ L of electrically competent XLI-Blue by electroporation at 2.5KV and 800 Ω, the cuvette was rinsed with 1mLSOC medium, and the liquid was pipetted into a 50mL centrifuge tube at 220rpm/min, 37 ℃ and 45min for shaking. mu.L, 50. mu.L and 100. mu.L of the bacterial suspension were applied to a plate containing Amp + (100. mu.g/mL), respectively, and the electrotransfer effect was determined. 9mL of LB liquid medium containing Amp + (100. mu.g/mL) were added to the centrifuge tube at a rate of 1:1000 adding glucose (1mol/L), 220rpm/min, 37 deg.C, shaking to OD6000.5. Add 20 u L helper phage M13K07 for rescue, infected 30min later shake bacteria for 1 h. The bacterial liquid was centrifuged at 3000rpm for 6min, the supernatant was discarded, and IPTG (1mol/L) was added at 1:1000 in an equal volume of LB liquid medium containing Amp + (100. mu.g/mL) and Kana (50. mu.g/mL), at 220rpm/min, at 37 ℃ and the bacteria were shaken for 6 h. The medium was centrifuged at 12000rpm/min for 10-20min, and the supernatant was collected. PEG8000 was added at a ratio of 1:4-1:5, and the mixture was mixed by inversion, whereupon a cloudy precipitate appeared, which was cooled to 4 ℃ in a refrigerator overnight. Centrifuging at 12000rpm for 10min, collecting precipitate, re-suspending the precipitate with 1.5mL1 XPBS (pH7.4), adding PEG8000 at a ratio of 1:4-1:5, reversing, and cooling to 4 deg.C for 2-3 hr at 12000rp And m, centrifuging for 10min, collecting precipitate, resuspending the precipitate with 300 μ L of 1 × PBS (pH7.4), adding 50% glycerol, mixing, and storing at-20 deg.C. The library is built for many times according to the method, and the original library of the scFv phage antibody is built.
Example 2 screening of library of feline-derived anti-feline herpesvirus Single chain antibodies
1. Preparation of phage antibodies
Adding 1mL of phage primary antibody library into 3mL of XLI-Blue bacterial liquid with OD600 equal to 0.5, standing at 37 ℃ for 45min, adding 6mL of LB liquid culture medium containing Amp + (100 mu g/mL), adding glucose (1mol/L) according to a ratio of 1:1000, continuing to culture, adding helper phage M13K07 when the bacterial liquid OD600 is equal to 0.5, standing at 37 ℃ in an incubator to infect for 30min, then culturing at 220rpm/min, culturing at 37 ℃ for 1h, centrifuging the bacterial liquid at 3500rpm for 10min, discarding supernatant, adding LB liquid culture medium containing Amp + (100 mu g/mL) and Kana (50 mu g/mL) in an equal volume, adding G (1mol/L), 220rpm/min, and shaking at 37 ℃ for 6 h. The medium was centrifuged at 12000rpm for 10-20min, and the supernatant was collected. PEG8000 was added at a ratio of 1:4-1:5, and the mixture was mixed by inversion, whereupon a cloudy precipitate appeared, which was cooled to 4 ℃ in a refrigerator overnight. Centrifuging at 12000rpm for 10min, collecting precipitate, re-suspending the precipitate with 1.5mL of 1 XPBS (pH7.4), adding PEG8000 at a ratio of 1:4-1:5, uniformly inverting, centrifuging at 12000rpm for 10min at 4 deg.C for 2-3h, collecting precipitate, re-suspending the precipitate with 300 μ L of 1 XPBS (pH7.4), calculating the amount of phage input into the elutriation sieve, and waiting for elutriation.
2. Panning of phage antibody libraries
(1) Coating: with 0.1M NaHCO3The purified feline herpesvirus was diluted to different concentrations of 2. mu.g/mL, 4. mu.g/mL and 8. mu.g/mL, coated on 96-well microtiter plates, 100. mu.L per well, and left to stand in a refrigerator at 4 ℃ overnight. After coating, discarding the liquid in the enzyme label plate with 96 holes, adding 100 mu L washing buffer solution PBST into each hole, and washing for 3 times;
(2) and (3) sealing: adding 250 mu L of sealing liquid into each hole, and sealing in a 37 ℃ incubator for 2 h;
(3) washing: add 100. mu.L PBST per well and wash 3 times in total. Washing each time, shaking for 1min at 400rpm by using a plate shaking instrument, vertically rotating the ELISA plate for one circle, and infiltrating the tube wall;
(4) adding a phage antibody: adding phage antibody into 100 μ L of each well, shaking at 400rpm/min for 5min, and incubating at room temperature for 1 h;
(5) washing: repeating the step (3);
(6) and (3) elution: stop solution was added at 50. mu.L per well and shaken at 1000rpm for 5min in a plate shaker. Each 400. mu.L of eluate was neutralized with 75. mu.L of Tris-HCl. mu.L of this liquid was added to 180. mu.L of competent cells with OD600 ═ 0.5, infected for 20min, and 20. mu.L of the bacterial suspension was spread on an LB plate containing Amp + (100. mu.g/mL), cultured overnight at 37 ℃ and the amount of phage pool exported was calculated. Picking monoclonal colony shake bacteria, carrying out PCR identification, and sequencing;
(7) Adding 3mL of OD into 90% of the total amount of the primary phage antibody library600In competent cells (0.5), after infection for 30min, 6mL of LB liquid was added, and ampicillin was added at a final concentration of 100. mu.g/mL and glucose (1M/L) was added at a rate of 1: 1000. OD of bacterial liquid to be treated600When the culture medium is equal to 0.5, 4 multiplied by 1010 helper phage M13K07 is added, after standing and incubation for 30min, shaking culture is carried out for 1h at 220rpm/min, centrifugation is carried out for 6min at 3500rpm/min, supernatant is discarded, the precipitate is resuspended by using LB liquid culture medium containing Amp + (100 mu g/mL) and Kana (50 mu g/mL) in the same volume, and shaking culture is carried out at 37 ℃ and 220rpm/min overnight; the medium was centrifuged at 12000rpm for 10-20min, and the supernatant was collected. PEG8000 was added at a ratio of 1:4-1:5, and the mixture was mixed by inversion, whereupon a cloudy precipitate appeared, which was cooled to 4 ℃ in a refrigerator overnight. Centrifuging at 12000rpm for 10min, collecting the precipitate, resuspending the precipitate with 1.5mL of 1 XPBS (pH7.4), adding PEG8000 again at a ratio of 1:4-1:5, inverting, centrifuging at 12000rpm for 10min at 4 deg.C for 2-3h, collecting the precipitate, and resuspending the precipitate with 300 uL of 1 XPBS (pH7.4) to obtain the first round of single chain antibody library.
(8) And performing 3-4 rounds of phage panning, and calculating the input and output phage library amount each time. And the final round of phage library was added to 50% glycerol and stored in a-80 ℃ freezer.
Identification of cat-derived Phage single-chain antibody against feline herpesvirus by Phage ELISA method
(1) Coating: the purified feline herpesvirus was treated with 0.1M NaHCO3Diluting to 8 mu g/mL coated 96-well enzyme label plate, setting BSA as a blank control, and setting M13K07 as a negative control;
(2) and (3) sealing: discarding the coating solution in a 96-well enzyme label plate, and incubating for 2h at 37 ℃ with 200 mu L of confining liquid in each well;
(3) washing: adding 200 μ L PBST into each well, washing for 3 times, and patting to dry;
(4) adding a phage single-chain antibody: 1:1 mixing phage single-chain antibody and PBST, adding 200 mu L of phage single-chain antibody into a 96-well enzyme label plate, and incubating for 2h at room temperature;
(5) washing: the same step (3);
(6) applying a second antibody: diluting an HRP-labeled anti-M13 antibody at a ratio of 1:5000, and incubating at 37 ℃ for 1 h;
(7) washing: the same step (3);
(8) color development: adding 50 μ L of TMB color developing solution into each well, covering with tinfoil paper, and reacting at 37 deg.C for 10 min;
(9) and (4) terminating: 50 μ L of 2mol/L H was added to each well2SO4Stopping the reaction, and detecting OD by an enzyme-linked immunosorbent assay450Numerical values.
Sequencing scFv bacterial liquid with positive Phage ELISA identification result by sequencing company to obtain the variable region sequences of heavy chain and light chain of the gene engineering antibody of the feline herpes virus resistance.
SEQ ID NO: 1: heavy chain variable region amino acid sequence
Asp Val Gln Leu Val Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Gly
Ser Leu Arg Leu Thr Cys Val Ala Ser Gly Phe Thr Phe Ser Ser Tyr
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Gln Trp Val
Ala Ala Ile Ser Tyr Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr
Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Thr Tyr Tyr Cys
Ala Lys Tyr Gly Tyr Cys Ile Gly Ser Ser Cys Val Pro His Phe Asp
Tyr Trp Gly Gln Gly Ala Leu Val Thr Val Ser Ser
SEQ ID NO: 2: light chain variable region amino acid sequence
Asp Val Met Met Ala Gln Thr Pro Leu Ser Leu Ala Val Thr Pro Gly
Glu Ser Ala Ser Ile Ser Cys Arg Ala Ser Gln Ser Leu Leu Asn Ser
Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
Pro Arg Leu Leu Ile Tyr Arg Val Ser Asn Arg Ala Ser Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile
Ser Arg Val Glu Ala Asp Asp Val Gly Val Tyr Tyr Cys Gln Gln Gly
Thr His Thr Pro Thr Thr Phe Gly Gln Gly Thr His Leu Glu Ile Ala
SEQ ID NO: 3: heavy chain variable region nucleotide sequence
gacgtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactcacctgtgtagcctctggatt
caccttcagtagctatgacatgagctgggtccgccaggctccagggaaggggctgcagtgggtcgcagcaattagttata
atggaggtagcacaggctacgcagactccgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtat
ctgcagatgaacagcctgaagaccgaggacacggccacatattactgtgcgaaatacggctactgtatcgggagtagctg
tgtcccccactttgactactggggccaaggagccctggtgacggtgtcctcag
SEQ ID NO: 4: light chain variable region nucleotide sequence
gatgtcatgatggcgcagacccctctgtccctggccgtcacccctggagagtcggcctcaatctcctgcagggccagtca
gagcctcctgaacagtaatggaaacacctatttacattggtacctgcagaagccaggccagtctccacggctcctgatct
atagggtttccaaccgggcctctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc
agcagggtggaggctgacgacgtcggagtttattactgccaacaaggtacacatactccgaccacctttggccaagggac
acatctggagattgcac
SEQ ID NO: 5: upstream primer for amplifying cat heavy chain variable region
ggtggttcctctagatcttcc ctgcacgtcgaccac
ggtggttcctctagatcttcc gttgaatgtgaagcc
ggtggttcctctagatcttcc gtccaaaacgaccac
ggtggttcctctagatcttcccaatggactggagctggagaatcc
ggtggttcctctagatcttccatggagtttgtgctgggctgggttttcct
ggtggttcctctagatcttccatcacygkavaacgccatcctcttccaga
Downstream primer for amplifying cat heavy chain variable region
acctggccggcctggcctggttgttgaccacactgttgttctt
acctggccggcctggcctggttgttgaccacactgttgttctt
acctggccggcctggcccgtggtggaggctgaggacaccgtca
acctggccggcctggcc ggctccttggcccca
SEQ ID NO: 6: amplification of cat light chain (Kappa) upstream primer
atagggcccaggcggcc ctacagcactactgc
atagggcccaggcggcc tcacaccacgactgc
atagggcccaggcggcc cgctagtgctactgc
atagggcccaggcggccgttcagcttctcaaaatgaggttccctgct
Downstream primer for amplifying cat light chain (Kappa)
ggaagatctagaggaaccaccatatgcacacgatagaggcacttcctgtat
ggaagatctagaggaaccacc cgtccccaggccgaa
SEQ ID NO: 7: amplification of cat light chain (lamda) upstream primer
atagggcccaggcggcc gtcagatccgactga
atagggcccaggcggcc gtcagacacgactga
atagggcccaggcggcc gtcagacgggactta
atagggcccaggcggcc gtcagccccgactga
atagggcccaggcggcc ccagtcagccccggc
atagggcccaggcggcc aggatacacgactga
atagggcccaggcggcc cggatacacaactga
atagggcccaggcggcc aggtcactccactga
atagggcccaggcggcc gtcggacacgactgg
Downstream primer for amplifying cat light chain (lamda)
ggaagatctagaggaaccaccggtccctccgccgaa
Demonstration part (/ experiment/simulation can prove the inventive front experimental data, etc.)
The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> Qingdao bonong Gene bioengineering Co., Ltd
<120> virus antibody sequence, tetrapeptide chain molecule, immunoglobulin molecule and application
<160>7
<170>SIPOSequenceListing 1.0
<210>1
<211>124
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>1
Asp Val Gln Leu Val Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Gly
15 10 15
Ser Leu Arg Leu Thr Cys Val Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Gln Trp Val
35 40 45
Ala Ala Ile Ser Tyr Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Thr Tyr Tyr Cys
85 90 95
Ala Lys Tyr Gly Tyr Cys Ile Gly Ser Ser Cys Val Pro His Phe Asp
100 105 110
Tyr Trp Gly Gln Gly Ala Leu Val Thr Val Ser Ser
115 120
<210>2
<211>112
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>2
Asp Val Met Met Ala Gln Thr Pro Leu Ser Leu Ala Val Thr Pro Gly
1 5 10 15
Glu Ser Ala Ser Ile Ser Cys Arg Ala Ser Gln Ser Leu Leu Asn Ser
20 25 30
Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Arg Leu Leu Ile Tyr Arg Val Ser Asn Arg Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile
65 70 75 80
Ser Arg Val Glu Ala Asp Asp Val Gly Val Tyr Tyr Cys Gln Gln Gly
85 90 95
Thr His Thr Pro Thr Thr Phe Gly Gln Gly Thr His Leu Glu Ile Ala
100 105 110
<210>3
<211>373
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gacgtgcagc tggtggagtc tgggggagac ctggtgaagc ctggggggtc cctgagactc 60
acctgtgtag cctctggatt caccttcagt agctatgaca tgagctgggt ccgccaggct 120
ccagggaagg ggctgcagtg ggtcgcagca attagttata atggaggtag cacaggctac 180
gcagactccg tgaagggccg attcaccatc tccagagaca acgccaagaa cacgctgtat 240
ctgcagatga acagcctgaa gaccgaggac acggccacat attactgtgc gaaatacggc 300
tactgtatcg ggagtagctg tgtcccccac tttgactact ggggccaagg agccctggtg 360
acggtgtcct cag 373
<210>4
<211>337
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gatgtcatga tggcgcagac ccctctgtcc ctggccgtca cccctggaga gtcggcctca 60
atctcctgca gggccagtca gagcctcctg aacagtaatg gaaacaccta tttacattgg 120
tacctgcaga agccaggcca gtctccacgg ctcctgatct atagggtttc caaccgggcc 180
tctggggtcc cagacaggtt cagtggcagc gggtcaggga cagatttcac cctgagaatc 240
agcagggtgg aggctgacga cgtcggagtt tattactgcc aacaaggtac acatactccg 300
accacctttg gccaagggac acatctggag attgcac 337
<210>5
<211>414
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ggtggttcct ctagatcttc cctgcacgtc gaccacggtg gttcctctag atcttccgtt 60
gaatgtgaag ccggtggttc ctctagatct tccgtccaaa acgaccacgg tggttcctct 120
agatcttccc aatggactgg agctggagaa tccggtggtt cctctagatc ttccatggag 180
tttgtgctgg gctgggtttt cctggtggtt cctctagatc ttccatcacy gkavaacgcc 240
atcctcttcc agaacctggc cggcctggcc tggttgttga ccacactgtt gttcttacct 300
ggccggcctg gcctggttgt tgaccacact gttgttctta cctggccggc ctggcccgtg 360
gtggaggctg aggacaccgt caacctggcc ggcctggccg gctccttggc ccca 414
<210>6
<211>230
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
atagggccca ggcggcccta cagcactact gcatagggcc caggcggcct cacaccacga 60
ctgcataggg cccaggcggc ccgctagtgc tactgcatag ggcccaggcg gccgttcagc 120
ttctcaaaat gaggttccct gctggaagat ctagaggaac caccatatgc acacgataga 180
ggcacttcct gtatggaaga tctagaggaa ccacccgtcc ccaggccgaa 230
<210>7
<211>324
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
atagggccca ggcggccgtc agatccgact gaatagggcc caggcggccg tcagacacga 60
ctgaataggg cccaggcggc cgtcagacgg gacttaatag ggcccaggcg gccgtcagcc 120
ccgactgaat agggcccagg cggccccagt cagccccggc atagggccca ggcggccagg 180
atacacgact gaatagggcc caggcggccc ggatacacaa ctgaataggg cccaggcggc 240
caggtcactc cactgaatag ggcccaggcg gccgtcggac acgactgggg aagatctaga 300
ggaaccaccg gtccctccgc cgaa 324
Claims (10)
1. A feline herpesvirus virus antibody sequence, wherein the virus antibody sequence is a heavy chain variable region amino acid sequence of SEQ ID NO: 1 and the nucleotide sequence SEQ ID NO: 3; light chain variable region amino acid sequence SEQ ID NO: 2 and the nucleotide sequence SEQ ID NO: 4.
2. a tetrapeptide chain molecule formed from the heavy and light chains of the viral antibody sequence of claim 1 linked by disulfide bonds.
3. An immunoglobulin molecule comprising the tetrapeptide chain molecule of claim 2.
4. A method for detecting a feline herpesvirus using the virus antibody sequence of claim 1.
5. A process for preparing a monoclonal antibody against feline herpesvirus comprising using the virus antibody sequence of claim 1.
6. A method of screening for feline herpesvirus virus antibody sequences as described in claim 1, wherein said method of screening for viral antibody sequences comprises:
firstly, preparing a phage antibody;
Step two, panning of a phage antibody library;
thirdly, identifying the cat source Phage single-chain antibody of the anti-feline herpesvirus by a Phage ELISA method;
and fourthly, sequencing the scFv bacterial liquid with positive Phage ELISA identification result by a sequencing company to obtain the variable region sequences of the heavy chain and the light chain of the gene engineering antibody of the feline herpesvirus.
7. The method for screening viral antibody sequences according to claim 6, wherein the first step comprises: adding 1mL of phage primary antibody library into 3mL of XLI-Blue bacterial liquid with OD600 equal to 0.5, standing at 37 ℃ for 45min, adding 6mL of LB liquid culture medium containing Amp + (100 mu g/mL), adding glucose according to a ratio of 1:1000, continuing to culture, adding helper phage M13K07 when the bacterial liquid OD600 is equal to 0.5, standing at 37 ℃ in an incubator for 30min, culturing at 37 ℃ for 1h at 220rpm/min, centrifuging the bacterial liquid at 3500rpm for 10min, discarding supernatant, adding IPTG (1mol/L) and Kana (50 mu g/mL) into LB liquid culture medium with the same volume of Amp + (100 mu g/mL) and Kana (50 mu g/mL), adding IPTG (1mol/L), at 220rpm/min, and shaking at 37 ℃ for 6 h; centrifuging the culture medium at 12000rpm for 10-20min, collecting supernatant, adding PEG8000 at 1:4-1:5, mixing, adding PEG8000 at 4 deg.C overnight, centrifuging at 12000rpm for 10min, collecting precipitate, resuspending the precipitate with 1.5mL of 1 XPBS, adding PEG8000 at 1:4-1:5, homogenizing, centrifuging at 4 deg.C for 2-3h at 12000rpm for 10min, collecting precipitate, resuspending the precipitate with 300 μ L of 1 XPBS, calculating the phage amount input into the sieve, and selecting.
8. The method for screening viral antibody sequences according to claim 6, wherein the second step comprises:
(1) coating: with 0.1M NaHCO3Diluting the purified feline herpesvirus into 96-hole enzyme-labeled plates with different concentrations of 2 mug/mL, 4 mug/mL and 8 mug/mL, wherein each hole is 100 mug L, and placing the plates in a refrigerator at 4 ℃ for overnight; after coating, discarding the liquid in the enzyme label plate with 96 holes, adding 100 mu L washing buffer solution PBST into each hole, and washing for 3 times;
(2) and (3) sealing: adding 250 mu L of sealing liquid into each hole, and sealing in a 37 ℃ incubator for 2 h;
(3) washing: add 100. mu.L PBST per hole, wash 3 times totally; washing each time, shaking for 1min at 400rpm by using a plate shaking instrument, vertically rotating the ELISA plate for one circle, and infiltrating the tube wall;
(4) adding a phage antibody: adding phage antibody into 100 μ L of each well, shaking at 400rpm/min for 5min, and incubating at room temperature for 1 h;
(5) washing: repeating the step (3);
(6) and (3) elution: adding 50 mu L of stop solution into each well, shaking the plate shaking instrument at 1000rpm for 5min, adding 75 mu L of LTris-HCL into each 400 mu L of eluent for neutralization, adding 20 mu L of the liquid into 180 mu L of competent cells with OD600 equal to 0.5, infecting for 20min, coating 20 mu L of bacterial solution on an LB plate containing Amp + (100 mu g/mL), culturing at 37 ℃ overnight, calculating the output quantity of phage library, picking up monoclonal colony shake bacteria, carrying out PCR identification and sending for sequencing;
(7) Adding 3mL of OD into 90% of the total amount of the primary phage antibody library600In competent cells of 0.5, after infection for 30min, 6mL of LB liquid was added, and ampicillin was added to a final concentration of 100 μ g/mL and glucose was added at a ratio of 1: 1000; OD of bacterial liquid to be treated600When the culture medium is equal to 0.5, 4 multiplied by 1010 helper phage M13K07 is added, after standing and incubation for 30min, shaking culture is carried out for 1h at 220rpm/min, centrifugation is carried out for 6min at 3500rpm/min, supernatant is discarded, the precipitate is resuspended by using LB liquid culture medium containing Amp + (100 mu g/mL) and Kana (50 mu g/mL) in the same volume, and shaking culture is carried out at 37 ℃ and 220rpm/min overnight; centrifuging the culture medium at 12000rpm for 10-20min, and collecting the supernatant; adding PEG8000 into the mixture at a ratio of 1:4-1:5, reversing and mixing uniformly, wherein a cloudy precipitate appears at the moment, centrifuging the mixture for 10min at 12000rpm after the mixture is cooled to 4 ℃ in a refrigerator, collecting the precipitate, re-suspending the precipitate with 1.5mL of 1 XPBS, adding PEG8000 into the mixture again according to a ratio of 1:4-1:5, reversing uniformly, centrifuging the mixture for 10min at 12000rpm after the mixture is cooled to 4 ℃ in a refrigerator for 2-3h, collecting the precipitate, and re-suspending the precipitate with 300 mu L of 1 XPBS to obtain a first round of single-chain antibody library;
(8) performing 3-4 rounds of phage panning, calculating the amount of phage library input and output each time, adding 50% glycerol into the phage library in the last round, and storing in a refrigerator at-80 deg.C.
9. The method for screening viral antibody sequences according to claim 6, wherein said third step comprises:
(1) coating: the purified feline herpesvirus was treated with 0.1M NaHCO3Diluting to 8 mu g/mL coated 96-well enzyme label plate, setting BSA as a blank control, and setting M13K07 as a negative control;
(2) and (3) sealing: discarding the coating solution in a 96-well enzyme label plate, and incubating for 2h at 37 ℃ with 200 mu L of confining liquid in each well;
(3) washing: adding 200 μ L PBST into each well, washing for 3 times, and patting to dry;
(4) adding a phage single-chain antibody: 1:1 mixing phage single-chain antibody and PBST, adding 200 mu L of phage single-chain antibody into a 96-well enzyme label plate, and incubating for 2h at room temperature;
(5) washing: the same step (3);
(6) applying a second antibody: diluting an HRP-labeled anti-M13 antibody at a ratio of 1:5000, and incubating at 37 ℃ for 1 h;
(7) washing: the same step (3);
(8) color development: adding 50 μ L of TMB color developing solution into each well, covering with tinfoil paper, and reacting at 37 deg.C for 10 min;
(9) and (4) terminating: 50 μ L of 2mol/L H was added to each well2SO4Stopping the reaction, and detecting OD by an enzyme-linked immunosorbent assay450Numerical values.
10. The method for screening viral antibody sequences according to claim 6, wherein the construction of said library of feline-derived anti-feline herpesvirus single chain antibodies comprises:
(1) separating peripheral blood lymphocytes of cats, performing vaccine immunization on 5 experimental cats, wherein each immunization is separated by 2 weeks, 3 times of immunization is performed, 2 weeks after 3 times of immunization, 5-10mL of fresh blood is uniformly mixed with whole blood and tissue diluent in a ratio of 1:1-1:2, adding cell separating medium into a 15mL centrifugal tube, slightly adding diluted anticoagulation blood with the same volume along the tube wall, centrifuging by a horizontal centrifuge at a rotation speed of 400-800 g for 15-25 min, and after centrifuging, dividing the liquid in the centrifugal tube into four layers which are respectively from top to bottom: a first layer: a plasma layer; a second layer: a layer of lymphocytes; and a third layer: separation liquid and fourth layer: sucking a second layer of milky lymphocytes into another 15mL centrifuge tube carefully by using a pipette, adding 10mL of cleaning solution for uniformly mixing, centrifuging for 10min at 250g, repeating for 2-3 times, discarding supernatant, resuspending the lymphocytes at the bottom of the tube by using cryopreservation solution containing 90% fetal calf serum, 10% DMSO and 1% double antibody, subpackaging the above suspension into 2mL cryopreservation tubes, placing the above cryopreservation tubes in a refrigerator at 4 ℃ for 30min, placing the above cryopreservation tubes in a refrigerator at-20 ℃ for 2h, placing the above cryopreservation tubes in a refrigerator at-80 ℃ overnight, and transferring the above cryopreservation tubes to liquid nitrogen sequentially for cryopreservation lymphocytes on the next day;
(2) Extracting total RNA of cat peripheral blood lymphocytes, transferring PBMC in a freezing tube into a 1.5mL centrifuge tube, centrifuging for 5min at 1800rpm, discarding supernatant, leaving 50-100 μ L of supernatant at the bottom of the centrifuge tube, resuspending tube bottom cells, adding 1mL Trizol, repeatedly blowing and beating uniformly by a pipette gun, incubating at room temperature for 5min, adding 0.2mL chloroform, shaking vigorously by hand for 15s, incubating at room temperature for 2-3min, centrifuging at 12000rpm at 4 ℃ for 15min by a refrigerated centrifuge, wherein the liquid can be divided into an organic phase containing DNA and protein at the lower layer and a transparent layer containing RNA at the upper layer, inclining at 45 degrees, transferring the transparent layer into another 1.5mL centrifuge tube, adding 0.5mL isopropanol, mixing, incubating at room temperature for 10min, centrifuging at 12000rpm for 10min, discarding supernatant, adding 1mL 75% ethanol, washing by a vortex oscillator, 7500rpm, 4 ℃, 5min, discarding supernatant, placing the centrifuge tube on a clean bench, standing for 5-10min, resuspending and dissolving with at least 30 μ L DEPC water, measuring concentration and A with ultramicro spectrophotometer260And A280The ratio is preserved at minus 80 ℃;
(3) cat heavy chain variable region VHAnd light chain variable region VLThe amplification of (1) was performed using PrimeScript using the extracted total RNA as a templateTMII 1st Strand cDNA Synthesis Kit reverse transcription of total RNA into cDNA, PCR amplification of V using it as template HGenes and VLPreparing 1.5% agarose gel for nucleic acid electrophoresis detection and identification, observing the result in a gel imager, recovering gel, and purifying VHAnd VLFragment, using primer of Linker to make heavy chain variable region gene V by SOE-PCR gene engineering methodHRespectively linked with light chain variable region gene VLLight chain variable region gene VLAssembly into scFv genes to form VL-linker-VHForm (1.0%) agaroseGel, observing the result in a gel imager, recovering the gel, purifying the scFv gene fragment, and carrying out enzyme digestion and connection on the purified scFv gene product and a phage vector pComb3 XSS;
(4) constructing a single-chain antibody library, performing electric shock transformation on 20 mu L of the ligation product and 80 mu L of electrotransformation competent XLI-Blue under the conditions of 2.5KV and 800 omega, washing an electric rotating cup by using 1mLSOC culture medium, sucking the liquid into a 50mL centrifuge tube, rotating at 220rpm/min and 37 ℃, shaking the bacteria for 45min, respectively coating 10 mu L, 50 mu L and 100 mu L of bacteria liquid on a plate containing Amp + (100 mu g/mL), identifying the electrotransformation effect, adding 9mL of LB liquid culture medium containing Amp + (100 mu g/mL) into the centrifuge tube, and performing electric shock transformation on the mixture by using a reaction solution prepared by mixing the following components in a ratio of 1:1000 adding glucose, 220rpm/min, 37 ℃, shaking to OD6000.5, adding 20 mul of helper phage M13K07 for rescue, shaking the bacteria for 1h after infecting for 30min, centrifuging the bacteria liquid at 3000rpm for 6min, discarding the supernatant, adding IPTG (isopropyl thiogalactoside) at 1:1000, 220rpm/min, 37 ℃ and shaking the bacteria for 6h with an LB liquid culture medium containing Amp + (100 mug/mL) and Kana at equal volume, centrifuging the culture medium at 12000rpm for 10-20min, collecting the supernatant, adding PEG8000 at 1:4-1:5, reversing and mixing uniformly, wherein the cloudy precipitate appears, centrifuging at 4 ℃ overnight at 12000rpm for 10min, collecting the precipitate, resuspending the precipitate with 1.5mL1 XPBS, adding PEG8000 at the ratio of 1:4-1:5 again, reversing uniformly, refrigerating at 4 ℃ for 2-3h, 12000rpm, centrifuging for 10min, collecting the precipitate, resuspending the precipitate with 300 mul 1 XPBS, adding 50% glycerol, standing and storing at-20 ℃, the library is built for many times according to the method, and the original library of the scFv phage antibody is built.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010663713.1A CN111848785B (en) | 2020-07-10 | 2020-07-10 | Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010663713.1A CN111848785B (en) | 2020-07-10 | 2020-07-10 | Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules |
Publications (2)
Publication Number | Publication Date |
---|---|
CN111848785A true CN111848785A (en) | 2020-10-30 |
CN111848785B CN111848785B (en) | 2022-09-06 |
Family
ID=72982921
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010663713.1A Active CN111848785B (en) | 2020-07-10 | 2020-07-10 | Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111848785B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114634564A (en) * | 2022-04-18 | 2022-06-17 | 北京华驰千盛生物科技有限公司 | Triple egg yolk antibody for cat, preparation method and application |
CN116284350A (en) * | 2023-05-06 | 2023-06-23 | 泰州博莱得利生物科技有限公司 | Cat herpesvirus monoclonal antibody, and preparation method and application thereof |
Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK301675A (en) * | 1975-07-03 | 1977-01-04 | Philips N V | |
FR2829498A1 (en) * | 2001-09-11 | 2003-03-14 | Merial Sas | New polynucleotide encoding feline insulin-like growth factor-1, useful as adjuvant for vaccines, specifically against feline immune deficiency or leukemia viruses |
US20040166544A1 (en) * | 2003-02-13 | 2004-08-26 | Morton Phillip A. | Antibodies to c-Met for the treatment of cancers |
CN103957932A (en) * | 2011-07-20 | 2014-07-30 | 梅里亚有限公司 | Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene |
CN106279414A (en) * | 2016-08-31 | 2017-01-04 | 天津医科大学总医院 | Humanized's anti-amylin antibody and preparation method thereof |
CN106978511A (en) * | 2017-05-15 | 2017-07-25 | 青岛农业大学 | A kind of method for detecting feline herpetovirus |
CN108659124A (en) * | 2018-05-24 | 2018-10-16 | 青岛博隆基因工程有限公司 | A kind of single-chain antibody of porcine epidemic diarrhea resisting virus and its application |
CN110283246A (en) * | 2019-06-20 | 2019-09-27 | 长春西诺生物科技有限公司 | A kind of cat source genetic engineering antibody of anti-feline panleucopenia virus |
-
2020
- 2020-07-10 CN CN202010663713.1A patent/CN111848785B/en active Active
Patent Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK301675A (en) * | 1975-07-03 | 1977-01-04 | Philips N V | |
FR2829498A1 (en) * | 2001-09-11 | 2003-03-14 | Merial Sas | New polynucleotide encoding feline insulin-like growth factor-1, useful as adjuvant for vaccines, specifically against feline immune deficiency or leukemia viruses |
US20040166544A1 (en) * | 2003-02-13 | 2004-08-26 | Morton Phillip A. | Antibodies to c-Met for the treatment of cancers |
CN103957932A (en) * | 2011-07-20 | 2014-07-30 | 梅里亚有限公司 | Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene |
CN106279414A (en) * | 2016-08-31 | 2017-01-04 | 天津医科大学总医院 | Humanized's anti-amylin antibody and preparation method thereof |
CN106978511A (en) * | 2017-05-15 | 2017-07-25 | 青岛农业大学 | A kind of method for detecting feline herpetovirus |
CN108659124A (en) * | 2018-05-24 | 2018-10-16 | 青岛博隆基因工程有限公司 | A kind of single-chain antibody of porcine epidemic diarrhea resisting virus and its application |
CN110283246A (en) * | 2019-06-20 | 2019-09-27 | 长春西诺生物科技有限公司 | A kind of cat source genetic engineering antibody of anti-feline panleucopenia virus |
Non-Patent Citations (3)
Title |
---|
MARIANNE RICHTER等: "猫疱疹病毒1型隐性感染猫二次感染后的临床、病毒学及免疫学参数", 《中国畜牧兽医》 * |
张继一等: "猫疱疹病毒1型gD基因的表达", 《黑龙江畜牧兽医》 * |
王延树等: "猫杯状病毒基因组结构与结构蛋白功能研究进展", 《中国兽药杂志》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114634564A (en) * | 2022-04-18 | 2022-06-17 | 北京华驰千盛生物科技有限公司 | Triple egg yolk antibody for cat, preparation method and application |
CN116284350A (en) * | 2023-05-06 | 2023-06-23 | 泰州博莱得利生物科技有限公司 | Cat herpesvirus monoclonal antibody, and preparation method and application thereof |
CN116284350B (en) * | 2023-05-06 | 2023-08-04 | 泰州博莱得利生物科技有限公司 | Cat herpesvirus monoclonal antibody, and preparation method and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN111848785B (en) | 2022-09-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113336846B (en) | Monoclonal antibody E11 against novel coronavirus SARS-CoV-2 | |
Meijer et al. | Isolation of human antibody repertoires with preservation of the natural heavy and light chain pairing | |
CN110964103B (en) | Canine-derived anti-canine parvovirus antibody, antibody library and construction method | |
Smith et al. | [15] Libraries of peptides and proteins displayed on filamentous phage | |
CN111848789B (en) | Single chain antibody for resisting SARS-COV-2 virus S protein and its use | |
CN109336979B (en) | Clostridium difficile glutamate dehydrogenase nano antibody, coding sequence, screening method and application thereof | |
CN111848785B (en) | Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules | |
Müller et al. | Generation and isolation of target-specific single-domain antibodies from shark immune repertoires | |
Finlay et al. | Optimized generation of high-affinity, high-specificity single-chain Fv antibodies from multiantigen immunized chickens | |
US20150276735A1 (en) | Aflatoxin m1 nanobody 2014afm-g2 | |
CN110551213A (en) | Anti-filovirus monoclonal neutralizing antibody and preparation method and application thereof | |
CN108017712A (en) | A kind of peptide backbone of shark antibody sources and its application | |
CN111909259A (en) | Feline parvovirus antibody sequence, tetrapeptide chain molecule, globulin molecule and application | |
McKitrick et al. | Identification of glycan-specific variable lymphocyte receptors using yeast surface display and glycan microarrays | |
CN105504053B (en) | A kind of Porcine epidemic diarrhea virus M protein-specific heavy chain antibody | |
CN111848788B (en) | Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules | |
Abi-Ghanem et al. | Phage display selection and characterization of single-chain recombinant antibodies against Eimeria tenella sporozoites | |
CN113173989B (en) | Anti-fibrin-2 antibody sequences, tetrapeptide chain molecules and immunoglobulin molecules | |
CN113150122B (en) | Preparation method of high-throughput whole rabbit source monoclonal antibody | |
CN110655572B (en) | Monoclonal antibody for resisting filovirus GP protein and application thereof | |
CN115975015A (en) | Peste des petits ruminants virus (PPRV) F protein nano antibody and preparation, purification and neutralization test method thereof | |
CN114409795A (en) | Nano antibody for detecting diazinon and application thereof | |
CN114085289B (en) | Construction method and application of semisynthetic single-domain antibody library | |
CN108794625A (en) | A kind of monoclonal antibody of anti-EV-D68 viruses and its preparation and application | |
Finlay et al. | Optimized generation of high-affinity, high-specificity single-chain Fv antibodies from multi-antigen immunized chickens |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |