CN111909259A - Feline parvovirus antibody sequence, tetrapeptide chain molecule, globulin molecule and application - Google Patents

Abstract

The invention belongs to the technical field of virus antibodies, and discloses a feline parvovirus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof, wherein the sequence is a heavy chain variable region amino acid sequence SEQ ID NO: 1 and the nucleotide sequence SEQ ID NO: 3; light chain variable region amino acid sequence SEQ ID NO: 2 and the nucleotide sequence SEQ ID NO: 4. the screening method of the sequence comprises the following steps: preparing a phage antibody; panning of a phage antibody library; identifying the anti-feline parvovirus feline phage single-chain antibody by a PhageELISA method; sequencing the scFv bacterial liquid with positive PhageELISA identification result by a sequencing company to obtain the variable region sequences of the heavy chain and the light chain of the gene engineering antibody of the feline parvovirus-resistant gene of the cat source. The invention provides support for constructing the caninized anti-feline parvovirus genetic engineering antibody with high affinity and low immunogenicity. Has important significance for promoting the development of the feline antibody drug.

Description

Feline parvovirus antibody sequence, tetrapeptide chain molecule, globulin molecule and application

Technical Field

The invention belongs to the technical field of virus antibodies, and particularly relates to a feline parvovirus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof.

Background

At present, Feline parvovirus (Feline panleukopharia virus) clinically shows symptoms such as vomiting and diarrhea, enteritis, high fever and the like, causes a drastic decrease in the number of leukocytes, and can be transmitted through respiratory tracts, digestive tracts, direct contact and the like. At present, feline parvovirus is mainly prevented, no specific treatment medicine is available, and symptomatic treatment, supportive therapy and the like are mostly adopted.

At present, the clinical treatment of feline parvovirus disease mainly relies on monoclonal antibodies, most of the commercially available antibodies are xenogeneic animal immune serum, although the feline parvovirus disease can protect young animals and adult animals from infection, continuous injection cannot be carried out, otherwise severe anaphylactic reaction can be caused, and animal death can be caused in severe cases. In addition, the traditional mouse-derived monoclonal antibody has stronger heterogeneity and immunogenicity to a non-mouse-derived antibody, and easily causes immunological rejection or anaphylactic reaction of a host when applied in vivo, so that the therapeutic effect of the mouse-derived monoclonal antibody is reduced, even serious consequences are generated in a diseased body, and the clinical application effect of the mouse-derived monoclonal antibody is greatly limited.

At present, the phage display technology is more and more widely applied, more humanized phage display antibody libraries are successfully constructed, and particularly, the development of some monoclonal antibody medicines enables the phage display technology to be better developed. At present, most of the immune phage libraries are constructed, and because the antibody level in an animal body is improved after immunization, the immune phage libraries are more favorable for screening antibodies aiming at specific antigens and have more advantages on subsequent diagnosis and treatment effects. At present, most of the monoclonal antibodies are monoclonal antibodies, and the phage antibody library aiming at the cat source avoids interference factors in the use process of the antibodies, and provides theoretical basis for the diagnosis of the feline parvovirus and the preparation of the therapeutic monoclonal antibodies.

Through the above analysis, the problems and defects of the prior art are as follows: at present, phage antibody libraries directed against feline sources have not been constructed.

The difficulty in solving the above problems and defects is: in order to obtain an antibody library with a certain scale, firstly, a complete set of antibody genes of organism origin are obtained by means of an RT-PCR technology, and at present, the reports about cat origin gene sequences are few, and multiple pairs of primer verification needs to be carried out on antibody light chain variable region sequences and antibody heavy chain variable region sequences.

The significance of solving the problems and the defects is as follows: is beneficial to screening the antibody aiming at the specific antigen and has more advantages on subsequent diagnosis and treatment effect.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a feline parvovirus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof.

The invention is realized in such a way that a feline parvovirus antibody sequence is a feline parvovirus antibody sequence having a heavy chain variable region amino acid sequence of SEQ ID NO: 1 and the nucleotide sequence SEQ ID NO: 3; light chain variable region amino acid sequence SEQ ID NO: 2 and the nucleotide sequence SEQ ID NO: 4.

it is another object of the invention to provide a tetrapeptide chain molecule formed by disulfide bonding of the heavy and light chains of the feline parvovirus antibody sequence.

It is another object of the present invention to provide an immunoglobulin molecule comprising said tetrapeptide chain molecule.

Another object of the present invention is to provide a method for detecting feline parvovirus using the feline parvovirus antibody sequence.

The invention also aims to provide a preparation method of the monoclonal antibody for treating the feline parvovirus, and the preparation method of the monoclonal antibody for treating the feline parvovirus uses the feline parvovirus antibody sequence.

Another object of the present invention is to provide a method for screening feline parvovirus antibody sequences, which comprises:

firstly, preparing a phage antibody;

step two, panning of a phage antibody library;

thirdly, identifying the cat source Phage single-chain antibody of the anti-feline parvovirus by a Phage ELISA method;

and fourthly, sequencing the scFv bacterial liquid with positive Phage ELISA identification result by a sequencing company to obtain the variable region sequences of the heavy chain and the light chain of the gene engineering antibody of the feline parvovirus resistance.

Further, the first step includes: adding 1mL of phage primary antibody library into 3mL of XLI-Blue bacterial liquid with OD600 equal to 0.5, standing at 37 ℃ for 45min, adding 6mL of LB liquid culture medium containing Amp + (100 mug/mL), adding glucose according to a ratio of 1:1000, continuing culture, adding helper phage M13K07 when the bacterial liquid OD600 is equal to 0.5, standing at 37 ℃ in an incubator for 30min, culturing at 37 ℃ at 220rpm/min, centrifuging at 37 ℃ for 1h, centrifuging at 3500rpm of bacterial liquid for 10min, discarding supernatant, adding IPTG (100 mug/mL) and Kana LB) in an equal volume, adding IPTG (isopropyl-beta-thiogalactopyranoside) at a ratio of 1:1000, 220rpm/min, shaking at 37 ℃ for 6h, centrifuging at 12000rpm for 10-20min, collecting supernatant, adding PEG8000 to 1:4-1:5, reversing, mixing uniformly, allowing cloud precipitation to appear, standing at 12000 ℃ in a refrigerator for 10min, collecting precipitate, centrifuging at 10mL of PBS by a ratio of 1:4-1:5, adding PEG8000 at a ratio of 1:4-1:5, reversing, centrifuging at 12000rpm for 10min in refrigerator at 4 deg.C for 2-3h, collecting precipitate, resuspending the precipitate with 300 μ L of 1 × PBS, calculating the amount of phage input into the elutriation sieve, and standing for elutriation.

Further, the second step includes:

(1) coating: with 0.1M NaHCO₃Diluting the purified feline parvovirus into a 96-well enzyme label plate coated with different concentrations of 2 mu g/mL, 4 mu g/mL and 8 mu g/mL, wherein each well is 100 mu L, placing the plate in a refrigerator at 4 ℃ overnight, discarding the liquid in the 96-well enzyme label plate after coating, adding 100 mu L of washing buffer PBST into each well, and washing for 3 times;

(2) and (3) sealing: adding 250 mu L of sealing liquid into each hole, and sealing in a 37 ℃ incubator for 2 h;

(3) washing: adding 100 mu L PBST into each hole, washing for 3 times, shaking for 1min at 400rpm by using a plate shaking instrument, vertically rotating the ELISA plate for one circle, and infiltrating the tube wall;

(4) adding a phage antibody: adding phage antibody into 100 μ L of each well, shaking at 400rpm/min for 5min, and incubating at room temperature for 1 h;

(5) washing: repeating the step (3);

(6) and (3) elution: adding 50 mu L of stop solution into each hole, shaking the plate shaking instrument at 1000rpm for 5min, adding 75 mu L of Tris-HCL into each 400 mu L of eluent for neutralization, adding 20 mu L of the liquid into 180 mu L of competent cells with OD600 equal to 0.5, infecting for 20min, coating 20 mu L of bacterial solution on an LB plate containing Amp + (100 mu g/mL), culturing at 37 ℃ overnight, calculating the output phage library amount, picking up a monoclonal colony, shaking the bacteria, carrying out PCR identification, and sending for sequencing;

(7) adding 3mL of OD into 90% of the total amount of the primary phage antibody library₆₀₀In competent cells (0.5), after infection for 30min, 6mL of LB liquid was added, ampicillin was added to the final concentration of 100. mu.g/mL, and glucose was added at a ratio of 1:1000 until OD of the bacterial liquid was reached₆₀₀When the culture medium is equal to 0.5, 4 multiplied by 1010 helper phage M13K07 is added, after standing and incubation for 30min, shaking culture is carried out for 1h at 220rpm/min, centrifugation is carried out for 6min at 3500rpm/min, supernatant is discarded, the precipitate is resuspended by using LB liquid culture medium containing Amp + (100 mu g/mL) and Kana (50 mu g/mL) in the same volume, and shaking culture is carried out at 37 ℃ and 220rpm/min overnight; centrifuging the culture medium at 12000rpm for 10-20min, collecting supernatant, adding PEG8000 at 1:4-1:5, mixing, and freezing at 4 deg.C overnight. Centrifuging at 12000rpm for 10min, collecting precipitate, re-suspending the precipitate with 1.5mL of 1 XPBS, adding PEG8000 in the ratio of 1:4-1:5, reversing uniformly, centrifuging at 12000rpm for 10min at 4 deg.C for 2-3h, collecting precipitate, and re-suspending the precipitate with 300. mu.L of 1 XPBS to obtain the first round of single-chain antibody library;

(8) performing 3-4 rounds of phage panning, calculating the amount of phage library input and output each time, adding 50% glycerol into the phage library in the last round, and storing in a refrigerator at-80 deg.C.

Further, the third step includes:

(1) coating: the purified feline parvovirus is treated with 0.1M NaHCO₃Diluting to 8 mu g/mL coated 96-well enzyme label plate, setting BSA as a blank control, and setting M13K07 as a negative control;

(2) and (3) sealing: discarding the coating solution in a 96-well enzyme label plate, and incubating for 2h at 37 ℃ with 200 mu L of confining liquid in each well;

(3) washing: adding 200 μ L PBST into each well, washing for 3 times, and patting to dry;

(4) adding a phage single-chain antibody: 1:1 mixing phage single-chain antibody and PBST, adding 200 mu L of phage single-chain antibody into a 96-well enzyme label plate, and incubating for 2h at room temperature;

(5) washing: the same step (3);

(6) applying a second antibody: diluting an HRP-labeled anti-M13 antibody at a ratio of 1:5000, and incubating at 37 ℃ for 1 h;

(7) washing: the same step (3);

(8) color development: adding 50 μ L of TMB color developing solution into each well, covering with tinfoil paper, and reacting at 37 deg.C for 10 min;

(9) and (4) terminating: 50 μ L of 2mol/L H was added to each well₂SO₄Stopping the reaction, and detecting OD by an enzyme-linked immunosorbent assay₄₅₀Numerical values.

Further, the construction of the cat-derived anti-feline parvovirus single-chain antibody library comprises:

(1) separating peripheral blood lymphocytes of cats, performing vaccine immunization on 5 experimental cats, wherein each immunization is separated by 2 weeks, 3 times of immunization is performed, 2 weeks after 3 times of immunization, 5-10mL of fresh blood is uniformly mixed with whole blood and tissue diluent in a ratio of 1:1-1:2, adding cell separating medium into a 15mL centrifugal tube, slightly adding diluted anticoagulation blood with the same volume along the tube wall, centrifuging by a horizontal centrifuge at a rotation speed of 400-800 g for 15-25 min, and after centrifuging, dividing the liquid in the centrifugal tube into four layers which are respectively from top to bottom: a first layer: a plasma layer; a second layer: a layer of lymphocytes; and a third layer: separation liquid and fourth layer: red blood cell layer. Carefully pipette the second layer of opalescent lymphocytes into another 15mL centrifuge tube, add 10mL of wash solution, mix well, centrifuge at 250g for 10 min. Repeating for 2-3 times, discarding the supernatant, resuspending the lymphocytes at the bottom of the tube with a cryopreservation solution containing 90% fetal calf serum, 10% DMSO and 1% double antibody, subpackaging in 2mL of cryopreservation tubes, standing in a refrigerator at 4 ℃ for 30min, standing in a refrigerator at-20 ℃ for 2h, standing in a refrigerator at-80 ℃ overnight, and moving to liquid nitrogen for sequential cryopreservation of the lymphocytes on the next day;

(2) extracting total RNA of peripheral blood lymphocytes of cats, transferring PBMC in a freezing tube into a 1.5mL centrifuge tube at 1800rpm, centrifuging for 5min, discarding supernatant, leaving 50-100 μ L of supernatant at the bottom of the centrifuge tube, resuspending cells at the bottom of the tube, adding 1mL Trizol, repeatedly blowing and beating uniformly by a pipette gun, incubating at room temperature for 5min, adding 0.2mL chloroform, violently shaking by hand for 15s, incubating at room temperature for 2-3min, centrifuging at 12000rpm for 15min at 4 ℃ by a refrigerated centrifuge, wherein the liquid can be divided into lower layer containing the lower layerAn organic phase of DNA and protein, and an upper transparent layer containing RNA. Inclining the centrifuge tube at 45 degrees, transferring the transparent layer to another 1.5mL centrifuge tube, adding 0.5mL isopropanol, mixing, incubating at room temperature for 10min, centrifuging at 12000rpm for 10min, discarding the supernatant, adding 1mL 75% ethanol, washing with vortex oscillator, centrifuging at 7500rpm and 4 deg.C for 5min, discarding the supernatant, standing and drying the centrifuge tube on a clean bench for 5-10min, re-suspending and dissolving with at least 30 μ L DEPC water, and measuring concentration and A with an ultramicro spectrophotometer₂₆₀And A₂₈₀The ratio is preserved at minus 80 ℃;

(3) cat heavy chain variable region V_HAnd light chain variable region V_LThe amplification of (1) was performed using PrimeScript using the extracted total RNA as a template^TMII 1st Strand cDNA Synthesis Kit Total RNA was reverse transcribed into cDNA and VH and VL genes were PCR amplified. Preparing 1.5% agarose gel, detecting and identifying by nucleic acid electrophoresis, observing the result in a gel imager, recovering gel, and purifying V_HAnd V_LFragment, using primer of Linker to make heavy chain variable region gene V by SOE-PCR gene engineering method_HRespectively linked with light chain variable region gene V_LLight chain variable region gene V_LAssembly into scFv genes to form V_L-linker-V_HPreparing 1.0% agarose gel, observing the result in a gel imager, recovering the gel, purifying the scFv gene fragment, and carrying out enzyme digestion and connection on the purified scFv gene product and a phage vector pComb3 XSS;

(4) constructing a single-chain antibody library, performing electric shock transformation on 20 mu L of the ligation product and 80 mu L of electrotransformation competent XLI-Blue under the conditions of 2.5KV and 800 omega, washing an electric rotating cup by using 1mLSOC culture medium, sucking the liquid into a 50mL centrifuge tube, rotating at 220rpm/min and 37 ℃, and shaking the bacteria for 45 min. mu.L, 50. mu.L and 100. mu.L of the inoculum, respectively, were applied to plates containing Amp + (100. mu.g/mL) to determine the effect of electroporation, and 9mL of LB broth containing Amp + (100. mu.g/mL) were added to the centrifuge tubes at a rate of 1:1000 adding glucose, 220rpm/min, 37 ℃, shaking to OD₆₀₀When the bacterial strain is equal to 0.5, 20 mu L of the helper phage M13K07 is added for rescue, and the bacterial strain is shaken for 1h after 30min of infection. The bacterial liquid is centrifuged at 3000rpm for 6min, the supernatant is discarded, and the cell suspension is treated with an equal volume of Amp + (100. mu.g)/mL), Kana LB liquid medium at a ratio of 1:1000, IPTG was added at 220rpm/min, 37 ℃, and the bacteria were shaken for 6 h. Centrifuging the culture medium at 12000rpm/min for 10-20min, collecting supernatant, adding PEG8000 at 1:4-1:5, reversing and mixing, wherein cloudy precipitate appears, centrifuging at 12000rpm for 10min after 4 ℃ in a refrigerator, collecting precipitate, re-suspending the precipitate with 1.5mL1 XPBS, adding PEG8000 at a ratio of 1:4-1:5, reversing and mixing, centrifuging at 12000rpm for 10min after 2-3h at 4 ℃ in a refrigerator, collecting precipitate, re-suspending the precipitate with 300 uL 1 XPBS, adding 50% glycerol, mixing, standing at-20 ℃ for storage, and constructing a library for multiple times according to the method to establish the original library of the scFv phage antibody.

By combining all the technical schemes, the invention has the advantages and positive effects that: in the research, an immune cat is selected as a research object, peripheral blood of a sample is collected firstly, then PBMC is separated by a centrifuge, and finally, the expression of cat source antibody genes is carried out on the surface of a phage vector based on a phage display method, so that a phage single-chain antibody library for the cat parvovirus is obtained, and the same animal source of the antibody is realized. The variable region amino acid sequences and the nucleotide sequences of the heavy chain and the light chain of the feline parvovirus-resistant humanized antibody provided by the invention provide support for constructing a high-affinity and low-immunogenicity canine parvovirus-resistant genetic engineering antibody. Has important significance for promoting the development of the feline antibody drug.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments of the present application will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present application, and it is obvious for those skilled in the art that other drawings can be obtained from the drawings without creative efforts.

FIG. 1 is a flow chart of a method for screening feline parvovirus antibody sequences according to an embodiment of the present invention.

FIG. 2 PCR amplification products of VH gene.

FIG. 3 PCR amplification product of Kappa gene.

FIG. 4 PCR amplification product of Lamda gene.

FIG. 5 PCR amplification product of scFv gene.

FIG. 6 library size of single chain antibody gene library construction.

FIG. 7 anti-feline parvovirus phage antibody binding activity.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Aiming at the problems in the prior art, the invention provides a feline parvovirus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof, and the invention is described in detail with reference to the attached drawings.

The feline parvovirus antibody sequence provided by the invention is a heavy chain variable region amino acid sequence SEQ ID NO: 1 and the nucleotide sequence SEQ ID NO: 3; light chain variable region amino acid sequence SEQ ID NO: 2 and the nucleotide sequence SEQ ID NO: 4.

as shown in FIG. 1, the method for screening feline parvovirus antibody sequences provided by the invention comprises the following steps:

s101: preparing a phage antibody;

s102: panning of a phage antibody library;

s103: identifying a cat source Phage single-chain antibody of the anti-feline parvovirus by a Phage ELISA method;

s104: sequencing scFv bacterial liquid with positive Phage ELISA identification result by sequencing company to obtain the variable region sequences of heavy chain and light chain of the gene engineering antibody of the cat-derived anti-cat parvovirus.

The technical solution of the present invention is further described with reference to the following specific examples.

Example 1 construction of a library of feline-derived anti-feline parvovirus single-chain antibodies

1. Isolation of feline peripheral blood lymphocytes

Vaccine immunization was performed on 5 experimental cats according to the international manual on animal immunization. The immunization was performed 3 times with 2 weeks interval. 2 weeks after 3 immunizations, cat peripheral blood was collected. 5-10mL of fresh blood is taken to be uniformly mixed with the whole blood and the tissue diluent in a ratio of 1:1-1: 2. Cell separation medium was added to a 15mL centrifuge tube and an equal volume of diluted anticoagulated blood was gently added along the tube wall. The horizontal centrifuge centrifuges at a rotation speed of 400g-800g for 15min-25min, after centrifugation, the liquid in the centrifuge tube is divided into four layers which are respectively from top to bottom: a first layer: a plasma layer; a second layer: a layer of lymphocytes; and a third layer: separation liquid and fourth layer: red blood cell layer. Carefully pipette the second layer of opalescent lymphocytes into another 15mL centrifuge tube, add 10mL of wash solution, mix well, centrifuge at 250g for 10 min. Repeat 2-3 times, abandon the supernatant. The lymphocyte at the bottom of the tube is resuspended by a freezing medium containing 90 percent fetal calf serum, 10 percent DMSO and 1 percent double antibody, the mixture is subpackaged into 2mL freezing tubes, the freezing tubes are placed for 30min at 4 ℃, the freezing tubes are placed for 2h at-20 ℃, the freezing tubes are placed overnight at-80 ℃, and the lymphocyte is frozen and stored in the liquid nitrogen sequentially the next day.

2. Extraction of total RNA from cat peripheral blood lymphocytes

The PBMC in the frozen tube were transferred to a 1.5mL centrifuge tube at 1800rpm, centrifuged for 5min, and the supernatant discarded. 50-100. mu.L of the supernatant was left at the bottom of the centrifuge tube and the tube bottom cells were resuspended. Adding 1mL Trizol, repeatedly and uniformly blowing by using a pipette gun, and incubating for 5min to room temperature. Adding 0.2mL chloroform, shaking vigorously by hand for 15s, incubating at room temperature for 2-3min, and centrifuging at 12000rpm and 4 deg.C for 15min in a refrigerated centrifuge, wherein the liquid can be divided into lower organic phase containing DNA and protein, and upper transparent layer containing RNA. The centrifuge tube was tilted 45 degrees and the clear layer was transferred to another 1.5mL centrifuge tube. Adding 0.5mL of isopropanol, mixing, incubating at room temperature for 10min, centrifuging at 12000rpm for 10min, and discarding the supernatant. 1mL of 75% ethanol was added and washed with a vortex shaker at 7500rpm, 4 ℃ and centrifuged for 5min, and the supernatant was discarded. Placing the centrifuge tube on a clean bench, standing for 5-10min, taking care not to dry RNA, resuspending and dissolving with at least 30 μ L DEPC water, measuring concentration and A with ultramicro spectrophotometer₂₆₀And A₂₈₀The ratio was stored at-80 ℃.

3. Cat heavy chain variable region (V)_H) And light chain variable region (V)_L) Amplification of

Using extracted total RNA as template and PrimeScript^TMII 1st Strand cDNA Synthesis Kit reverse transcription of total RNA into cDNA. VH gene and VL gene were amplified by PCR using the same as a template and the sequence of the primer shown in appendix 5. Preparing 1.5% agarose gel, detecting and identifying by nucleic acid electrophoresis, observing the result in a gel imager, recovering gel, and purifying V_HAnd V_LAnd (3) fragment. The heavy chain variable region gene V is processed by a SOE-PCR gene engineering method by using a primer of a Linker_HRespectively linked with light chain variable region gene V_L(Lamda), light chain variable region Gene V_L(Kappa) Assembly of scFv genes to form V_L-linker-V_HIn the form of (1). Preparing 1.0% agarose gel, observing the result in a gel imager, recovering the gel, and purifying the scFv gene fragment. And carrying out enzyme digestion and connection on the purified scFv gene product and a phage vector pComb3 XSS.

4. Construction of Single chain antibody library

20 μ L of the ligation product was transformed with 80 μ L of electrically competent XLI-Blue by electroporation at 2.5KV and 800 Ω, the cuvette was rinsed with 1mLSOC medium, and the liquid was pipetted into a 50mL centrifuge tube at 220rpm/min, 37 ℃ and 45min for shaking. mu.L, 50. mu.L and 100. mu.L of the bacterial suspension were applied to a plate containing Amp + (100. mu.g/mL), respectively, and the electrotransfer effect was determined. 9mL of LB liquid medium containing Amp + (100. mu.g/mL) were added to the centrifuge tube at a rate of 1:1000 adding glucose (1mol/L), 220rpm/min, 37 deg.C, shaking to OD₆₀₀0.5. Add 20 u L helper phage M13K07 for rescue, infected 30min later shake bacteria for 1 h. The bacterial liquid was centrifuged at 3000rpm for 6min, the supernatant was discarded, and IPTG (1mol/L) was added at 1:1000 in an equal volume of LB liquid medium containing Amp + (100. mu.g/mL) and Kana (50. mu.g/mL), at 220rpm/min, at 37 ℃ and the bacteria were shaken for 6 h. The medium was centrifuged at 12000rpm/min for 10-20min, and the supernatant was collected. PEG8000 was added at a ratio of 1:4-1:5, and the mixture was mixed by inversion, whereupon a cloudy precipitate appeared, which was cooled to 4 ℃ in a refrigerator overnight. Centrifuging at 12000rpm for 10min, collecting precipitate, re-suspending the precipitate with 1.5mL1 XPBS (pH7.4), adding PEG8000 at 1:4-1:5, reversing, centrifuging at 12000rpm for 10min at 4 deg.C for 2-3 hr, collecting precipitate, centrifuging with 300 μmL1 XPBS (pH7.4) heavy suspension precipitation, adding 50% glycerol, mixing, standing at-20 deg.C for storage. The library is built for many times according to the method, and the original library of the scFv phage antibody is built.

Example 2 screening of library of feline-derived anti-feline parvovirus single-chain antibodies

1. Preparation of phage antibodies

Adding 1mL of phage primary antibody library into 3mL of XLI-Blue bacterial liquid with OD600 equal to 0.5, standing at 37 ℃ for 45min, adding 6mL of LB liquid culture medium containing Amp + (100 mu g/mL), adding glucose (1mol/L) according to a ratio of 1:1000, continuing to culture, adding helper phage M13K07 when the bacterial liquid OD600 is equal to 0.5, standing at 37 ℃ in an incubator to infect for 30min, then culturing at 220rpm/min, culturing at 37 ℃ for 1h, centrifuging the bacterial liquid at 3500rpm for 10min, discarding supernatant, adding LB liquid culture medium containing Amp + (100 mu g/mL) and Kana (50 mu g/mL) in an equal volume, adding G (1mol/L), 220rpm/min, and shaking at 37 ℃ for 6 h. The medium was centrifuged at 12000rpm for 10-20min, and the supernatant was collected. PEG8000 was added at a ratio of 1:4-1:5, and the mixture was mixed by inversion, whereupon a cloudy precipitate appeared, which was cooled to 4 ℃ in a refrigerator overnight. Centrifuging at 12000rpm for 10min, collecting precipitate, re-suspending the precipitate with 1.5mL of 1 XPBS (pH7.4), adding PEG8000 at a ratio of 1:4-1:5, uniformly inverting, centrifuging at 12000rpm for 10min at 4 deg.C for 2-3h, collecting precipitate, re-suspending the precipitate with 300 μ L of 1 XPBS (pH7.4), calculating the amount of phage input into the elutriation sieve, and waiting for elutriation.

2. Panning of phage antibody libraries

(1) Coating: with 0.1M NaHCO₃The purified feline parvovirus was diluted to different concentrations of 2. mu.g/mL, 4. mu.g/mL and 8. mu.g/mL and coated on 96-well ELISA plates, each well was 100. mu.L, and the plates were placed in a refrigerator at 4 ℃ overnight. After coating, discarding the liquid in the enzyme label plate with 96 holes, adding 100 mu L washing buffer solution PBST into each hole, and washing for 3 times;

(2) and (3) sealing: adding 250 mu L of sealing liquid into each hole, and sealing in a 37 ℃ incubator for 2 h;

(3) washing: add 100. mu.L PBST per well and wash 3 times in total. Washing each time, shaking for 1min at 400rpm by using a plate shaking instrument, vertically rotating the ELISA plate for one circle, and infiltrating the tube wall;

(4) adding a phage antibody: adding phage antibody into 100 μ L of each well, shaking at 400rpm/min for 5min, and incubating at room temperature for 1 h;

(5) washing: repeating the step (3);

(6) and (3) elution: stop solution was added at 50. mu.L per well and shaken at 1000rpm for 5min in a plate shaker. Each 400. mu.L of eluate was neutralized with 75. mu.L of Tris-HCl. mu.L of this liquid was added to 180. mu.L of competent cells with OD600 ═ 0.5, infected for 20min, and 20. mu.L of the bacterial suspension was spread on an LB plate containing Amp + (100. mu.g/mL), cultured overnight at 37 ℃ and the amount of phage pool exported was calculated. Picking monoclonal colony shake bacteria, carrying out PCR identification, and sequencing;

(7) adding 3mL of OD into 90% of the total amount of the primary phage antibody library₆₀₀In competent cells (0.5), after infection for 30min, 6mL of LB liquid was added, and ampicillin was added at a final concentration of 100. mu.g/mL and glucose (1M/L) was added at a rate of 1: 1000. OD of bacterial liquid to be treated₆₀₀When the concentration is 0.5, 4 multiplied by 1010 helper phage M13K07 is added, after standing and incubation for 30min, shaking culture is carried out for 1h at 220rpm/min, centrifugation is carried out for 6min at 3500rpm/min, supernatant is discarded, weight suspension precipitation is carried out by using LB liquid culture medium containing Amp + (100 mu g/mL) and Kana (50 mu g/mL) with the same volume, and shaking culture is carried out at 37 ℃ and 220rpm/min overnight; the medium was centrifuged at 12000rpm for 10-20min, and the supernatant was collected. PEG8000 was added at a ratio of 1:4-1:5, and the mixture was mixed by inversion, whereupon a cloudy precipitate appeared, which was cooled to 4 ℃ in a refrigerator overnight. Centrifuging at 12000rpm for 10min, collecting the precipitate, resuspending the precipitate with 1.5mL of 1 XPBS (pH7.4), adding PEG8000 again according to the ratio of 1:4-1:5, inverting uniformly, centrifuging at 12000rpm for 10min at 4 ℃ for 2-3h, collecting the precipitate, and resuspending the precipitate with 300 uL of 1 XPBS (pH7.4) to obtain the first round of single-chain antibody library.

(8) And performing 3-4 rounds of phage panning, and calculating the input and output phage library amount each time. And the final round of phage library was added to 50% glycerol and stored in a-80 ℃ freezer.

Phage ELISA method for identifying cat source Phage single-chain antibody of anti-feline parvovirus

(1) Coating: the purified feline parvovirus is treated with 0.1M NaHCO₃Diluting to 8 mu g/mL coated 96-well enzyme label plate, setting BSA as a blank control, and setting M13K07 as a negative control;

(2) and (3) sealing: discarding the coating solution in a 96-well enzyme label plate, and incubating for 2h at 37 ℃ with 200 mu L of confining liquid in each well;

(3) washing: adding 200 μ L PBST into each well, washing for 3 times, and patting to dry;

(4) adding a phage single-chain antibody: 1:1 mixing phage single-chain antibody and PBST, adding 200 mu L of phage single-chain antibody into a 96-well enzyme label plate, and incubating for 2h at room temperature;

(5) washing: the same step (3);

(6) applying a second antibody: diluting an HRP-labeled anti-M13 antibody at a ratio of 1:5000, and incubating at 37 ℃ for 1 h;

(7) washing: the same step (3);

(8) color development: adding 50 μ L of TMB color developing solution into each well, covering with tinfoil paper, and reacting at 37 deg.C for 10 min;

(9) and (4) terminating: 50 μ L of 2mol/L H was added to each well₂SO₄Stopping the reaction, and detecting OD by an enzyme-linked immunosorbent assay₄₅₀Numerical values.

Sequencing scFv bacterial liquid with positive Phage ELISA identification result by sequencing company to obtain the variable region sequences of heavy chain and light chain of the gene engineering antibody of the cat-derived anti-cat parvovirus.

SEQ ID NO: 1: heavy chain variable region amino acid sequence

Gln Glu Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Val Gly Ser Gly Phe Thr Phe Ser Ser Thr Trp Ile Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Leu Ala Gly Ile Tyr Ser Ser Ala Gly Ser Thr Val His Ser Asp Ser Val Lys Gly Arg Phe Thr Val Ser Gly Asp Asn Ser Gln Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Arg Tyr Tyr Cys Thr Lys Ser Asn Trp Tyr Thr Leu Asp Val Trp Gly Pro Gly Val Glu Val Val Val Ser Ser Ala Ser Thr Lys Gly Pro Ser

SEQ ID NO: 2: light chain variable region amino acid sequence

Ala Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ala Ala Ser Leu Gly Asp Thr Val Ser Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Ala Trp Tyr Gln Gln Gln Pro Gly Thr Ala Pro Lys Arg Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Asn Asn Asn Val Pro Pro Thr Phe Gly Gln Gly Thr Lys Leu Glu Leu Lys

SEQ ID NO: 3: heavy chain variable region nucleotide sequence

caggagaagctggtggagtctggaggaggcctggtgcagcctggggggtctctcagactctcctgtgtcggctct ggatt

caccttcagtagtacctggattaactgggtccgccaggctccagggaaggggctggagtggctggcaggcatttat agta

gtgcaggtagcaccgtccactcagactctgtgaagggccgattcaccgtctcaggagacaactcccagaacacg gcctat

ctgcaaatgaacagcctgagaaccgaagacacggcccgctattactgtacaaaatccaactggtatacgttggatg tctg

gggcccaggcgttgaggtcgtcgtgtcctcagcctccaccaagggcccatcgg

SEQ ID NO: 4: light chain variable region nucleotide sequence

gccatccagatgacccagtctccagcctccctggctgcatctctcggagacacggtctccatcacttgccgggcca gtca

gagcattagcagttatttagcctggtatcaacaacaaccagggacggctcctaaacgcttgatctatgctgcatcca gtt

tgcaaagtggggtcccatcccggttcaagggcagtggatctggcaccgatttcaccctcaccatcagtggcctgca ggct

gaagatgttgcaacttattactgtttgcagaataataatgtacctccgacgttcggccaaggaaccaagctggaactc aa

ac

SEQ ID NO：5：

Upstream primer for amplifying cat heavy chain variable region

ggtggttcctctagatcttcc ctgcacgtcgaccac

ggtggttcctctagatcttcc gttgaatgtgaagcc

ggtggttcctctagatcttcc gtccaaaacgaccac

ggtggttcctctagatcttcccaatggactggagctggagaatcc

ggtggttcctctagatcttccatggagtttgtgctgggctgggttttcct

ggtggttcctctagatcttccatcacygkavaacgccatcctcttccaga

Downstream primer for amplifying cat heavy chain variable region

acctggccggcctggcctggttgttgaccacactgttgttctt

acctggccggcctggcctggttgttgaccacactgttgttctt

acctggccggcctggcccgtggtggaggctgaggacaccgtca

acctggccggcctggcc ggctccttggcccca

SEQ ID NO：6：

Amplification of cat light chain (Kappa) upstream primer

atagggcccaggcggcc ctacagcactactgc

atagggcccaggcggcc tcacaccacgactgc

atagggcccaggcggcc cgctagtgctactgc

atagggcccaggcggccgttcagcttctcaaaatgaggttccctgct

Downstream primer for amplifying cat light chain (Kappa)

ggaagatctagaggaaccaccatatgcacacgatagaggcacttcctgtat

ggaagatctagaggaaccacc cgtccccaggccgaa

SEQ ID NO：7：

Amplification of cat light chain (lamda) upstream primer

atagggcccaggcggcc gtcagatccgactga

atagggcccaggcggcc gtcagacacgactga

atagggcccaggcggcc gtcagacgggactta

atagggcccaggcggcc gtcagccccgactga

atagggcccaggcggcc ccagtcagccccggc

atagggcccaggcggcc aggatacacgactga

atagggcccaggcggcc cggatacacaactga

atagggcccaggcggcc aggtcactccactga

atagggcccaggcggcc gtcggacacgactgg

Downstream primer for amplifying cat light chain (lamda)

ggaagatctagaggaaccaccggtccctccgccgaa

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> Qingdao bonong Gene bioengineering Co., Ltd

<120> feline parvovirus antibody sequence, tetrapeptide chain molecule, immunoglobulin molecule and application

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 124

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Gln Glu Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Val Gly Ser Gly Phe Thr Phe Ser Ser Thr

20 25 30

Trp Ile Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Leu

35 40 45

Ala Gly Ile Tyr Ser Ser Ala Gly Ser Thr Val His Ser Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Val Ser Gly Asp Asn Ser Gln Asn Thr Ala Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Arg Tyr Tyr Cys

85 90 95

Thr Lys Ser Asn Trp Tyr Thr Leu Asp Val Trp Gly Pro Gly Val Glu

100 105 110

Val Val Val Ser Ser Ala Ser Thr Lys Gly Pro Ser

115 120

<210> 2

<211> 107

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Ala Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ala Ala Ser Leu Gly

1 5 10 15

Asp Thr Val Ser Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Gln Pro Gly Thr Ala Pro Lys Arg Leu Ile

35 40 45

Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Gly Leu Gln Ala

65 70 75 80

Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Asn Asn Asn Val Pro Pro

85 90 95

Thr Phe Gly Gln Gly Thr Lys Leu Glu Leu Lys

100 105

<210> 3

<211> 373

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caggagaagc tggtggagtc tggaggaggc ctggtgcagc ctggggggtc tctcagactc 60

tcctgtgtcg gctctggatt caccttcagt agtacctgga ttaactgggt ccgccaggct 120

ccagggaagg ggctggagtg gctggcaggc atttatagta gtgcaggtag caccgtccac 180

tcagactctg tgaagggccg attcaccgtc tcaggagaca actcccagaa cacggcctat 240

ctgcaaatga acagcctgag aaccgaagac acggcccgct attactgtac aaaatccaac 300

tggtatacgt tggatgtctg gggcccaggc gttgaggtcg tcgtgtcctc agcctccacc 360

aagggcccat cgg 373

<210> 4

<211> 322

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gccatccaga tgacccagtc tccagcctcc ctggctgcat ctctcggaga cacggtctcc 60

atcacttgcc gggccagtca gagcattagc agttatttag cctggtatca acaacaacca 120

gggacggctc ctaaacgctt gatctatgct gcatccagtt tgcaaagtgg ggtcccatcc 180

cggttcaagg gcagtggatc tggcaccgat ttcaccctca ccatcagtgg cctgcaggct 240

gaagatgttg caacttatta ctgtttgcag aataataatg tacctccgac gttcggccaa 300

ggaaccaagc tggaactcaa ac 322

<210> 5

<211> 414

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtggttcct ctagatcttc cctgcacgtc gaccacggtg gttcctctag atcttccgtt 60

gaatgtgaag ccggtggttc ctctagatct tccgtccaaa acgaccacgg tggttcctct 120

agatcttccc aatggactgg agctggagaa tccggtggtt cctctagatc ttccatggag 180

tttgtgctgg gctgggtttt cctggtggtt cctctagatc ttccatcacy gkavaacgcc 240

atcctcttcc agaacctggc cggcctggcc tggttgttga ccacactgtt gttcttacct 300

ggccggcctg gcctggttgt tgaccacact gttgttctta cctggccggc ctggcccgtg 360

gtggaggctg aggacaccgt caacctggcc ggcctggccg gctccttggc ccca 414

<210> 6

<211> 230

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atagggccca ggcggcccta cagcactact gcatagggcc caggcggcct cacaccacga 60

ctgcataggg cccaggcggc ccgctagtgc tactgcatag ggcccaggcg gccgttcagc 120

ttctcaaaat gaggttccct gctggaagat ctagaggaac caccatatgc acacgataga 180

ggcacttcct gtatggaaga tctagaggaa ccacccgtcc ccaggccgaa 230

<210> 7

<211> 324

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atagggccca ggcggccgtc agatccgact gaatagggcc caggcggccg tcagacacga 60

ctgaataggg cccaggcggc cgtcagacgg gacttaatag ggcccaggcg gccgtcagcc 120

ccgactgaat agggcccagg cggccccagt cagccccggc atagggccca ggcggccagg 180

atacacgact gaatagggcc caggcggccc ggatacacaa ctgaataggg cccaggcggc 240

caggtcactc cactgaatag ggcccaggcg gccgtcggac acgactgggg aagatctaga 300

ggaaccaccg gtccctccgc cgaa 324

Claims (10)

1. A feline parvovirus antibody sequence, which is characterized in that the feline parvovirus antibody sequence is a heavy chain variable region amino acid sequence of SEQ ID NO: 1 and the nucleotide sequence SEQ ID NO: 3; light chain variable region amino acid sequence SEQ ID NO: 2 and the nucleotide sequence SEQ ID NO: 4.

2. a tetrapeptide chain molecule formed from the heavy and light chains of the feline parvovirus antibody sequence of claim 1 joined by disulfide bonds.

3. An immunoglobulin molecule comprising the tetrapeptide chain molecule of claim 2.

4. A method for detecting feline parvovirus, which comprises using the feline parvovirus antibody sequence of claim 1.

5. A method for preparing a monoclonal antibody for treating feline parvovirus, which comprises using the feline parvovirus antibody sequence of claim 1.

6. A method of screening for feline parvovirus antibody sequences as defined in claim 1 comprising:

firstly, preparing a phage antibody;

step two, panning of a phage antibody library;

thirdly, identifying the cat source Phage single-chain antibody of the anti-feline parvovirus by a Phage ELISA method;

and fourthly, sequencing the scFv bacterial liquid with positive Phage ELISA identification result by a sequencing company to obtain the variable region sequences of the heavy chain and the light chain of the gene engineering antibody of the feline parvovirus resistance.

7. The method for screening feline parvovirus antibody sequences according to claim 6, wherein said first step comprises: adding 1mL of phage primary antibody library into 3mL of XLI-Blue bacterial liquid with OD600 equal to 0.5, standing at 37 ℃ for 45min, adding 6mL of LB liquid culture medium containing Amp + (100 mug/mL), adding glucose according to a ratio of 1:1000, continuing culture, adding helper phage M13K07 when the bacterial liquid OD600 is equal to 0.5, standing at 37 ℃ in an incubator for 30min, culturing at 37 ℃ at 220rpm/min, centrifuging at 37 ℃ for 1h, centrifuging at 3500rpm of bacterial liquid for 10min, discarding supernatant, adding IPTG (100 mug/mL) and Kana LB) in an equal volume, adding IPTG (isopropyl-beta-thiogalactopyranoside) at a ratio of 1:1000, 220rpm/min, shaking at 37 ℃ for 6h, centrifuging at 12000rpm for 10-20min, collecting supernatant, adding PEG8000 to 1:4-1:5, reversing, mixing uniformly, allowing cloud precipitation to appear, standing at 12000 ℃ in a refrigerator for 10min, collecting precipitate, centrifuging at 10mL of PBS by a ratio of 1:4-1:5, adding PEG8000 at a ratio of 1:4-1:5, reversing, centrifuging at 12000rpm for 10min in refrigerator at 4 deg.C for 2-3h, collecting precipitate, resuspending the precipitate with 300 μ L of 1 × PBS, calculating the amount of phage input into the elutriation sieve, and standing for elutriation.

8. The method of screening for feline parvovirus antibody sequences according to claim 6, wherein said second step comprises:

(1) coating: with 0.1M NaHCO₃Diluting the purified feline parvovirus into a 96-well enzyme label plate coated with different concentrations of 2 mu g/mL, 4 mu g/mL and 8 mu g/mL, wherein each well is 100 mu L, placing the plate in a refrigerator at 4 ℃ overnight, discarding the liquid in the 96-well enzyme label plate after coating, adding 100 mu L of washing buffer PBST into each well, and washing for 3 times;

(2) and (3) sealing: adding 250 mu L of sealing liquid into each hole, and sealing in a 37 ℃ incubator for 2 h;

(3) washing: adding 100 mu L PBST into each hole, washing for 3 times, shaking for 1min at 400rpm by using a plate shaking instrument, vertically rotating the ELISA plate for one circle, and infiltrating the tube wall;

(4) adding a phage antibody: adding phage antibody into 100 μ L of each well, shaking at 400rpm/min for 5min, and incubating at room temperature for 1 h;

(5) washing: repeating the step (3);

(6) and (3) elution: adding 50 mu L of stop solution into each hole, shaking the plate shaking instrument at 1000rpm for 5min, adding 75 mu L of Tris-HCL into each 400 mu L of eluent for neutralization, adding 20 mu L of the liquid into 180 mu L of competent cells with OD600 equal to 0.5, infecting for 20min, coating 20 mu L of bacterial solution on an LB plate containing Amp + (100 mu g/mL), culturing at 37 ℃ overnight, calculating the output phage library amount, picking up a monoclonal colony, shaking the bacteria, carrying out PCR identification, and sending for sequencing;

(7) adding 3mL of OD into 90% of the total amount of the primary phage antibody library₆₀₀In competent cells (0.5), after infection for 30min, 6mL of LB liquid was added, ampicillin was added to the final concentration of 100. mu.g/mL, and glucose was added at a ratio of 1:1000 until OD of the bacterial liquid was reached₆₀₀When the culture medium is equal to 0.5, 4 multiplied by 1010 helper phage M13K07 is added, after standing and incubation for 30min, shaking culture is carried out for 1h at 220rpm/min, centrifugation is carried out for 6min at 3500rpm/min, supernatant is discarded, the precipitate is resuspended by using LB liquid culture medium containing Amp + (100 mu g/mL) and Kana (50 mu g/mL) in the same volume, and shaking culture is carried out at 37 ℃ and 220rpm/min overnight; centrifuging the culture medium at 12000rpm for 10-20min, collecting supernatant, adding PEG8000 at 1:4-1:5, mixing, adding PEG8000 at 4 deg.C overnight, centrifuging at 12000rpm for 10min, collecting precipitate, resuspending the precipitate with 1.5mL of 1 XPBS, adding PEG8000 at 1:4-1:5, homogenizing, centrifuging at 4 deg.C for 2-3h at 12000rpm for 10min, collecting precipitate, and resuspending the precipitate with 300 μ L of 1 XPBS to obtain the first round of single chain antibody library;

(8) performing 3-4 rounds of phage panning, calculating the amount of phage library input and output each time, adding 50% glycerol into the phage library in the last round, and storing in a refrigerator at-80 deg.C.

9. The method for screening feline parvovirus antibody sequences according to claim 6, wherein said third step comprises:

(1) coating: the purified feline parvovirus is treated with 0.1M NaHCO₃Diluting to 8 mu g/mL coated 96-well enzyme label plate, setting BSA as a blank control, and setting M13K07 as a negative control;

(2) and (3) sealing: discarding the coating solution in a 96-well enzyme label plate, and incubating for 2h at 37 ℃ with 200 mu L of confining liquid in each well;

(3) washing: adding 200 μ L PBST into each well, washing for 3 times, and patting to dry;

(4) adding a phage single-chain antibody: 1:1 mixing phage single-chain antibody and PBST, adding 200 mu L of phage single-chain antibody into a 96-well enzyme label plate, and incubating for 2h at room temperature;

(5) washing: the same step (3);

(6) applying a second antibody: diluting an HRP-labeled anti-M13 antibody at a ratio of 1:5000, and incubating at 37 ℃ for 1 h;

(7) washing: the same step (3);

(8) color development: adding 50 μ L of TMB color developing solution into each well, covering with tinfoil paper, and reacting at 37 deg.C for 10 min;

(9) and (4) terminating: 50 μ L of 2mol/L H was added to each well₂SO₄Stopping the reaction, and detecting OD by an enzyme-linked immunosorbent assay₄₅₀Numerical values.

10. The method for screening feline parvovirus antibody sequences according to claim 6, wherein the constructing of the library of feline anti-feline parvovirus single chain antibodies comprises:

(1) separating peripheral blood lymphocytes of cats, performing vaccine immunization on 5 experimental cats, wherein each immunization is separated by 2 weeks, 3 times of immunization is performed, 2 weeks after 3 times of immunization, 5-10mL of fresh blood is uniformly mixed with whole blood and tissue diluent in a ratio of 1:1-1:2, adding cell separating medium into a 15mL centrifugal tube, slightly adding diluted anticoagulation blood with the same volume along the tube wall, centrifuging by a horizontal centrifuge at a rotation speed of 400-800 g for 15-25 min, and after centrifuging, dividing the liquid in the centrifugal tube into four layers which are respectively from top to bottom: a first layer: a plasma layer; a second layer: a layer of lymphocytes; and a third layer: separation liquid and fourth layer: sucking a second layer of milky lymphocytes into another 15mL centrifuge tube carefully by using a pipette, adding 10mL of cleaning solution for uniformly mixing, centrifuging for 10min at 250g, repeating for 2-3 times, discarding supernatant, resuspending the lymphocytes at the bottom of the tube by using cryopreservation solution containing 90% fetal calf serum, 10% DMSO and 1% double antibody, subpackaging the above suspension into 2mL cryopreservation tubes, placing the above cryopreservation tubes in a refrigerator at 4 ℃ for 30min, placing the above cryopreservation tubes in a refrigerator at-20 ℃ for 2h, placing the above cryopreservation tubes in a refrigerator at-80 ℃ overnight, and transferring the above cryopreservation tubes to liquid nitrogen sequentially for cryopreservation lymphocytes on the next day;

(2) extracting total RNA of cat peripheral blood lymphocytes, transferring PBMC in a freezing tube into a 1.5mL centrifuge tube, centrifuging for 5min at 1800rpm, discarding supernatant, leaving 50-100 μ L of supernatant at the bottom of the centrifuge tube, resuspending tube bottom cells, adding 1mL Trizol, repeatedly blowing and beating uniformly by a pipette gun, incubating at room temperature for 5min, adding 0.2mL chloroform, shaking vigorously by hand for 15s, incubating at room temperature for 2-3min, centrifuging at 12000rpm at 4 ℃ for 15min by a refrigerated centrifuge, wherein the liquid can be divided into an organic phase containing DNA and protein at the lower layer and a transparent layer containing RNA at the upper layer, inclining at 45 degrees, transferring the transparent layer into another 1.5mL centrifuge tube, adding 0.5mL isopropanol, mixing, incubating at room temperature for 10min, centrifuging at 12000rpm for 10min, discarding supernatant, adding 1mL 75% ethanol, washing by a vortex oscillator, 7500rpm, 4 ℃, 5min, discarding supernatant, placing the centrifuge tube on a clean bench, standing for 5-10min, resuspending and dissolving with at least 30 μ L DEPC water, measuring concentration and A with ultramicro spectrophotometer₂₆₀And A₂₈₀The ratio is preserved at minus 80 ℃;

(3) cat heavy chain variable region V_HAnd light chain variable region V_LThe amplification of (1) was performed using PrimeScript using the extracted total RNA as a template^TMII 1st Strand cDNA Synthesis Kit reverse transcription of Total RNA into cDNA, PCR amplification of V_HGenes and V_LPreparing 1.5% agarose gel for nucleic acid electrophoresis detection and identification, observing the result in a gel imager, recovering gel, and purifying V_HAnd V_LFragment, using primer of Linker to make heavy chain variable region gene V by SOE-PCR gene engineering method_HRespectively linked with light chain variable region gene V_LLight chain variable region gene V_LAssembly into scFv genes to form V_L-linker-V_HThe form of (1.0%) agarose gel is prepared, and the gel is recovered and purified by observing the result on a gel imagerDigesting and connecting the purified scFv gene product with a phage vector pComb3 XSS;

(4) constructing a single-chain antibody library, performing electric shock transformation on 20 mu L of the ligation product and 80 mu L of electrotransformation competent XLI-Blue under the conditions of 2.5KV and 800 omega, washing an electric rotating cup by using 1mLSOC culture medium, sucking the liquid into a 50mL centrifuge tube, rotating at 220rpm/min and 37 ℃, shaking the bacteria for 45min, respectively coating 10 mu L, 50 mu L and 100 mu L of bacteria liquid on a plate containing Amp + (100 mu g/mL), identifying the electrotransformation effect, adding 9mL of LB liquid culture medium containing Amp + (100 mu g/mL) into the centrifuge tube, and performing electric shock transformation on the mixture by using a reaction solution prepared by mixing the following components in a ratio of 1:1000 adding glucose, 220rpm/min, 37 ℃, shaking to OD₆₀₀0.5, adding 20 mul of helper phage M13K07 for rescue, shaking the bacteria for 1h after infecting for 30min, centrifuging the bacteria liquid at 3000rpm for 6min, discarding the supernatant, adding IPTG (isopropyl thiogalactoside) at 1:1000, 220rpm/min, 37 ℃ and shaking the bacteria for 6h with an LB liquid culture medium containing Amp + (100 mug/mL) and Kana at equal volume, centrifuging the culture medium at 12000rpm for 10-20min, collecting the supernatant, adding PEG8000 at 1:4-1:5, reversing and mixing uniformly, wherein the cloudy precipitate appears, centrifuging at 4 ℃ overnight at 12000rpm for 10min, collecting the precipitate, resuspending the precipitate with 1.5mL1 XPBS, adding PEG8000 at the ratio of 1:4-1:5 again, reversing uniformly, refrigerating at 4 ℃ for 2-3h, 12000rpm, centrifuging for 10min, collecting the precipitate, resuspending the precipitate with 300 mul 1 XPBS, adding 50% glycerol, standing and storing at-20 ℃, the library is built for many times according to the method, and the original library of the scFv phage antibody is built.

Images