CN111848789B

CN111848789B - Single chain antibody for resisting SARS-COV-2 virus S protein and its use

Info

Publication number: CN111848789B
Application number: CN202010633208.2A
Authority: CN
Inventors: 罗绍祥; 易汪雪; 张芳; 王静
Original assignee: Cusabio Biotech Co ltd
Current assignee: Cusabio Biotech Co ltd
Priority date: 2020-07-02
Filing date: 2020-07-02
Publication date: 2022-04-22
Anticipated expiration: 2040-07-02
Also published as: CN111848789A

Abstract

The invention provides a single-chain antibody for resisting SARS-COV-2 virus S protein, the single-chain antibody comprises at least one of single-chain antibody 1 and single-chain antibody 2: single-chain antibody 1: has the sequence shown in SEQ ID NO: 1-SEQ ID NO: 3 and a light chain having three complementarity determining regions of the amino acid sequence set forth in SEQ ID NO: 4-SEQ ID NO: 6, and a light chain of three complementarity determining regions of the amino acid sequence set forth in seq id no; single-chain antibody 2: has the sequence shown in SEQ ID NO: 7-SEQ ID NO: 9 and a light chain having three complementarity determining regions of the amino acid sequence set forth in SEQ ID NO: 10-SEQ ID NO: 12, or a light chain of three complementarity determining regions of the amino acid sequence set forth in seq id no. The invention also provides the use of the single-chain antibody in the preparation of a SARS-COV-2 virus detection reagent kit.

Description

Single chain antibody for resisting SARS-COV-2 virus S protein and its use

Technical Field

The present invention belongs to the field of biotechnology, and relates to a single chain antibody of SARS-COV-2 virus S protein and its application.

Background

Coronavirus is a single-stranded RNA virus that is hosted by mammals and birds. Coronaviruses that can infect humans include 229E, NL63, OC43, HKU1, SARS-CoV and MERS-CoV. These viruses can cause a range of mild seasonal illnesses, or cause severe disease outbreaks, most typically Severe Acute Respiratory Syndrome (SARS) and Middle East Respiratory Syndrome (MERS) caused by SARS-CoV and MERS-CoV. SARS-CoV-2 is a seventh coronavirus capable of infecting humans, which is more contagious than SARS-CoV and MERS-CoV, resulting in a broad outbreak of COVID-19.

Coronaviruses consist of a bilayer lipid envelope containing spike, envelope, membrane and nucleocapsid proteins. Among them, the membrane protein mediates the interaction of the virus with the host ACE2 protein, and SARS-CoV-2 and SARS-CoV use the same invasion receptor. The sequence alignment shows that the amino acid sequence homology of SARS-CoV-2 and SARS-CoV is 80%. The S protein is divided into two subunits of S1 and S2, wherein the function of S1 is to bind to host receptors, and the main function of S2 is to promote fusion of virus and cell membrane. The high affinity of the RBD domain of S1 for binding to ACE2 protein results in rapid spread of the virus in the human population. The S protein is exposed on the surface of the virus, contains a large number of antigenic determinants and can generate protective antibodies against the virus. Therefore, the S protein is the most important target for disease diagnosis and treatment.

The single chain antibody (scFv) is formed by connecting an antibody heavy chain variable region and an antibody light chain variable region through a short peptide (linker) with 15-20 amino acids. Advantages of scFv Single chain antibodies: competitive surface protein of non-specific reaction can be removed, and the background of tumor visualization is clearer; the immunity is small, and the rejection reaction of human anti-mouse can be eliminated; the half-life period of the circulation in the body is short, the clearing is easy, and the detoxification and the discharge are facilitated; is easy to connect with toxin or enzyme gene, and is convenient for directly obtaining immunotoxin or enzyme-labeled antibody, etc.

Therefore, there is a strong need to develop new single chain antibodies for SARS-COV-2.

Disclosure of Invention

In order to solve the technical problem, the invention provides a single-chain antibody of SARS-COV-2 virus S protein and the application thereof, which can specifically identify RBD protein, and the EC50 of the single-chain antibody combined with the RBD is 0.4212 ng/ml-325.24 ng/ml.

In a first aspect, the present invention provides a single chain antibody against SARS-COV-2 virus S protein, which single chain antibody recognizes the RBD domain of SARS-COV-2 virus S protein, the single chain antibody comprising at least one of single chain antibody 1 and single chain antibody 2:

single-chain antibody 1: comprises a polypeptide with the sequence shown in SEQ ID NO: 1-SEQ ID NO: 3 and a light chain having three complementarity determining regions of the amino acid sequence set forth in SEQ ID NO: 4-SEQ ID NO: 6, and a light chain of three complementarity determining regions of the amino acid sequence set forth in seq id no;

single-chain antibody 2: comprises a polypeptide with the sequence shown in SEQ ID NO: 7-SEQ ID NO: 9 and a light chain having three complementarity determining regions of the amino acid sequence set forth in SEQ ID NO: 10-SEQ ID NO: 12, or a light chain of three complementarity determining regions of the amino acid sequence set forth in seq id no.

Further, the single chain antibody includes one or more of the following single chain antibodies:

h6 single chain antibody: comprises a polypeptide with the sequence shown in SEQ ID NO: 13 and a light chain having the amino acid sequence set forth in SEQ ID NO: 14, a light chain of an amino acid sequence set forth in seq id no;

d2 single chain antibody: comprises a polypeptide with the sequence shown in SEQ ID NO: 15 and a light chain having the amino acid sequence set forth in SEQ ID NO: 16, or a light chain of the amino acid sequence set forth in seq id no.

Further, the single chain antibody against SARS-COV-2 virus S protein further comprises: the H6 single-chain antibody and the D2 single-chain antibody have the same functions obtained by substituting, deleting and/or adding one or more amino acids in the amino acid sequences.

Further, the single chain antibody against SARS-COV-2 virus S protein further comprises: the H6 single-chain antibody and the D2 single-chain antibody are obtained by connecting labels at the N end and/or the C end.

In a second aspect, the invention provides a nucleic acid molecule encoding said single chain antibody.

Further, the nucleic acid molecule includes a nucleotide molecule encoding the single-chain antibody 1 and/or a nucleotide molecule encoding the single-chain antibody 2.

Further, the nucleotide sequence of the nucleotide molecule encoding the heavy chain of the single-chain antibody 1 is shown as SEQ ID NO: 17, and the nucleotide sequence of the nucleotide molecule for encoding the light chain of the single-chain antibody 1 is shown as SEQ ID NO: 18 is shown in the figure; the nucleotide sequence of the nucleotide molecule for encoding the heavy chain of the single-chain antibody 2 is shown as SEQ ID NO: 19, and the nucleotide sequence of the nucleotide molecule for encoding the light chain of the single-chain antibody 2 is shown as SEQ ID NO: shown at 20.

In a third aspect, the invention provides a biological material containing the nucleic acid molecule, wherein the biological material comprises recombinant DNA, a plasmid vector, a phage vector, a viral vector, an engineered bacterium or a transgenic cell line.

In a fourth aspect, the present invention provides a recombinant antibody, wherein the recombinant antibody comprises a single chain antibody against SARS-COV-2 virus S protein and a human Fc fragment, and the amino acid sequence of the human Fc fragment is as shown in SEQ ID NO: shown at 21.

In the fifth aspect, the invention provides the single chain antibody of the S protein RBD structural domain of the SARS-COV-2 virus and the application of the recombinant antibody in the preparation of drugs for inhibiting SARS-COV-2 virus infection, and the preparation of SARS-COV-2 virus reagents or kits.

In the sixth aspect, the invention provides a SARS-COV-2 virus detection reagent or kit, comprising the single-chain antibody of the S protein RBD structural domain of the SARS-COV-2 virus or the recombinant antibody.

One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

the single-chain antibody of the S protein of the SARS-COV-2 virus provided by the invention has the EC50 combined with the S1 protein of 42.83ng/ml and 245.13ng/ml respectively; the EC50 of the single-chain antibody combined with the RBD protein is 29.51ng/ml and 152.45ng/ml respectively; the single-chain antibody competes with a virus receptor ACE2 protein, IC50 is 23.32ng/ml and 125.45ng/ml respectively, and the single-chain antibody has the capacity of inhibiting virus infection. The SARS-COV-2 virus detection kit provided by the invention comprises the single-chain antibody or the recombinant antibody composed of the single-chain antibody and the humanized Fc fragment, and has strong specificity and high sensitivity.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIG. 1 is a graph of the binding of the recombinant H6 antibody to the S1 protein in example 3;

FIG. 2 is a graph showing the binding of H6 recombinant antibody to RBD protein in example 4;

FIG. 3 is the competition of the H6 recombinant antibody with ACE2 protein in example 5;

FIG. 4 shows the sensitivity of the single-chain antibody when applied to a colloidal gold assay kit.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

In order to solve the technical problems, the embodiment of the invention provides the following general ideas:

the S protein is exposed on the surface of the virus, contains a large number of antigenic determinants, can generate protective antibodies against the virus, and is a main antigen for vaccine development and neutralizing antibody development. Meanwhile, due to the strong immunogenicity, a large amount of antibodies can be generated in the virus body, and the antibody is also an important raw material for developing a diagnostic kit.

The natural antibody library is suitable for screening various antigens, a mouse is not required to be singly immunized, and the antibody for identifying the target protein can be screened within one week by combining a high-throughput screening scheme of a phage display technology. This study used recombinant expressed S protein to screen the natural antibody library of mice, and obtained 2 strains of single chain antibodies that can specifically recognize S protein:

h6 single chain antibody: comprises a polypeptide with the sequence shown in SEQ ID NO: 13 and a light chain having the amino acid sequence set forth in SEQ ID NO: 14, a light chain of an amino acid sequence set forth in seq id no; the heavy chain has the amino acid sequence of SEQ ID NO: 1-SEQ ID NO: 3, and the light chain has the amino acid sequence set forth in SEQ ID NO: 4-SEQ ID NO: 6, and (b) three complementarity determining regions of the amino acid sequence set forth in figure 6.

D2 single chain antibody: comprises a polypeptide with the sequence shown in SEQ ID NO: 15 and a light chain having the amino acid sequence set forth in SEQ ID NO: 16, or a light chain of the amino acid sequence set forth in seq id no. The heavy chain has the amino acid sequence of SEQ ID NO: 7-SEQ ID NO: 9, and the light chain has the amino acid sequence shown in SEQ ID NO: 10-SEQ ID NO: 12, or a sequence of three complementarity determining regions of the amino acid sequence set forth in seq id no.

The amino acid sequences of the CDR regions of the single chain antibody are shown in table 1 below:

TABLE 1

Therefore, single-chain antibodies having the heavy chain complementarity determining regions CDR1-CDR3 and light chain complementarity determining regions CDR1-CDR3 of the H6 single-chain antibody, and single-chain antibodies having the heavy chain complementarity determining regions CDR1-CDR3 and light chain complementarity determining regions CDR1-CDR3 of the D2 single-chain antibody are also within the scope of the present invention, i.e., the single-chain antibody 1-single-chain antibody 2 of the present invention.

The single-chain antibodies can be specifically combined with an RBD region of an S protein of a novel coronavirus SARS-COV-2 through experimental verification, and EC50 of the combination of an H6 recombinant antibody and a D2 recombinant antibody with an S1 protein is 42.83ng/ml and 245.13ng/ml respectively; the EC50 of the H6 recombinant antibody and the D2 recombinant antibody combined with the RBD protein is 29.51ng/ml and 152.45ng/ml respectively. The H6 recombinant antibody and the D2 recombinant antibody compete with the virus receptor ACE2 protein, IC50 is 23.32ng/ml and 125.45ng/ml respectively, and the antibodies have the capacity of inhibiting virus infection.

In addition, the invention also relates to a recombinant antibody obtained after recombining the single-chain antibody;

the single-chain antibody or the recombinant antibody is used for a colloidal gold detection kit of SARS-COV-2 virus, and has strong specificity, high accuracy and high sensitivity.

The effects of the present application will be described in detail below with reference to examples and experimental data.

EXAMPLE 1 obtaining Single chain antibodies

1. Construction of phage display antibody libraries

(1) Taking a 15ml centrifuge tube, firstly adding a separation solution with the same amount as the blood sample, carefully sucking the blood sample and adding the blood sample on the liquid surface of the separation solution, and centrifuging for 20-30min at 450-; after centrifugation, the centrifuge tube is divided into four layers from top to bottom, namely a plasma layer, an annular milky white lymphocyte layer, a transparent separation liquid layer and a red blood cell layer; carefully sucking the second annular milky white lymphocyte layer into another 15ml centrifuge tube by using a pipette; adding 10ml of cleaning solution into the obtained centrifugal tube, uniformly mixing the cells, centrifuging for 10min at 250 Xg; after centrifugation, the supernatant is clarified, and the centrifugation time is prolonged if the supernatant is not clarified; cells were washed 2 times with 1xPBS and lysed by addition of trizol and stored at-80 ℃.

(2) Thawing the peripheral lymphocyte lysate preserved at-80 ℃ at room temperature; adding 0.2ml chloroform, covering, shaking vigorously for 15s, standing at room temperature for 2min, and centrifuging at 12000g and 4 deg.C for 15 min; carefully transferring the supernatant into another centrifuge tube, adding isopropanol with the same volume, uniformly mixing, and standing at room temperature for 10 min; centrifuging at 12000g at 4 deg.C for 15 min; centrifuging, removing supernatant, rinsing precipitate with 75% ethanol, and centrifuging at 12000g at 4 deg.C for 5 min; centrifuging, removing supernatant, placing the centrifuge tube at room temperature, and dissolving RNA in RNase-free water after drying; a small amount of dissolved RNA is taken out and is run on agarose gel, and the concentration is measured to judge whether the RNA is degraded or not.

(3) Total RNA was removed from-80 ℃ and thawed on ice; opening the secondary structure of RNA at 65 ℃ for 5min on a PCR instrument; placing on ice for 2 min; sequentially adding buffer, reverse transcriptase and primer at 37 ℃ for 15min and at 98 ℃ for 5 min; verifying the obtained cDNA by using an internal reference primer; storage at-20 deg.C (-80 deg.C for long term). Preparing a PCR reaction system, and amplifying heavy chain and light chain variable regions of the antibody from cDNA by using mouse antibody library primers (the primer sequences are shown in Table 2);

PCR conditions of 94 ℃ for 4min, (94 ℃ for 30s, 54 ℃ for 30s, 72 ℃ for 1min)25 cycles, 72 ℃ for4 min; the PCR product is analyzed by 2% agarose gel electrophoresis, a target band of about 350bp is cut off, and a target fragment amplification product is recovered by using a gel recovery column.

The antibody genes recovered from the heavy chain and the light chain are respectively added with a linker (GGTGGAGGCGGCTGTGGCGGTGGCAGTGGCGGCGGAGGTTCT) by a PCR method, after running and recovering, the antibody genes are mixed according to equal mass, enzyme cutting site primers (Sfi I and Not I are selected as enzyme cutting sites), and the heavy chain and the light chain are connected by the linker through PCR amplification reaction (the reaction condition is the same as the PCR reaction condition for amplifying the variable regions of the heavy chain and the light chain of the antibody from cDNA).

Reagents were added to the PCR tube as follows:

carrying out Sfi I enzyme digestion on a PCR instrument overnight at 50 ℃; taking out, cooling to room temperature, and continuously adding the following components into the system:

10xBuffer 5uL

NotⅠ 1ul

adding water to 50ul

Preserving the temperature on a PCR instrument at 37 ℃ overnight for Not I enzyme digestion; running 1.5% agarose gel, cutting, recovering target fragment with Tiangen DNA recovery kit, subpackaging, and freezing at-20 deg.C; preparing a reaction system, and connecting the antibody gene into the pCANTAB5E vector after enzyme digestion.

The connection system was formulated as follows

Ligation was performed overnight at 16 ℃ on a PCR instrument.

Streaking a minimum plate at 37 ℃ for overnight culture; inoculating single TG1 colony to 5mL2YT culture solution, and performing shaking culture at 37 ℃ overnight; adding 5mL of the overnight inoculated culture solution into 300mL of 2YT culture solution the next day, and performing shaking culture until OD600 reaches 0.4-0.5; after the bacterial liquid is subjected to ice bath for 30min, centrifuging the bacterial liquid in a precooled centrifuge at 4000g for 15min at 4 ℃; gently resuspending the precipitate in ice water with 300mL of pre-cooled sterile deionized water until the precipitated cells are completely and uniformly dispersed in the water; centrifuging at 4000g for 15min at 4 ℃ in a precooled centrifuge; resuspending the cells twice as described above sequentially with 150mL of pre-chilled sterile deionized water and 30mL of pre-chilled 10% glycerol (prepared with sterile deionized water); finally, resuspending the cells in 1mL of pre-cooled 10% glycerol, and placing on ice for immediate use or subpackaging; freezing at-80 deg.C; adding 5uL of the ligation product into 100uL of competence, placing on ice for precooling, and transferring into a precooled electric rotor cup; adjusting the voltage of an electrotransformation machine to 2.5KV, shocking for 5ms, quickly adding 0.9ml of 2YT culture medium after shocking, and carrying out shake culture at 37 ℃ for 1.5 hours; and (3) taking 10uL of the diluted gradient, coating the diluted gradient on an SOBAG plate, calculating the storage capacity, coating the rest bacterial liquid on 10 SOBAG plates, and culturing at 37 ℃ overnight.

Counting the colonies subjected to gradient dilution, and calculating the storage capacity of the antibody library built this time; randomly picking 20 clones from the SOBAG plate, and detecting the efficiency of the antibody gene insertion into the vector by colony PCR; 20 randomly selected clones were subjected to sequencing analysis to detect the antibody library capacity, and the integrity and diversity of antibody genes.

2. Antibody library displayed on rescue phage surface

The constructed natural antibody library of the mouse is stored in a host bacterium in the form of phagemid, and the library should be rescued to become the antibody library displayed by phage before the panning process is started. The specific method comprises the following steps:

1.5mL of E-tag-labeled antibody library was inoculated into 300mL of 2YT-AG medium to OD_600nmAbout 0.3 to about 0.4; shaking culture at 37 deg.C for about 1.5h to OD_600nm＝0.5-0.6; according to the bacteria: adding helper phase helper phage (M13K07) to the phase 1:5, and culturing at 37 ℃ for about 1h with shaking; centrifuging at 4000rpm and 15 deg.C for 15min, and removing culture medium; adding 200mL of 2YT-AK (100. mu.g/mL Amp, 50. mu.g/mL Kan) culture medium to resuspend the bacteria, and culturing at 37 ℃ for 2 h; centrifuging at 10000rpm for 20min to remove precipitate; adding 40mL of PEG/NaCl into the supernatant to precipitate phage, and carrying out ice bath overnight; centrifuging at 10000rpm for 20min, and removing supernatant; culture with 0.6mL 2YTThe culture medium was suspended in phase at 4 ℃ for use. If large amounts of phase are required, the culture time is extended from two hours to overnight culture after changing the kan resistant medium. The obtained phage were subjected to gradient dilution, infected with TG1 bacteria, coated with SOBAG plates, and phage pool titers were calculated by colony counting.

3. Panning Single chain antibodies

In the experiment, His Bind to Resin and antigen protein are utilized to pan the antibody from the phage displayed antibody library, and the specific process is as follows: activation of His Bind Resin: putting 200 mu L of His Bind Resin into a 1.5mL centrifuge tube, centrifuging for 1min at 1000g, and removing the preservation solution; add 200. mu.L of ddH₂Cleaning the resin once, centrifuging for 1min at 1000g, removing the supernatant, and repeating the step once; adding 200 μ L of ionized buffer solution, resuspending the resin, standing for 10min, centrifuging to remove supernatant; adding 200 μ L binding buffer solution, resuspending the resin, and standing for 10 min; add 40. mu.L of the resin to a 1.5mL centrifuge tube and centrifuge to remove the supernatant.

4. Panning and recognizing single-chain antibody of target protein

Adding 35 μ L (about 10 μ g) of purified S1 protein into 165 μ L PBS, mixing, adding into EP tube filled with activated resin, mixing for 1h, centrifuging for 1min at 1000g, and removing supernatant; add 200. mu.L of rinsing buffer, resuspend the resin, centrifuge at 1000g for 1min, remove the supernatant and repeat this step once. Taking 300 mu L of the rescued phage display antibody library solution, adding 0.3 mu L of Triton X-100, and gently mixing by using a micropipette; adding 40 mu L of unactivated resin, and slightly rotating for reaction for1 h; centrifuging at 1000g for 1min, collecting supernatant, adding 40 μ L resin coated with antigen protein, and slightly rotating for 2 hr; centrifuging at 1000g for 1min, and removing supernatant; adding 500 μ L of rinsing buffer (containing 0.1% Triton X-100), resuspending the resin, rinsing with gentle shaking for 5min, centrifuging at 1000g for 1min, removing supernatant, and repeating this step for 5 times;

adding 500 μ L of rinsing buffer (0.1% Tween-20), resuspending the resin, rinsing with gentle shaking for 5min, centrifuging at 1000g for 1min, removing supernatant, and repeating the steps for 5 times; after the last rinsing, the resin was transferred to a new EP tube, centrifuged at 1000g for 1min and the supernatant removed; adding 200 μ L elution buffer, and slightly rotating for 20 min; centrifuging for 1min at 1000g, taking supernatant, adding into 5mL TG1 bacterial liquid, and infecting for 1h at 37 ℃; coating the infected bacterial liquid on an SOBAG plate, and performing inverted culture at 30 ℃ overnight; the next day, colonies on the plates were scraped with 2YT-AG medium and rescued as phages for the next round of panning.

5. Selection of positive clones recognizing the protein S1

Randomly picking single colony from the SOBAG plate and inoculating the single colony into a 96-well bacterial culture plate, adding 200 μ L of 2YT-AG into each well, and culturing at 37 ℃ overnight; sucking 25 μ L bacterial liquid into a new bacterial culture plate, adding 175 μ L2YT-AG culture medium, and culturing at 37 deg.C for 3 hr; centrifuging at 3500rpm for 10min, removing supernatant, resuspending the bacterial pellet in 200 μ L2 YT-AI (100 μ g/mL Amp, 1mM IPTG) culture medium, and inducing at 30 deg.C overnight; centrifuging at 3500rpm for 10min, and storing the supernatant at 4 deg.C; adding the purified target protein into an ELISA plate, and coating overnight at 4 ℃; after the coating solution was decanted, the cells were washed 3 times with PBS and blocked with 4% PBSM (PBS containing 4% skim milk) for1 h; after washing with PBS for1 time, adding more than 50 μ L of the prepared single-chain antibody supernatant and 50 μ L of 4% PBSM to each well, and reacting for 1h at 37 ℃; after washing 3 times with PBS and PBST, 100. mu.L anti-E/HRP conjugation (diluted 1: 5000 with 4% PBSM) was added to each well and incubated at 37 ℃ for1 h; washing with PBST and PBS three times, adding 100 μ L TMB substrate solution, reacting for 15min in dark, adding 25 μ L2 mol/L H₂SO₄The reaction was terminated and OD was measured with a microplate reader_450nmThe value determines the concentration of the protein of interest.

6. Positive clone sequencing and sequence analysis

And (3) identifying the target protein with a larger OD450nm value obtained by the panning through ELISA, sequencing the positive monoclonal Cherey-fed forward, and using a sequencing universal primer S1: 5'-GACCATGATTACGCCAAGC-3', the variable regions of the heavy and light chains of the antibody were sequenced using DNAstar and Clustalw1.8, and 2 different antibodies were finally obtained:

TABLE 2

In table 2, H denotes a heavy chain, K denotes a light chain, M denotes a mouse, V denotes a variable region, the MHV is for amplifying the heavy chain, MKV is for amplifying the light chain, back and for denote upstream and downstream, respectively, any one of mhv.back1 to mhv.back10 and any one of mhv.forth 1 to mhv.forth 4 constitute a pair of primer pairs for amplifying the heavy chain; any one of MKV, BACK1-MKV, BACK10 and any one of MKV, FOR1-MKV, FOR4 form a pair of primer pairs for amplifying hydrogen chains.

Example 2 antibody expression

1. Construction of recombinant expression vectors

Amplifying antibody genes by using primers according to a sequencing result; 5'-GCGGCCCAGCCGGCCATGGCC-3', the upstream gene is as follows, and the downstream primer is as follows: 5'-ACCGGCGCACCTGCGGCCGC-3', respectively; the antibody gene is subjected to double enzyme digestion by sfiI and NotI, inserted into an antibody expression vector pSecTag2A-fc, and extracted into a plasmid by using a plasmid extraction kit. The pSecTag2A-Fc is transformed by pSecTag2A (Thermo Fisher, V90020), a humanized IgG1 Fc gene is inserted into the enzyme cutting sites of hind III and BamH I of the vector, and the amino acid sequence of the humanized Fc fragment is shown as SEQ ID NO: shown at 21).

2. Expression of fusion proteins

All reagents were left at room temperature for 10 minutes prior to transfection,the following operations used 6-well petri dishes; diluting 3 mu g of plasmid DNA to 250 mu L of serum-free DMEM medium, and blowing and sucking for 3-4 times by using a pipette gun; diluting 5 mu L of LPEI reagent into 250 mu L of serum-free DMEM medium, and blowing and sucking for 3-4 times by using a pipette gun; note that: the serum-free DMEM medium is a diluent, DNA can not be carried out by using the serum-containing medium, the diluted PEI transfection reagent is added into the diluted plasmid DNA at one time, and the diluted PEI transfection reagent is blown and sucked by a pipette 3-4 times; standing at room temperature for 10-15 minutes to form PEI-DNA complex; counting and plating of cells 18-24 hours before transfection to achieve around 80% confluence of adherent cells at the time of transfection; discarding the original culture medium in the wells, and adding 1ml of fresh DMEM complete culture medium; preparing a PEI-DNA complex; uniformly dripping the PEI-DNA mixed solution into a cell culture medium, and slightly performing cross motion to uniformly disperse the PEI-DNA compound; petri dish with 5% CO₂And collecting cells after 72 hours in a constant temperature incubator at 37 ℃ and detecting the protein expression amount. 100ml of cells were transformed in the same ratio and the recombinantly expressed antibody was purified. The supernatant was purified by affinity chromatography and analyzed by SDS-PAGE electrophoresis, and the activity of the purified recombinant antibody was preliminarily determined by indirect competitive ELISA. The target protein expression can be further improved by optimizing induction expression conditions (such as host bacteria, expression vectors, induction culture time, temperature, IPTG concentration and the like), and a way is provided for large-scale preparation and recombination.

Example 3 binding of recombinant antibodies to S1 protein

The 2-strain single-chain antibody obtained by screening in example 1: h6 single-chain antibody and D2 single-chain antibody, after the expression of example 2, the obtained H6 recombinant antibody and D2 recombinant antibody are respectively combined with S1, the EC50 value of the combination of the antibodies and S1 is detected, and S1 protein coats a microplate according to 2 mug/ml; the results are shown in Table 3.

TABLE 3

Group of	EC50
		H6 recombinant antibody	42.83ng/ml
D2 recombinant antibody	245.13ng/ml

As shown in Table 2, the EC50 of the H6 recombinant antibody and the D2 recombinant antibody were 42.83ng/ml and 245.13ng/ml, respectively.

Example 4 binding of recombinant antibodies to RBD proteins

The 2-strain single-chain antibody obtained by screening in example 1: h6 single-chain antibody and D2 single-chain antibody, after the expression of example 2, the obtained H6 recombinant antibody and D2 recombinant antibody are respectively combined with RBD, the EC50 value of the combination of the antibodies and the RBD is detected, and RBD protein coats a microporous plate according to 2 mu g/ml; the results are shown in Table 4.

TABLE 4

Group of	EC50
		H6 recombinant antibody	29.51ng/ml
D2 recombinant antibody	152.45ng/ml

As can be seen from Table 3, the EC50 of the H6 recombinant antibody and the D2 recombinant antibody were 29.51ng/ml and 152.45ng/ml, respectively.

Example 5 Competition of recombinant antibodies with ACE2 protein

The 2-strain single-chain antibody obtained by screening in example 1: after the H6 single-chain antibody and the D2 single-chain antibody are expressed in the embodiment 2, the obtained H6 recombinant antibody and the D2 recombinant antibody are respectively combined with ACE2, the H6 recombinant antibody and the D2 recombinant antibody detect the EC50 value combined with ACE2, and ACE2 protein coats a microporous plate according to 2 mu g/ml. OD450nm values were determined and anti-IC 50 values for H6 recombinant antibody and D2 recombinant antibody are shown in table 5.

TABLE 5

Group of	IC50
		H6 recombinant antibody	23.32ng/ml
D2 recombinant antibody	125.45ng/ml

As can be seen from Table 3, the IC50 of the H6 recombinant antibody and the D2 recombinant antibody were 23.32ng/ml and 125.45ng/ml, respectively.

Example 6 application of recombinant antibodies to colloidal gold detection

The purified H6 recombinant antibody was diluted at 28571ng/ml, 7142ng/ml, 1875ng/ml, 446.4ng/ml, 223.2ng/ml and loaded with 70. mu.L to the colloidal gold assay card. FIG. 4 shows the sensitivity results of the application of H6 recombinant antibody as a quality control antibody to a colloidal gold assay kit, and it can be seen from FIG. 4 that all assay cards have normal C-line and weakened T-line with the dilution of antibody gradient, indicating that H6 recombinant antibody can recognize S1 protein and the assay signal is reduced with the increase of dilution ratio and has high sensitivity.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Wuhan Huamei bioengineering Co., Ltd

<120> single-chain antibody against SARS-COV-2 virus S protein and use thereof

<160> 48

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Gly Phe Asn Ile Lys Asp Thr Tyr

1 5

<210> 2

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Ile Asp Pro Glu Asn Gly Asn Thr

1 5

<210> 3

<211> 12

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Ala Arg Gly Gly Gly Tyr Asp Pro Trp Phe Ala Tyr

1 5 10

<210> 4

<211> 6

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Gln Asn Val Gly Thr Asn

1 5

<210> 5

<211> 3

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Trp Ala Ser

1

<210> 6

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Gln Gln Tyr Asn Ser Tyr Pro Tyr Met Tyr Thr

1 5 10

<210> 7

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Gly Tyr Ala Phe Ser Ser Tyr Trp

1 5

<210> 8

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Ile Tyr Pro Gly Asp Gly Asp Thr

1 5

<210> 9

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Phe Thr Ala Thr Phe Ala Met Asp Tyr

1 5

<210> 10

<211> 6

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Gln Asp Val Gly Thr Ala

1 5

<210> 11

<211> 3

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Trp Ala Ser

1

<210> 12

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Gln Gln Tyr Ser Ile Tyr Pro Tyr Thr

1 5

<210> 13

<211> 119

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 13

Glu Val Lys Leu Leu Glu Ser Gly Ala Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile Lys Asp Thr

20 25 30

Tyr Met His Trp Val Lys Gln Arg Pro Glu Gln Gly Leu Glu Trp Ile

35 40 45

Gly Trp Ile Asp Pro Glu Asn Gly Asn Thr Ile Tyr Asp Pro Lys Phe

50 55 60

Gln Gly Lys Ala Ser Ile Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr

65 70 75 80

Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Gly Tyr Asp Pro Trp Phe Ala Tyr Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Thr

115

<210> 14

<211> 108

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 14

Thr Val Met Thr Gln Ser Gln Lys Phe Met Ser Thr Ser Val Gly Asp

1 5 10 15

Arg Val Ser Val Thr Cys Lys Ala Ser Gln Asn Val Gly Thr Asn Val

20 25 30

Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr

35 40 45

Trp Ala Ser Thr Arg His Thr Gly Val Pro Asp Arg Phe Thr Gly Ser

50 55 60

Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Val Gln Ser Glu

65 70 75 80

Asp Leu Ala Glu Tyr Phe Cys Gln Gln Tyr Asn Ser Tyr Pro Tyr Met

85 90 95

Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 15

<211> 116

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 15

Glu Val Lys Leu Gln Gln Ser Gly Gly Gly Leu Leu Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ala Phe Ser Ser Tyr

20 25 30

Trp Met Asn Trp Val Lys Gln Arg Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Gln Ile Tyr Pro Gly Asp Gly Asp Thr Asn Tyr Asn Gly Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Asn Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Thr Glu Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Phe Thr Ala Thr Phe Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val

100 105 110

Thr Val Ser Thr

115

<210> 16

<211> 107

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 16

Asp Val Val Met Thr Gln Ser His Lys Phe Met Ser Thr Ser Val Gly

1 5 10 15

Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asp Val Gly Thr Ala

20 25 30

Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile

35 40 45

Tyr Trp Ala Ser Thr Arg His Thr Gly Val Pro Asp Arg Phe Thr Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Val Gln Ser

65 70 75 80

Glu Asp Leu Ala Asp Tyr Phe Cys Gln Gln Tyr Ser Ile Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 17

<211> 357

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gaggtgaagc tgctggagtc tggggcagag cttgtgaagc caggggcctc agtcaagttg 60

tcctgcacag cttctggctt caacattaaa gacacctata tgcactgggt gaagcagagg 120

cctgaacagg gcctggagtg gattggatgg attgatcctg agaatggtaa tactatatat 180

gacccgaagt tccagggcaa ggccagtata acagcagaca catcctccaa cacagcctat 240

atggaacttg ccagactgac atctgaggat tctgccatct attactgtgc aagaggaggg 300

gggtatgatc cctggtttgc ttactggggc caagggactc tggtcaccgt gtcgaca 357

<210> 18

<211> 324

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

acggtgatga cccagtctca aaaattcatg tccacatcag taggagacag ggtcagcgtc 60

acctgcaagg ccagtcagaa tgtgggtact aatgtagcct ggtatcaaca gaaaccaggg 120

caatctccta aactactgat ttactgggca tccacccggc acactggagt ccctgatcgc 180

ttcacaggca gtggatctgg gacagatttc actctcacca ttagcaatgt gcagtctgaa 240

gacttggcag agtatttctg tcagcaatat aacagctatc cgtacatgta cacgttcgga 300

ggggggacca agctggaaat caag 324

<210> 19

<211> 348

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gaggtgaagc tgcagcagtc tgggggaggc ttactgaagc ctggggcctc agtgaagatt 60

tcctgcaaag cttctggcta cgcattcagt agctactgga tgaactgggt gaagcagagg 120

cctggaaagg gtcttgagtg gattggacag atttatcctg gagatggtga tactaactac 180

aacggaaagt tcaagggcaa ggccacactg actgcagaca aatcctccaa cacagcctac 240

atgcaactca gcagcctgac aactgaggac tctgccatct attactgttt tacggctacg 300

tttgctatgg actactgggg tcaaggaacc tcagtcaccg tgtcgaca 348

<210> 20

<211> 321

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gacgtcgtga tgacccagtc tcacaaattc atgtccacat cagtaggaga cagggtcagc 60

atcacctgca aggccagtca ggatgtgggt actgctgtag cctggtatca acagaaacca 120

ggacaatctc ctaaactact gatttactgg gcatccaccc ggcacactgg agtccctgat 180

cgcttcacag gcagtggatc tgggacagat ttcactctca ccattagcaa tgtgcagtct 240

gaagacttgg cagattattt ctgtcagcaa tatagcatct atccgtacac gttcggaggg 300

gggaccaagc tggaaatcaa g 321

<210> 21

<211> 232

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 21

Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala

1 5 10 15

Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro

20 25 30

Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val

35 40 45

Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val

50 55 60

Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln

65 70 75 80

Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln

85 90 95

Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala

100 105 110

Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro

115 120 125

Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr

130 135 140

Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser

145 150 155 160

Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr

165 170 175

Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr

180 185 190

Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe

195 200 205

Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys

210 215 220

Ser Leu Ser Leu Ser Pro Gly Lys

225 230

<210> 22

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ttattactcg cggcccagcc ggccatggcc gatgtgaagc ttcaggagtc 50

<210> 23

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ttattactcg cggcccagcc ggccatggcc caggtgcagc tgaaggagtc 50

<210> 24

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ttattactcg cggcccagcc ggccatggcc caggtgcagc tgaagcagtc 50

<210> 25

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

ttattactcg cggcccagcc ggccatggcc caggttactc tgaaagagtc 50

<210> 26

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

ttattactcg cggcccagcc ggccatggcc gaggtccagc tgcaacaatc t 51

<210> 27

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ttattactcg cggcccagcc ggccatggcc gaggtccagc tgcagcagtc 50

<210> 28

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

ttattactcg cggcccagcc ggccatggcc caggtccaac tgcagcagcc t 51

<210> 29

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ttattactcg cggcccagcc ggccatggcc gaggtgaagc tggtggagtc 50

<210> 30

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

ttattactcg cggcccagcc ggccatggcc gaggtgaagc tggtggaatc 50

<210> 31

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

ttattactcg cggcccagcc ggccatggcc gatgtgaact tggaagtgtc 50

<210> 32

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tgaaccgcct ccacctgcag agacagtgac cagagt 36

<210> 33

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

tgaaccgcct ccacctgagg agactgtgag agtggt 36

<210> 34

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

tgaaccgcct ccacctgagg agacggtgac tgaggt 36

<210> 35

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

tgaaccgcct ccacctgagg agacggtgac cgtggt 36

<210> 36

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

tctggcggtg gcggatcgga tgttttgatg acccaaact 39

<210> 37

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

tctggcggtg gcggatcgga tattgtgatg acgcaggct 39

<210> 38

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tctggcggtg gcggatcgga tattgtgata acccag 36

<210> 39

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

tctggcggtg gcggatcgga cattgtgctg acccaatct 39

<210> 40

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

tctggcggtg gcggatcgga cattgtgatg acccagtct 39

<210> 41

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

tctggcggtg gcggatcgga tattgtgcta actcagtct 39

<210> 42

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

tctggcggtg gcggatcgga tatccagatg actcagtct 39

<210> 43

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

tctggcggtg gcggatcgga catccagctg actcagtct 39

<210> 44

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

tctggcggtg gcggatcgca aattgttctc acccagtct 39

<210> 45

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

atgagttttt gttctgcggc cgcccgtttc agctccagct tg 42

<210> 46

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

atgagttttt gttctgcggc cgcccgtttt atttccagct tggt 44

<210> 47

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

atgagttttt gttctgcggc cgcccgtttt atttccaact ttg 43

<210> 48

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

atgagttttt gttctgcggc cgcggataca gttggtgcag catc 44

Claims

1. A single chain antibody against the S protein of SARS-COV-2 virus, said single chain antibody recognizing the RBD domain of the S protein of SARS-COV-2 virus, said single chain antibody comprising at least one of single chain antibody 1 and single chain antibody 2:

2. The single chain antibody against SARS-COV-2 virus S protein of claim 1, wherein the single chain antibody comprises one or more of the following single chain antibodies:

3. The single-chain antibody against SARS-COV-2 virus S protein according to claim 2, wherein the single-chain antibody against SARS-COV-2 virus S protein further comprises: the H6 single-chain antibody and the D2 single-chain antibody are obtained by connecting labels at the N end and/or the C end.

4. A nucleic acid molecule encoding the single chain antibody of any one of claims 1 to 3.

5. The nucleic acid molecule according to claim 4, wherein said nucleic acid molecule comprises a nucleotide molecule encoding said single-chain antibody 1 and/or a nucleotide molecule encoding said single-chain antibody 2.

6. A biological material comprising a nucleic acid molecule according to any one of claims 4 to 5, wherein the biological material comprises recombinant DNA, a plasmid vector, a phage vector, a viral vector, an engineered bacterium or a transgenic cell line.

7. A recombinant antibody, which consists of a single chain antibody against the S protein of SARS-COV-2 virus according to any one of claims 1 to 3 and a human Fc fragment, the amino acid sequence of which is as shown in SEQ ID NO: shown at 21.

8. Use of the single-chain antibody of the S protein RBD domain of SARS-COV-2 virus according to any one of claims 1-3 or the recombinant antibody according to claim 7 in the preparation of a reagent or a kit for detecting SARS-COV-2 virus.

9. A reagent or a kit for detecting SARS-COV-2 virus, comprising a single-chain antibody of the RBD domain of the S protein of SARS-COV-2 virus according to any one of claims 1 to 3 or a recombinant antibody according to claim 7.