CN111848788B - Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules - Google Patents

Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules Download PDF

Info

Publication number
CN111848788B
CN111848788B CN202010662681.3A CN202010662681A CN111848788B CN 111848788 B CN111848788 B CN 111848788B CN 202010662681 A CN202010662681 A CN 202010662681A CN 111848788 B CN111848788 B CN 111848788B
Authority
CN
China
Prior art keywords
antibody
phage
feline calicivirus
variable region
chain variable
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010662681.3A
Other languages
Chinese (zh)
Other versions
CN111848788A (en
Inventor
曲雪婷
尹燕博
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Bolong Gene Engineering Co ltd
Original Assignee
Qingdao Bolong Gene Engineering Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Bolong Gene Engineering Co ltd filed Critical Qingdao Bolong Gene Engineering Co ltd
Priority to CN202010662681.3A priority Critical patent/CN111848788B/en
Publication of CN111848788A publication Critical patent/CN111848788A/en
Application granted granted Critical
Publication of CN111848788B publication Critical patent/CN111848788B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/005—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention belongs to the technical field of virus antibodies, and discloses a feline calicivirus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof, wherein the sequence is as follows: heavy chain variable region amino acid sequence SEQ ID NO:1 and the nucleotide sequence SEQ ID NO:3; light chain variable region amino acid sequence SEQ ID NO:2 and the nucleotide sequence SEQ ID NO:4. the screening method of the virus antibody sequence comprises the following steps: preparing a phage antibody; panning of a phage antibody library; identifying a cat source Phage single-chain antibody of the anti-feline calicivirus by a Phage ELISA method; sequencing scFv bacterial liquid with positive Phage ELISA identification result by sequencing company to obtain heavy chain and light chain variable region sequences. The invention provides support for constructing the gene engineering antibody of the cat humanized anti-feline calicivirus with high affinity and low immunogenicity, and has important significance for promoting the development of cat humanized antibody medicaments.

Description

Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules
Technical Field
The invention belongs to the technical field of virus antibodies, and particularly relates to a feline calicivirus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof.
Background
Currently, feline Calicivirus (FCV) is a calicivirus that infects a variety of animals, such as humans. The clinical manifestations are ulcer with nostril, oral cavity, skin edema, severe pneumonia and the like; the clinical manifestations of chronic cases are damage to the nostrils and palate, low fever, and significant increase in oral and canthus secretions, with the virus being currently distributed worldwide.
The clinical treatment of feline calicivirus disease currently relies mainly on monoclonal antibodies, and most of the commercially available antibodies are xenogeneic animal immune sera, which can protect young and adult animals from infection, but cannot be injected continuously, otherwise severe allergic reactions can be caused, and in severe cases, animal death can be caused. In addition, the traditional mouse-derived monoclonal antibody has stronger heterogeneity and immunogenicity to a non-mouse-derived antibody, and can easily cause immunological rejection or anaphylactic reaction of a host when applied in vivo, so that the curative effect of the mouse-derived monoclonal antibody is reduced, even serious consequences are generated in a diseased body, and the clinical application effect of the mouse-derived monoclonal antibody is greatly limited. At present, the phage display technology is more and more widely applied, more humanized phage display antibody libraries are successfully constructed, and particularly, the research and development of some monoclonal antibody medicines enable the phage display technology to be better developed. At present, most of the construction methods are immune phage libraries, because the antibody level in an animal body is improved after immunization, the screening of antibodies aiming at specific antigens is more facilitated, and the subsequent diagnosis and treatment effects are more advantageous. At present, most of the monoclonal antibodies are monoclonal antibodies, and a phage antibody library aiming at a cat source avoids interference factors in the using process of the antibodies, so that a theoretical basis is provided for diagnosis of the feline calicivirus and preparation of a therapeutic monoclonal antibody.
Through the above analysis, the problems and defects of the prior art are as follows: at present, phage antibody libraries directed against feline sources have not been constructed, mostly monoclonal antibodies.
The difficulty in solving the above problems and defects is: in order to obtain an antibody library with a certain scale, firstly, a complete set of antibody genes of organism origin are obtained by means of an RT-PCR technology, and at present, the reports about cat origin gene sequences are few, and multiple pairs of primer verification needs to be carried out on antibody light chain variable region sequences and antibody heavy chain variable region sequences.
The significance of solving the problems and the defects is as follows: is beneficial to screening the antibody aiming at the specific antigen and has more advantages on subsequent diagnosis and treatment effect.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a virus antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and application thereof.
The invention is realized by a virus antibody sequence which is as follows: heavy chain variable region amino acid sequence SEQ ID NO:1 and the nucleotide sequence SEQ ID NO:3; light chain variable region amino acid sequence SEQ ID NO:2 and the nucleotide sequence SEQ ID NO:4.
it is another object of the invention to provide a tetrapeptide chain molecule formed by disulfide bonding of the heavy and light chains of the viral antibody sequence.
It is another object of the present invention to provide an immunoglobulin molecule comprising said tetrapeptide chain molecule.
Another object of the present invention is to provide a method for detecting feline calicivirus using the virus antibody sequence.
The invention also aims to provide a preparation method of the monoclonal antibody for treating feline calicivirus, and the preparation method of the monoclonal antibody for treating feline calicivirus uses the virus antibody sequence.
Another object of the present invention is to provide a method for screening for the pair of viral antibody sequences, comprising the steps of:
firstly, preparing a phage antibody;
step two, panning of a phage antibody library;
thirdly, identifying a cat source Phage single-chain antibody of the anti-feline calicivirus by a Phage ELISA method;
and fourthly, sequencing the scFv bacterial liquid with positive Phage ELISA identification result by a sequencing company to obtain the variable region sequences of the heavy chain and the light chain of the gene engineering antibody of the feline calicivirus.
Further, the first step includes: adding 1mL of phage primary antibody library into 3mL of XLI-Blue bacterial liquid with OD600=0.5, standing at 37 ℃ for 45min, adding 6mL of LB liquid culture medium containing Amp + (100 μ g/mL), adding 1mol/L of glucose according to 1; centrifuging the culture medium at 12000rpm for 10-20min, and collecting the supernatant; adding PEG8000 in a ratio of 1; collecting the precipitate after centrifugation at 12000rpm for 10min, re-suspending the precipitate with 1.5mL of 1 XPBS, adding PEG8000 again according to the proportion of 1.
Further, the second step includes:
(1) Coating: with 0.1M NaHCO 3 The purified feline calicivirus was diluted to different concentrations of 2. Mu.g/mL, 4. Mu.g/mL, and 8. Mu.g/mL coating96-well ELISA plates, 100. Mu.L per well, were left in a refrigerator at 4 ℃ overnight. After coating, discarding the liquid in the enzyme label plate with 96 holes, adding 100 mu L of washing buffer solution PBST into each hole, and washing for 3 times;
(2) And (3) sealing: adding 250 mu L of sealing liquid into each hole, and sealing in an incubator at 37 ℃ for 2h;
(3) Washing: add 100. Mu.L PBST per well and wash 3 times in total. Washing each time, shaking for 1min at 400rpm by using a plate shaking instrument, vertically rotating the ELISA plate for one circle, and infiltrating the tube wall;
(4) Adding a phage antibody: adding phage antibody into 100 μ L of each well, shaking at 400rpm/min for 5min, and incubating at room temperature for 1h;
(5) Washing: repeating the step (3);
(6) And (3) elution: stop solution was added at 50. Mu.L per well and shaken at 1000rpm for 5min in a plate shaker. Adding 75 mu L of Tris-HCL into each 400 mu L of eluent for neutralization; mu.L of this liquid was added to 180. Mu.L of competent cells with OD600=0.5, infected for 20min, 20. Mu.L of the broth was spread on LB plate containing Amp + (100. Mu.g/mL), cultured overnight at 37 ℃, and the amount of phage pool exported was calculated. Picking monoclonal colony shake bacteria, performing PCR identification, and sequencing;
(7) Taking 90% of the total amount of the first-stage phage antibody library, and adding 3mL of OD 600 In the competent cells of =0.5, after 30min of infection, 6mL of LB liquid was added, and ampicillin was added at a final concentration of 100 μ g/mL and glucose was added at 1; OD of bacterial liquid to be treated 600 Adding 4 × 1010 helper phage M13K07 when the culture medium is 0.5, standing and incubating for 30min, shaking and culturing at 220rpm/min for 1h, centrifuging at 3500rpm/min for 6min, discarding the supernatant, resuspending the precipitate by using an equal volume of LB liquid culture medium containing Amp + (100 μ g/mL) and Kana (50 μ g/mL), and shaking and culturing at 37 ℃ and 220rpm/min overnight; the medium was centrifuged at 12000rpm for 10-20min, and the supernatant was collected. Adding PEG8000 into a mixture of 1; collecting the precipitate after centrifugation at 12000rpm for 10min, resuspending the precipitate with 1.5mL of 1 XPBS, adding PEG8000 again according to the proportion of 1-4-1;
(8) Performing 3-4 rounds of phage panning, and calculating the input and output phage library amount each time; and the final round of phage library was added to 50% glycerol and stored in a-80 ℃ freezer.
Further, the third step includes:
(1) Coating: the purified feline calicivirus was treated with 0.1M NaHCO 3 Diluting to 8 mu g/mL coated 96-well enzyme-labeled plate, setting BSA as blank control, and taking M13K07 as negative control;
(2) And (3) sealing: discarding the coating solution in a 96-well enzyme label plate, and incubating for 2h at 37 ℃ with 200 mu L of confining liquid in each well;
(3) Washing: adding 200 μ L PBST into each well, washing for 3 times, and patting to dry;
(4) Adding a phage single-chain antibody: 1, mixing the phage single-chain antibody with PBST, adding 200 mu L of the mixed phage single-chain antibody into a 96-well enzyme label plate, and incubating for 2h at room temperature;
(5) Washing: the same step (3);
(6) Applying a second antibody: diluting an HRP-labeled anti-M13 antibody according to the proportion of 1;
(7) Washing: the same step (3);
(8) Color development: adding 50 μ L of TMB color developing solution into each well, covering with tinfoil paper, and reacting at 37 deg.C for 10min;
(9) And (4) terminating: 50 μ L of 2mol/L H was added to each well 2 SO 4 Stopping the reaction, and detecting OD by an enzyme-linked immunosorbent assay 450 Numerical values.
Further, the construction of the cat-derived anti-feline calicivirus single-chain antibody library comprises:
(1) Isolation of peripheral blood lymphocytes from cats 5 experimental cats were immunized with the vaccine. 2 weeks apart for each immunization, 3 times of immunization, 2 weeks after 3 times of immunization, collecting 5-10mL of fresh blood, uniformly mixing with whole blood and tissue diluent in a proportion of 1-1; the horizontal centrifuge is centrifuged at the rotation speed of 400-800 g for 15-25 min, after centrifugation, the liquid in the centrifuge tube is divided into four layers which are respectively from top to bottom: a first layer: a plasma layer; a second layer: a layer of lymphocytes; and a third layer: separation liquid and fourth layer: red blood cell layer. Carefully sucking the second layer of milky lymphocytes into another 15mL centrifuge tube by using a pipette, adding 10mL of cleaning solution, uniformly mixing, and centrifuging at 250g for 10min; repeat 2-3 times, abandon the supernatant. Resuspending the lymphocytes at the bottom of the tube with a cryopreservation solution containing 90% fetal calf serum, 10% DMSO and 1% double antibody, subpackaging in 2mL of cryopreservation tubes, standing in a refrigerator at 4 ℃ for 30min, standing in a refrigerator at-20 ℃ for 2h, standing in a refrigerator at-80 ℃ overnight, and transferring to liquid nitrogen for sequential cryopreservation of the lymphocytes on the next day;
(2) Extracting total RNA of the cat peripheral blood lymphocytes, transferring the PBMC in the frozen tube into a 1.5mL centrifuge tube, centrifuging at 1800rpm for 5min, and discarding the supernatant; leaving 50-100 μ L of supernatant at the bottom of the centrifuge tube, and resuspending the tube bottom cells; adding 1mL of Trizol, repeatedly and uniformly blowing by using a pipette gun, and incubating for 5min to room temperature; adding 0.2mL chloroform, shaking vigorously by hand for 15s, incubating at room temperature for 2-3min, centrifuging at 12000rpm and 4 deg.C for 15min in a refrigerated centrifuge, wherein the liquid can be divided into lower organic phase containing DNA and protein, and upper transparent layer containing RNA; the centrifuge tube is inclined at 45 degrees, and the transparent layer is moved into another 1.5mL centrifuge tube; adding 0.5mL of isopropanol, mixing uniformly, incubating at room temperature for 10min, centrifuging at 12000rpm for 10min, and removing the supernatant; adding 1mL of 75% ethanol, washing with a vortex oscillator at 7500rpm at 4 ℃, centrifuging for 5min, and discarding the supernatant; placing the centrifuge tube on a clean bench, standing for 5-10min, resuspending and dissolving with at least 30 μ L DEPC water, measuring concentration and A with ultramicro spectrophotometer 260 And A 280 The ratio is preserved at minus 80 ℃;
(3) Cat heavy chain variable region V H And light chain variable region V L The amplification of (1) was performed using PrimeScript using the extracted total RNA as a template TM II 1st Strand cDNA Synthesis Kit reverse transcription of total RNA into cDNA, PCR amplification of V using it as template H Genes and V L A gene; preparing 1.5% agarose gel, detecting and identifying by nucleic acid electrophoresis, observing the result in a gel imager, recovering gel, and purifying V H And V L A fragment; the heavy chain variable region gene V is processed by a SOE-PCR gene engineering method by using a primer of a Linker H Respectively linked with light chain variable region gene V L Light chain variable region gene V L Assembled intoscFv gene, forming V L -linker-V H Preparing 1.0% agarose gel, observing the result in a gel imager, recovering the gel, purifying scFv gene fragments, and carrying out enzyme digestion and connection on the purified scFv gene products and a phage vector pComb3 XSS;
(4) Constructing a single-chain antibody library, performing electric shock transformation on 20 mu L of a ligation product and 80 mu L of electrotransformation competent XLI-Blue under the conditions of 2.5KV and 800 omega, washing an electric revolving cup by using 1mLSOC culture medium, sucking liquid into a 50mL centrifuge tube at 220rpm/min and 37 ℃, and shaking bacteria for 45min; mu.L, 50. Mu.L and 100. Mu.L of the bacterial suspension were applied to a plate containing Amp + (100. Mu.g/mL), respectively, and the electrotransfer effect was determined. 9mL of LB liquid medium containing Amp + (100. Mu.g/mL) were added to the centrifuge tube at a rate of 1:1000 adding glucose, 220rpm/min,37 ℃, shaking to OD 600 =0.5. Adding 20 mu L of helper phage M13K07 for rescue, and shaking the bacteria for 1h after infecting for 30 min; centrifuging the bacterium solution at 3000rpm for 6min, removing the supernatant, adding IPTG (isopropyl-beta-D-thiogalactoside) into an LB liquid culture medium containing Amp + (100 mu g/mL) and Kana in the same volume at 1; centrifuging the culture medium at 12000rpm/min for 10-20min, and collecting the supernatant; adding PEG8000 into a mixture of the components according to a ratio of 1.
By combining all the technical schemes, the invention has the advantages and positive effects that: the variable region amino acid sequences and the nucleotide sequences of the heavy chain and the light chain of the feline calicivirus-resistant humanized antibody provided by the invention provide support for constructing the high-affinity and low-immunogenicity canine-resistant feline calicivirus-resistant genetic engineering antibody. Has important significance for promoting the development of the feline antibody drug. According to the invention, an immune cat is selected as a research object, peripheral blood of a sample is collected firstly, then PBMC is separated by means of a centrifuge, and finally expression of a cat source antibody gene is carried out on the surface of a phage vector based on a phage display method, so that a phage single-chain antibody library for the feline calicivirus is obtained, and the same animal source of the antibody is realized.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments of the present application will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present application, and it is obvious for those skilled in the art that other drawings can be obtained from the drawings without creative efforts.
FIG. 1 is a flow chart of a method for screening viral antibody sequences provided in the examples of the present invention.
FIG. 2V H Gene PCR amplification product
FIG. 3 Kappa Gene PCR amplification product
FIG. 4 Lamda Gene PCR amplification product
FIG. 5 PCR amplification product of scFv Gene
FIG. 6 library size for single-chain antibody Gene library construction
FIG. 7 anti-feline calicivirus phage antibody binding Activity
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
In view of the problems of the prior art, the present invention provides a viral antibody sequence, a tetrapeptide chain molecule, an immunoglobulin molecule and applications thereof, and the present invention is described in detail below with reference to the accompanying drawings.
The virus antibody sequence provided by the invention is as follows: heavy chain variable region amino acid sequence SEQ ID NO:1 and the nucleotide sequence SEQ ID NO:3; light chain variable region amino acid sequence SEQ ID NO:2 and the nucleotide sequence SEQ ID NO:4.
as shown in fig. 1, the method for screening a pair of viral antibody sequences provided by the present invention comprises the following steps:
s101: preparing a phage antibody;
s102: panning of a phage antibody library;
s103: identifying the anti-feline calicivirus feline Phage single-chain antibody by a Phage ELISA method;
s104: sequencing the scFv bacterial liquid with positive Phage ELISA identification result by a sequencing company to obtain the variable region sequences of the heavy chain and the light chain of the genetic engineering antibody of the feline calicivirus.
The technical solution of the present invention is further described with reference to the following specific examples.
Example 1 construction of a library of feline-derived anti-feline calicivirus Single chain antibodies
1. Isolation of feline peripheral blood lymphocytes
Vaccine immunization was performed on 5 experimental cats according to the international manual on animal immunization. The immunization was performed 3 times with 2 weeks interval. 2 weeks after 3 immunizations, cat peripheral blood was collected. 5-10mL of fresh blood is taken and mixed with whole blood and tissue diluent uniformly, and the ratio is 1. Cell separation medium was added to a 15mL centrifuge tube and an equal volume of diluted anticoagulated blood was gently added along the tube wall. The horizontal centrifuge is centrifuged at the rotation speed of 400-800 g for 15-25 min, after centrifugation, the liquid in the centrifuge tube is divided into four layers which are respectively from top to bottom: a first layer: a plasma layer; a second layer: a layer of lymphocytes; and a third layer: separation liquid and fourth layer: red blood cell layer. The second layer of opalescent lymphocytes was carefully pipetted into another 15mL centrifuge tube, mixed with 10mL of wash solution and centrifuged at 250g for 10 min. Repeat 2-3 times, abandon the supernatant. Resuspending the lymphocytes at the bottom of the tube with a cryopreservative solution containing 90% fetal bovine serum, 10% DMSO and 1% diabody, packaging into 2mL cryopreservative tubes, standing at 4 ℃ for 30min, standing at-20 ℃ for 2h, standing at-80 ℃ overnight, and moving to liquid nitrogen for the next day to cryopreserve the lymphocytes.
2. Extraction of total RNA from cat peripheral blood lymphocytes
The PBMC in the frozen tube were transferred to a 1.5mL centrifuge tube at 1800rpm, centrifuged for 5min, and the supernatant discarded. Leaving 50-100. Mu.L of supernatant at the bottom of the centrifuge tubeResuspend the tube bottom cells. Adding 1mL Trizol, repeatedly and uniformly blowing by using a pipette gun, and incubating for 5min to room temperature. Adding 0.2mL chloroform, shaking vigorously by hand for 15s, incubating at room temperature for 2-3min, and centrifuging at 12000rpm and 4 deg.C for 15min in a refrigerated centrifuge, wherein the liquid can be divided into a lower organic phase containing DNA and protein, and an upper transparent layer containing RNA. The centrifuge tube was tilted 45 degrees and the clear layer was transferred to another 1.5mL centrifuge tube. Adding 0.5mL of isopropanol, mixing, incubating at room temperature for 10min, centrifuging at 12000rpm for 10min, and discarding the supernatant. 1mL of 75% ethanol was added and washed with a vortex shaker at 7500rpm,4 ℃ for 5min, and the supernatant was discarded. Placing the centrifuge tube on a clean bench, standing for 5-10min to dry RNA, re-suspending and dissolving with at least 30 μ L DEPC water, and measuring concentration and A with ultramicro spectrophotometer 260 And A 280 The ratio was stored at-80 ℃.
3. Cat heavy chain variable region (V) H ) And light chain variable region (V) L ) Amplification of
Using extracted total RNA as template and PrimeScript TM II 1st Strand cDNA Synthesis Kit reverse transcription of total RNA into cDNA. Taking it as a template, the primer sequence SEQ ID NO:5, PCR amplification of V H Genes and V L A gene. Preparing 1.5% agarose gel, detecting and identifying by nucleic acid electrophoresis, observing the result in a gel imager, recovering gel, and purifying V H And V L And (3) fragment. The heavy chain variable region gene V is processed by a SOE-PCR gene engineering method by using a primer of a Linker H Respectively linked with light chain variable region gene V L (Lamda), light chain variable region Gene V L (Kappa) Assembly of scFv genes to form V L -linker-V H In the form of (1). Preparing 1.0% agarose gel, observing the result in a gel imager, recovering the gel, and purifying the scFv gene fragment. And carrying out enzyme digestion and connection on the purified scFv gene product and a phage vector pComb3 XSS.
4. Construction of Single chain antibody libraries
Transforming 20 mu L of the ligation product and 80 mu L of electrotransformation competent XLI-Blue under the condition of 2.5KV and 800 omega, washing an electrotransfer cup with 1mLSOC culture medium, sucking the liquid into a 50mL centrifuge tube, and performing ion exchange at 220rpmmin,37 ℃, shake bacteria for 45min. mu.L, 50. Mu.L and 100. Mu.L of the bacterial suspension were applied to a plate containing Amp + (100. Mu.g/mL), respectively, and the electrotransfer effect was determined. 9mL of LB liquid medium containing Amp + (100. Mu.g/mL) were added to the centrifuge tube at a rate of 1:1000 adding glucose (1 mol/L), 220rpm/min,37 deg.C, shaking to OD 600 =0.5. Adding 20 mu L of helper phage M13K07 for rescue, and shaking the bacteria for 1h after infecting for 30 min. The resulting broth was centrifuged at 3000rpm for 6min, the supernatant was discarded, and IPTG (1 mol/L) was added at 1. The medium was centrifuged at 12000rpm/min for 10-20min, and the supernatant was collected. PEG8000 was added at 1. After centrifugation at 12000rpm for 10min, the precipitate was collected, resuspended in 1.5ml1 × PBS (pH7.4), PEG8000 was added again at a ratio of 1. The library is built for many times according to the method, and the original library of the scFv phage antibody is built.
Example 2 screening of library of feline-derived anti-feline calicivirus Single chain antibodies
1. Preparation of phage antibodies
Adding 1mL of phage primary antibody library into 3mL of XLI-Blue bacterial liquid of OD600=0.5, standing at 37 ℃ for 45min, adding 6mL of LB liquid culture medium containing Amp + (100 μ g/mL), adding glucose (1 mol/L) according to a ratio of 1. The medium was centrifuged at 12000rpm for 10-20min, and the supernatant was collected. PEG8000 was added at 1. After centrifugation at 12000rpm for 10min, the pellet was collected, resuspended in 1.5mL of 1 XPBS (pH 7.4), PEG8000 was added again at a ratio of 1-1.
2. Panning of phage antibody libraries
(1) Coating: the purified feline calicivirus was diluted with 0.1M NaHCO3 to different concentrations of 2. Mu.g/mL, 4. Mu.g/mL, and 8. Mu.g/mL in 96-well microtiter plates, 100. Mu.L per well, and left to stand in a refrigerator at 4 ℃ overnight. After coating, discarding the liquid in the enzyme label plate with 96 holes, adding 100 mu L washing buffer solution PBST into each hole, and washing for 3 times;
(2) And (3) sealing: adding 250 mu L of sealing liquid into each hole, and sealing in a 37 ℃ incubator for 2h;
(3) Washing: add 100. Mu.L PBST per well and wash 3 times in total. Washing each time, shaking for 1min at 400rpm by using a plate shaking instrument, vertically rotating the ELISA plate for one circle, and infiltrating the tube wall;
(4) Adding a phage antibody: adding phage antibody into 100 μ L of each well, shaking at 400rpm/min for 5min, and incubating at room temperature for 1h;
(5) Washing: repeating the step (3);
(6) And (3) elution: stop solution was added at 50. Mu.L per well and shaken at 1000rpm for 5min in a plate shaker. Each 400. Mu.L of eluate was neutralized with 75. Mu.L of Tris-HCl. mu.L of this liquid was added to 180. Mu.L of competent cells with OD600=0.5, infected for 20min, 20. Mu.L of the broth was spread on LB plate containing Amp + (100. Mu.g/mL), cultured overnight at 37 ℃ and the amount of phage pool exported was calculated. Picking monoclonal colony shake bacteria, carrying out PCR identification, and sequencing;
(7) Taking 90% of the total amount of the first-stage phage antibody library, and adding 3mL of OD 600 In competent cells of =0.5, 30min after infection, 6mL of LB liquid was added, and ampicillin was added at a final concentration of 100 μ g/mL and glucose was added at 1. Bacterial suspension OD 600 Adding 4 × 1010 helper phage M13K07 when the culture medium is 0.5, standing and incubating for 30min, shaking and culturing at 220rpm/min for 1h, centrifuging at 3500rpm/min for 6min, discarding the supernatant, resuspending the precipitate by using an equal volume of LB liquid culture medium containing Amp + (100 μ g/mL) and Kana (50 μ g/mL), and shaking and culturing at 37 ℃ and 220rpm/min overnight; the medium was centrifuged at 12000rpm for 10-20min, and the supernatant was collected. PEG8000 is added into the mixture in a ratio of 1,at this point, a cloudy precipitate appeared, which was refrigerated overnight at 4 ℃. After centrifugation at 12000rpm for 10min, the precipitate was collected, resuspended in 1.5mL of 1 XPBS (pH7.4), PEG8000 was added again at a ratio of 1.
(8) And performing 3-4 rounds of phage panning, and calculating the input and output phage library amount each time. And the phage library from the last round was added to 50% glycerol and stored in a-80 ℃ freezer.
Phage ELISA method for identifying cat-origin phage single-chain antibody of anti-feline calicivirus
(1) Coating: the purified feline calicivirus was treated with 0.1M NaHCO 3 Diluting to 8 mu g/mL coated 96-well enzyme-labeled plate, setting BSA as a blank control and M13K07 as a negative control;
(2) And (3) sealing: discarding the coating solution in a 96-well enzyme label plate, and incubating for 2h at 37 ℃ with 200 mu L of confining liquid in each well;
(3) Washing: adding 200 μ L PBST into each well, washing for 3 times, and patting to dry;
(4) Adding a phage single-chain antibody: 1, mixing phage single-chain antibody with PBST, adding 200 mu L of phage single-chain antibody into a 96-well enzyme label plate, and incubating for 2h at room temperature;
(5) Washing: the same step (3);
(6) Applying a second antibody: diluting an HRP-labeled anti-M13 antibody according to the proportion of 1;
(7) Washing: the same step (3);
(8) Color development: adding 50 μ L of TMB color developing solution into each well, covering with tinfoil paper, and reacting at 37 deg.C for 10min;
(9) And (4) terminating: 50 μ L of 2mol/L H was added to each well 2 SO 4 Stopping the reaction, and detecting OD by an enzyme-linked immunosorbent assay 450 Numerical value
Sequencing scFv bacterial liquid with positive Phage ELISA identification result by sequencing company to obtain the variable region sequences of heavy chain and light chain of the gene engineering antibody of the cat-derived anti-feline calicivirus.
SEQ ID NO:1: heavy chain variable region amino acid sequence
Asp Val Gln Leu Val Glu Ser Gly Gly Asp Leu Val Gln Pro Gly Gly
Ser Leu Arg Leu Thr Cys Val Ala Ser Gly Phe Thr Phe Ser Ser Tyr
Glu Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Gln Trp Val
Ala Tyr Ile Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Gln Asn Thr Leu Tyr Leu
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala
Arg Gly Glu Asn Asn Asp Pro Tyr Asn Ile Asp Leu Trp Gly His Gly
Thr Ile Val Thr Val Ser Ser
The amino acid sequence of SEQ ID NO:2: light chain variable region amino acid sequence
Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Thr Pro Gly
Glu Pro Ala Ser Ile Ser Cys Arg Ala Ser Gln Ser Leu Leu His Ser
Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
Pro Arg Leu Leu Ile Phe Arg Val Ser Asn Arg Ala Ser Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile
Ser Arg Val Glu Ala Asp Asp Val Gly Val Tyr Tyr Cys Gln Gln Gly
Thr His Ala Pro Thr Thr Phe Gly Gln Gly Thr His Leu Glu Ile Lys
SEQ ID NO:3: heavy chain variable region nucleotide sequence
gacgtgcagctggtggagtctgggggagacctggtgcagcctggggggtccctgagactcacctgtgtggcctccggatt
caccttcagtagctatgaaatgaactgggtccgccaggctccagggaaggggctgcagtgggtcgcatatattagtagtg
gaggtagcacatactacgcagactccgtgaagggccgattcaccatctccagagacaacgcccagaacacattgtatctg
cagatgaacagcctcaagaccgaggacacggccacatattactgtgcgaggggggagaataacgacccctataatatcga
tctctggggccatggaaccatagtcacagtgtcctcag
SEQ ID NO:4: light chain variable region nucleotide sequence
gatgtcgtgatgacgcagacccctctgtccctgcccgtcacccctggagagccggcctcaatctcctgcagggccagtca
gagcctcctgcacagtaatggaaacacctatttacattggtacctgcagaagccaggccagtctccacggctcctgatct
ttagggtttccaaccgggcctctggggtcccagacaggttcagtggcagcgggtcggggacagatttcaccctgagaatc
agcagggtggaggctgacgacgtcggagtttattactgccagcaaggtacacatgctccgaccacctttggccaagggac
acatctggagattaaac
SEQ ID NO:5: upstream primer for amplifying cat heavy chain variable region
ggtggttcctctagatcttcc ctgcacgtcgaccac
ggtggttcctctagatcttcc gttgaatgtgaagcc
ggtggttcctctagatcttcc gtccaaaacgaccac
ggtggttcctctagatcttcccaatggactggagctggagaatcc
ggtggttcctctagatcttccatggagtttgtgctgggctgggttttcct
ggtggttcctctagatcttccatcacygkavaacgccatcctcttccaga
Downstream primer for amplifying cat heavy chain variable region
acctggccggcctggcctggttgttgaccacactgttgttctt
acctggccggcctggcctggttgttgaccacactgttgttctt
acctggccggcctggcccgtggtggaggctgaggacaccgtca
acctggccggcctggcc ggctccttggcccca
SEQ ID NO：6：
Amplification of cat light chain (Kappa) upstream primer
atagggcccaggcggcc ctacagcactactgc
atagggcccaggcggcc tcacaccacgactgc
atagggcccaggcggcc cgctagtgctactgc
atagggcccaggcggccgttcagcttctcaaaatgaggttccctgct
Amplification of Cat light chain (Kappa) downstream primer
ggaagatctagaggaaccaccatatgcacacgatagaggcacttcctgtat
ggaagatctagaggaaccacc cgtccccaggccgaa
SEQ ID NO：7：
Amplification of upstream primers for Cat light chain (lamda)
atagggcccaggcggcc gtcagatccgactga
atagggcccaggcggcc gtcagacacgactga
atagggcccaggcggcc gtcagacgggactta
atagggcccaggcggcc gtcagccccgactga
atagggcccaggcggcc ccagtcagccccggc
atagggcccaggcggcc aggatacacgactga
atagggcccaggcggcc cggatacacaactga
atagggcccaggcggcc aggtcactccactga
atagggcccaggcggcc gtcggacacgactgg
Downstream primer for amplifying cat light chain (lamda)
ggaagatctagaggaaccaccggtccctccgccgaa
Demonstration part (/ experiment/simulation// positive experimental data capable of demonstrating the inventive aspects of the invention, etc.)
The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> Qingdao bonong Gene bioengineering Co., ltd
<120> a virus antibody sequence, tetrapeptide chain molecule, immunoglobulin molecule and uses thereof
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 119
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Asp Val Gln Leu Val Glu Ser Gly Gly Asp Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Thr Cys Val Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Glu Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Gln Trp Val
35 40 45
Ala Tyr Ile Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Gln Asn Thr Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala
85 90 95
Arg Gly Glu Asn Asn Asp Pro Tyr Asn Ile Asp Leu Trp Gly His Gly
100 105 110
Thr Ile Val Thr Val Ser Ser
115
<210> 2
<211> 112
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ala Ser Gln Ser Leu Leu His Ser
20 25 30
Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Arg Leu Leu Ile Phe Arg Val Ser Asn Arg Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile
65 70 75 80
Ser Arg Val Glu Ala Asp Asp Val Gly Val Tyr Tyr Cys Gln Gln Gly
85 90 95
Thr His Ala Pro Thr Thr Phe Gly Gln Gly Thr His Leu Glu Ile Lys
100 105 110
<210> 3
<211> 358
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gacgtgcagc tggtggagtc tgggggagac ctggtgcagc ctggggggtc cctgagactc 60
acctgtgtgg cctccggatt caccttcagt agctatgaaa tgaactgggt ccgccaggct 120
ccagggaagg ggctgcagtg ggtcgcatat attagtagtg gaggtagcac atactacgca 180
gactccgtga agggccgatt caccatctcc agagacaacg cccagaacac attgtatctg 240
cagatgaaca gcctcaagac cgaggacacg gccacatatt actgtgcgag gggggagaat 300
aacgacccct ataatatcga tctctggggc catggaacca tagtcacagt gtcctcag 358
<210> 4
<211> 337
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gatgtcgtga tgacgcagac ccctctgtcc ctgcccgtca cccctggaga gccggcctca 60
atctcctgca gggccagtca gagcctcctg cacagtaatg gaaacaccta tttacattgg 120
tacctgcaga agccaggcca gtctccacgg ctcctgatct ttagggtttc caaccgggcc 180
tctggggtcc cagacaggtt cagtggcagc gggtcgggga cagatttcac cctgagaatc 240
agcagggtgg aggctgacga cgtcggagtt tattactgcc agcaaggtac acatgctccg 300
accacctttg gccaagggac acatctggag attaaac 337
<210> 5
<211> 414
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggtggttcct ctagatcttc cctgcacgtc gaccacggtg gttcctctag atcttccgtt 60
gaatgtgaag ccggtggttc ctctagatct tccgtccaaa acgaccacgg tggttcctct 120
agatcttccc aatggactgg agctggagaa tccggtggtt cctctagatc ttccatggag 180
tttgtgctgg gctgggtttt cctggtggtt cctctagatc ttccatcacy gkavaacgcc 240
atcctcttcc agaacctggc cggcctggcc tggttgttga ccacactgtt gttcttacct 300
ggccggcctg gcctggttgt tgaccacact gttgttctta cctggccggc ctggcccgtg 360
gtggaggctg aggacaccgt caacctggcc ggcctggccg gctccttggc ccca 414
<210> 6
<211> 230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atagggccca ggcggcccta cagcactact gcatagggcc caggcggcct cacaccacga 60
ctgcataggg cccaggcggc ccgctagtgc tactgcatag ggcccaggcg gccgttcagc 120
ttctcaaaat gaggttccct gctggaagat ctagaggaac caccatatgc acacgataga 180
ggcacttcct gtatggaaga tctagaggaa ccacccgtcc ccaggccgaa 230
<210> 7
<211> 324
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
atagggccca ggcggccgtc agatccgact gaatagggcc caggcggccg tcagacacga 60
ctgaataggg cccaggcggc cgtcagacgg gacttaatag ggcccaggcg gccgtcagcc 120
ccgactgaat agggcccagg cggccccagt cagccccggc atagggccca ggcggccagg 180
atacacgact gaatagggcc caggcggccc ggatacacaa ctgaataggg cccaggcggc 240
caggtcactc cactgaatag ggcccaggcg gccgtcggac acgactgggg aagatctaga 300
ggaaccaccg gtccctccgc cgaa 324

Claims (3)

1. An anti-feline calicivirus antibody having the sequence: heavy chain variable region amino acid sequence SEQ ID NO:1 and the nucleotide sequence SEQ ID NO:3; light chain variable region amino acid sequence SEQ ID NO:2 and the nucleotide sequence SEQ ID NO:4.
2. a tetrapeptide chain molecule formed from the heavy and light chains of the anti-feline calicivirus antibody of claim 1 joined by disulfide bonds.
3. Use of an anti-feline calicivirus antibody according to claim 1 in the manufacture of a medicament, kit for detecting feline calicivirus.
CN202010662681.3A 2020-07-10 2020-07-10 Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules Active CN111848788B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010662681.3A CN111848788B (en) 2020-07-10 2020-07-10 Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010662681.3A CN111848788B (en) 2020-07-10 2020-07-10 Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules

Publications (2)

Publication Number Publication Date
CN111848788A CN111848788A (en) 2020-10-30
CN111848788B true CN111848788B (en) 2022-10-14

Family

ID=73153218

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010662681.3A Active CN111848788B (en) 2020-07-10 2020-07-10 Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules

Country Status (1)

Country Link
CN (1) CN111848788B (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2022959C (en) * 1989-08-10 2001-03-20 Hiroaki Maeda Cat-mouse heterohybridoma and gene fragment coding for constant region of feline immunoglobulin
CN110272488B (en) * 2018-03-16 2022-05-17 洛阳普泰生物技术有限公司 Cat calicivirus monoclonal antibody and application thereof
CN110283246A (en) * 2019-06-20 2019-09-27 长春西诺生物科技有限公司 A kind of cat source genetic engineering antibody of anti-feline panleucopenia virus
CN110501509A (en) * 2019-09-03 2019-11-26 长春西诺生物科技有限公司 A kind of anti-feline panleucopenia virus cat source genetic engineering antibody ELISA kit and its detection method

Also Published As

Publication number Publication date
CN111848788A (en) 2020-10-30

Similar Documents

Publication Publication Date Title
Meijer et al. Isolation of human antibody repertoires with preservation of the natural heavy and light chain pairing
WO2016188449A1 (en) Single-domain antibody targeting cd47
CN110964103B (en) Canine-derived anti-canine parvovirus antibody, antibody library and construction method
CN106243219B (en) The single-chain antibody and preparation method thereof of one boar source property porcine epidemic diarrhea resisting virus
US20240092910A1 (en) B7-h3 nanobody, preparation method and use thereof
CN111848785B (en) Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules
JP6211702B2 (en) Human insecticidal genes and insecticidal peptides encoded thereby and uses
JP2016146820A (en) Specification method of antigen specific adaptive immune response using arm pcr and high processing sequencing
CN115109151A (en) Novel coronavirus monoclonal antibody XY6 and application thereof
CN106008710B (en) The single-chain antibody and preparation method thereof of the anti-enterotoxigenic escherichia coli K88 FaeG albumen of one boar source property
BR112016016027B1 (en) HUMAN-DERIVED INSECT RESISTANCE GENE AND SINGLE-CHAIN ANTI-TOXIN CRYLC ANTI-TOXIN SINGLE-CHAIN ANTIBODY ENCODED BY THE SAME AND USE THEREOF
CN111848788B (en) Feline calicivirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules
McKitrick et al. Identification of glycan-specific variable lymphocyte receptors using yeast surface display and glycan microarrays
CN111909259A (en) Feline parvovirus antibody sequence, tetrapeptide chain molecule, globulin molecule and application
CN106632670A (en) Swine-derived single-chain antibody capable of resisting swine transmissible gastroenteritis viruses and preparation method of swine-derived single-chain antibody
CN114409795B (en) Nanometer antibody for detecting diazinon and application thereof
CN109438573A (en) Porcine epidemic diarrhea virus M protein-specific heavy chain antibody
Abi-Ghanem et al. Phage display selection and characterization of single-chain recombinant antibodies against Eimeria tenella sporozoites
CN113173989B (en) Anti-fibrin-2 antibody sequences, tetrapeptide chain molecules and immunoglobulin molecules
CN113667014B (en) anti-BSA (bovine serum albumin) nano antibody and application
CN110655572B (en) Monoclonal antibody for resisting filovirus GP protein and application thereof
CN113583119A (en) Anti-staphylococcus aureus nanobody Nb56, application and kit
CN103951749B (en) The preparation and its application of a kind of monoclonal neutrality antibody E4 2 of anti-Staphylococcus aureus eLtaS albumen
CN107840884B (en) Nano antibody for resisting avian infectious bronchitis virus and preparation method thereof
CN114085289B (en) Construction method and application of semisynthetic single-domain antibody library

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant