CN106978511A - A kind of method for detecting feline herpetovirus - Google Patents
A kind of method for detecting feline herpetovirus Download PDFInfo
- Publication number
- CN106978511A CN106978511A CN201710340186.9A CN201710340186A CN106978511A CN 106978511 A CN106978511 A CN 106978511A CN 201710340186 A CN201710340186 A CN 201710340186A CN 106978511 A CN106978511 A CN 106978511A
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- feline herpetovirus
- fluorescent
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of method for detecting feline herpetovirus, i.e., by screening the Oligonucleolide primers obtained, and feline herpetovirus is detected by SYBR Green I fluorescent quantitations PCR method.Present invention firstly provides a kind of primer pair for being used to detect feline herpetovirus, the sequence of its upstream and downstream primer is respectively SEQ ID NO:1 and SEQ ID NO:2.The primer that the present invention is screened both can guarantee that the correct of identification cause of disease, and missing inspection different pathogen strains of the same race are unable to again.In addition, the expanding fragment length of the present invention is suitable, it can be separated from each other in electrophoresis, but it is less discrete, it is to avoid the situation of long segment amplification is hindered in multiplex PCR after preferential amplification small fragment, while the non-specific amplification product such as primer dimer is seldom.In addition, by the optimization of fluorescent quantitation reaction system and reaction condition, obtaining specificity and the higher FHV of sensitivity fluorescent quantitative PCR detection method.
Description
Technical field
The invention belongs to field of molecular detection, and in particular to a kind of method of detection feline herpetovirus, that is, pass through sieve
The Oligonucleolide primers obtained are selected, feline herpetovirus is detected by SYBR Green I fluorescent quantitations PCR method.
Background technology
Feline herpetovirus (FHV, Feline Rhinotracheitis), the virus mainly encroaches on young cat, can cause hair Feline Rhinotracheitis disease, infection
During cat serious symptom, there is body temperature rise, it will be apparent that the infection of the upper respiratory tract, nose, throat, trachea and bronchus of the virus in sick cat
And the position propagation of tongue, conjunctiva etc..The disease is found from the U.S. earliest, then in Canada, Britain, Holland, Switzerland, breast tooth
The ground such as profit, Vietnam find and popular that China repeatedly finds doubtful case, and is separated to virus.But at present in experimental animal state
In family's standard and provincial standard, not to testing detection requirement and relevant regulations with cat.
For feline herpetovirus disease diagnosis can according to this sick epidemic, face examine performance and typical pathologic change
Tentative diagnosis is made, needs to carry out laboratory diagnosis to further make a definite diagnosis.The laboratory diagnostic method master of feline herpetovirus disease
To include etiological diagnosis, serodiagnosis and diagnosis of molecular biology.But in terms of etiological diagnosis, due to being separately cultured
Workload is relatively large, and the resistance of virus itself environment to external world is relatively low, therefore the success rate of separation is not very high.
The most quick, easy viral Electronic Speculum identification after being separately cultured also is merely capable of observing the sickly structure of virus, it is impossible to
Complete the difference with coe virus；Conventional serological diagnostic method mainly has agar gel diffusion test, SPA CAs etc.,
Such experiment can only carry out the measure of antibody roughly, and sensitivity is not also high.This is accomplished by China and further speeds up research step
Cut down, accelerate to promote the flow of research of feline herpetovirus early stage Accurate Diagnosis, make great efforts to start the brand-new situation of feline herpetovirus diagnosis.
The content of the invention
The present invention provides a kind of method for detecting feline herpetovirus, i.e., by screening the Oligonucleolide primers obtained, pass through
SYBR Green I fluorescent quantitations PCR method detects feline herpetovirus.
Present invention firstly provides a kind of primer pair for being used to detect feline herpetovirus, the sequence of its upstream and downstream primer is respectively
SEQ ID NO:1 and SEQ ID NO:2, its particular sequence information is as follows：
Sense primer：ACGCTACAATTATACTCAAGCCAGAA(SEQ ID NO:1)
Anti-sense primer：TCAGCTGTTATCTTCGGATCCA(SEQ ID NO:2)
The primer of the present invention can detect the biological products of feline herpetovirus, such as kit for preparation；
The primer pair of the present invention is used for the detection of the feline herpetovirus of non-diseases diagnosis and therapeutic purposes, a kind of its specific step
It is rapid as follows：
1) nucleic acid for extracting sample to be detected is standby；
2) above-mentioned primer is used, SYBR Green I fluorescent quantitations PCR detections are carried out, wherein reaction system is by with the following group
It is grouped into：
PCR reaction conditions：95 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 50s, 60 DEG C of annealing 45s, 72 DEG C extend 30s, totally 30
Circulation, 72 DEG C extend 7min eventually；
3) foundation of standard curve：
Using feline herpetovirus genome as template, expanded, will be obtained using above-mentioned sense primer and anti-sense primer
Purpose fragment be cloned into pMD18-T carriers, prepare standard items, by template of standard items carry out quantitative fluorescent PCR amplification, build
Day-mark directrix curve；
4) according to step 3) amplification condition detected sample is entered performing PCR amplification, it is determined whether there is feline herpetovirus.
The primer that the present invention is screened both can guarantee that the correct of identification cause of disease, and missing inspection different pathogen strains of the same race are unable to again.In addition,
The expanding fragment length of the present invention is suitable, can be separated from each other in electrophoresis, and less discrete, it is to avoid preferentially expand in multiplex PCR
Increase the situation that long segment amplification is hindered after small fragment, while the non-specific amplification product such as primer dimer is seldom.In addition, passing through
The optimization of fluorescent quantitation reaction system and reaction condition, obtains specificity and the higher FHV of sensitivity fluorescence quantitative PCR detection
Method.Through final it is experimentally confirmed that the fluorescence quantifying PCR method of the present invention is due to the selection of design of primers and reaction system, sensitivity
Property is higher and with low cost, can quickly realize the specificity and sensitivity Detection to FHV.
Brief description of the drawings
Fig. 1：The PCR amplification figures of FHV genetic fragments；
Fig. 2：The PCR qualification figures of recombinant plasmid；
Fig. 3：The amplification curve diagram of standard items；
Fig. 4：Canonical plotting；
Fig. 5：The solubility curve figure of standard items.
Embodiment
The present invention is setting up special, sensitive, quick, quantitative accurate FHV SYBR Green I fluorescent quantitations PCR detections
Method, by molecular biology method, carries out the detection that FHV nucleic acid is carried to cat.Double-stranded DNA specific fluorescent dye SYBR
The quantitative real-time PCRs of Green I, can specifically bind with all double-stranded DNAs, can select various DNA profilings, price
Cheaply, it is not necessary to which probe is designed.Have to carrying out experiment from now on the detection work and experiment cat Standardization Research of cat
Positive facilitation, while by the detection to FHV Carriages, for cat quality control standard formulation provide with reference to according to
According to.
Strain and clinical sample information used in the present invention is as follows：
Feline herpetovirus (FHV) is purchased from ATTCC companies of the U.S.；Feline panleucopenia virus (FPV), herpes simplex virus I-form (HSV-
1), canine alphaherpesvirus (CHV), PRV (PRV) are detected by National Institute for Food and Drugs Control's Quality of Experimental Animals
Room is provided.
Main agents and device information are as follows：
SYBR Premix Ex Taq, Taq polymerase, dNTPs, pMD18-T carrier, glue reclaim kit etc. are purchased from
TaKaRa treasured bioengineering (Dalian) Co., Ltd；Gel reclaims kit and a large amount of extracts kits of plasmid are purchased from Omega
Company；DEPC is purchased from Sigma companies；Other reagents are domestic analysis net product.
Superclean bench (Harbin Dong Lian electronic technology development corporation, Ltd., DL-CJ-2FN)；Quantitative real time PCR Instrument
LightⅡ(Roche)；42 DEG C of adjustable thermostatic water-baths (mayor of Beijing wind instrument company, HW.SY21-K)；It is high
Fast centrifuge (Changsha Xiang Yi centrifuges Co., Ltd, H2050R-1)；Electronic balance (Shanghai Haikang Electronic Instruments Plant,
YB202N)；The type electrophoresis apparatuses (Liuyi Instruments Plant, Beijing) of DYY- III -7；Ultraviolet gel imaging system (U.S. Gene Genius UVP
Type)；UV2550 types ultraviolet-uisible spectrophotometer (Japanese Shimadzu Corporation).
The present invention is described in detail with reference to embodiment.
Embodiment 1：The design and screening of primer
FHV-1C-27 pnca gene (the sequences logged in GenBank are compared by the MegLign in DNAStar softwares
FJ478159), using the softwares of Primer Premier 5.0, PCR primer and Taq man probe sequences are made using fluorophor
For the luminophore of probe, it is used to detect with the different wave length section of corresponding quantitative real time PCR Instrument.Design and synthesize a pair of FHV
Specific primer P1/P2.Analysis below is carried out to designed primer：Interference between primer, hairpin structure and dimer.And
Preliminary Identification is carried out to its specificity by NCBI BLAST functions.Through screening, eliminate and exist between primer itself and primer
Complementary series, the single-stranded of amplified production can form the primer of secondary structure, select and remain primer and probe sequence as shown in table 1 below.
Primer is synthesized by Beijing SBS Genetech gene technology Co., Ltd, 10pmol/ μ L is diluted to DEPC water, -20 DEG C save backup.
Table 1：Specific primer P1/P2
The processing of 2.2 clinical samples
Smeared with cotton rod and take throat, eyes, nasal discharge or ulcer wound to obtain sample, plus the PBS dilutions sterilized in right amount
Afterwards, abundant multigelation 3 times, 5000rpm centrifugation 20min, takes supernatant (viral suspension), -70 DEG C save backup.
2.3DNA extract
DNA in sample is extracted using the DNAiso Reagent reagents of TaKaRa companies.Key step：
1. sample treatment, if containing liquid sample pipe, then directly carrying out next step；If no liquid, 1mL PBS need to be added
Buffer solution, vibration is mixed, and carries out next step；
2. taking the μ L of supernatant 500, then add 500 μ L lysate DNAiso Reagent in 1.5mL centrifuge tubes, overturn and mix 6
~8 times, stand 10min；
3. centrifuge 10000g, 10min；
4. taking the μ L of supernatant 800, it is added in another clean 1.5mL centrifuge tubes, adds 300 μ L absolute ethyl alcohols, overturns mixed
Even 5~6 times, centrifuge 4000g, 2min；
5. supernatant, stays precipitation, plus 75% alcohol 1mL, overturn and mix 5~8 times, centrifuge 12000g, 5min；
6. supernatant, is blotted, dry in the air 5min with blotting paper；
7. add ddH2O, 20 μ L, plus during blow and beat when turning, acquisition DNA simultaneously preserve (- 20 DEG C).
The preparation of 2.4 standard positive quality-control products
2.4.1 target gene piece PCR is expanded
By template of FHV-1C-27 genomes, P1 and P2 be primer, using conventional PCR method to FHV-1C-27 pnca genes
(sequence FJ478159) is expanded.The reaction system and condition of PCR amplifications are as follows：
PCR reaction systems
PCR reaction conditions
2.4.2 purpose fragment glue reclaim
Cut after fragment PCR product after amplification is separated through 2% agarose EB gel electrophoresises, operating procedure
It is as follows with reference to the explanation of Omega companies glue reclaim kit：
Under ultraviolet gel imager, cut fragment and be placed in the 1.5ml Eppendorf pipes of sterilizing, add Binding
Buffer, is placed in 60 DEG C of water-bath 10min, gel is melted completely, the liquid after thawing is transferred in adsorption column, and absorption
Post is put in 2ml centrifuge tubes, 12000 × g centrifugations 1min；Filtrate is abandoned, adsorption column is put back in centrifuge tube again, 300 μ L are added
Binding Buffer are into adsorption column, 12000 × g centrifugations 1min；Filtrate is abandoned, adsorption column is recovered in centrifuge tube again, plus
Enter 700 μ L SPW Wash buffer (using the preceding strict absolute ethyl alcohol of addition as requested and mixing), 12000 × g centrifugations
1min；Walked in repetition, abandon filtrate, adsorption column is recovered in centrifuge tube again, 12000 × g centrifugations 2min；Finally pillar is placed in
In 1.5ml centrifuge tubes, and add 35 μ L Elution buffer, 12000 × g centrifugations 1min.The DNA product being purified by flash ,-
70 DEG C freeze it is standby
2.4.3 purified product is connected with carrier T
The product that above-mentioned glue reclaim is purified respectively is connected with carrier p MD18-T, is positioned in connection instrument, and 16 DEG C overnight.
Linked system is as follows：
SolutionⅠ 5μL
The μ L of pMD18-T carriers 1
The μ L of product 4 of glue reclaim purifying
2.4.4 the conversion of connection product
(1) competent cell JM109 is taken out from -70 DEG C of refrigerators, is put in 37 DEG C of water-baths, cell once thawing, immediately from
Heart pipe is transferred in ice bath, places 10min.
(2) with the sterile pipette tip of a precooling, competent cell is transferred to sterile micro- centrifugation of precooling, Guan Zhong puts ice bath
In.
(3) recombinant DNA is added in competent cell, gently rotates several times, mix content, placed on ice
30min。
(4) pipe is put into 42 DEG C of water-bath, heat shock 90s should not shake.
(5) pipe is transferred in ice bath rapidly, cools down 1~2min.
(6) often pipe adds 200 μ L LB culture mediums, culture medium is heated up into 37 DEG C with water-bath, pipe then is transferred into 37 DEG C shakes
On bed, 45min is incubated, to improve conversion ratio to greatest extent, cell (rotating speed≤225r/ should be leniently shaken during recovery
min)。
(7) the competent cell of conversion is transferred on Amp flat boards, smoothened, per the μ L of sample 60.
(8) flat board is placed in 37 DEG C of incubators, until after liquid is fully absorbed, being inverted 16~18h of plate culture.
(9) trained with the suspicious colony inoculation of sterilizing toothpick picking in the test tube containing Amp (100 μ g/m L) LB liquid medium
Support overnight.Extract plasmid and carry out digestion identification.The glycerine for taking part bacterium solution to add final concentration 30% preserves strain.
A small amount of extractions of plasmid are usedIt is specific that Minipreps mini-scale plasmids purification kit extracts plasmid
Operation is carried out by operation instructions.Extraction purification plasmid is sequenced for fluorescence.Sequencing is complete by United Gene Science Co., Ltd
Into.
2.4.5PCR identification
200 μ L bacterium solution is aseptically taken respectively in 1.5m L EP pipes, the ice bath after water-bath 5min in boiling water
2min, 5000rpm centrifuge 5min.Take supernatant as template, reaction system and condition are as follows：
PCR reaction systems
PCR reaction conditions
Send Beijing Genomics Institute Co., Ltd. to be sequenced the PCR clones for being accredited as the positive, be sequenced to be positive
Recombinant plasmid is preserved, standby.
2.4.6 a large amount of extraction purifications of plasmid carry out a large amount of systems of plasmid to sequencing identification for the recombinant plasmid of positive colony
It is standby, pressMaxipreps kit specifications carry out a large amount of plasmid purifications.
The foundation of 2.5 real-time fluorescence quantitative PCR standard curves
2.5.1 the optimization of quantitative fluorescent PCR reaction system
The optimization of quantitative fluorescent PCR reaction system is optimized mainly for the optium concentration of primer, and quantitative fluorescent PCR is anti-
It is 20 μ L to answer system, and primer concentration is respectively by final concentration of 0.8 μM (primer respectively adds 1.6 μ L), 0.4 μM (primer respectively adds 0.8 μ L)
Optimized with the dosage of 0.2 μM (primer respectively adds 0.4 μ L).
2.5.2 the optimization of quantitative fluorescent PCR response procedures
In quantitative fluorescent PCR reaction, according toPremix Ex Taq TMⅡ(PerfectReal Time)
The instrument response parameter provided in kit specification is optimized to quantitative fluorescent PCR response procedures, adjustment annealing temperature and
Annealing time, determines optimum reaction condition.Wherein annealing temperature is optimized in the range of 58 DEG C~62 DEG C, and annealing time exists
Optimized in the range of 20s~30s.
2.5.3 the structure of standard curve
By standard items plasmid by 10 times of gradient dilutions, 1 × 10 is obtained10、1×109、1×108、1×107、1×106、1×
105、1×104Individual copy/μ L series standard templates, quantitative fluorescent PCR reaction is carried out using the reaction system after optimization and program,
Corresponding Cq values are obtained, wherein Cq values assign the logarithm of initial template concentration as abscissa, making standard song as ordinate
Line.
The foundation of 2.6FHV-1 fluorescent quantitative PCR detection methods
It is 10 that standard items, which are diluted to multiple,10~104As the 3 parallel repetitions of template and setting, quantitative fluorescent PCR instrument is used
Carry out the fluorescent PCR amplifications of SYBR Green I.Reaction system is that 20 μ L, 2 × SYBR Premix Ex Taq are 10.0 μ L, up and down
It is respectively 0.4 μ L (10 μM), dd H to swim primer2O is 7.2 μ L, is well mixed.Response procedures are Stage1:Predeformation 95 DEG C of 30s, 1
Individual circulation；Stage2：PCR reacts 95 DEG C of 5s, 60 DEG C of 30s, 40 circulations；Stage3：95 DEG C 0,65 DEG C of the analysis of solubility curve
15s、95℃0s.Reaction terminates the data that post processing is obtained, and obtains respective sample and the data of standard items, while fluorescent quantitation
After PCR terminates, PCR primer is mixed in proportion with bromophenol blue buffer solution, is identified with 2.0% agarose gel electrophoresis, and with biological
Electrophoretic image analytical instrument carries out photographic analysis.
Positive be defined is occurred without by blank control and adjusts the baseline of amplification curve, the fluorescence of 3~15 circulations are generally taken
Signal averaging as baseline adjustment.Ordinate is the cycle-index Cq values with the amplifiable intersections of complex curve of baseline, and abscissa is
The logarithm value of DNA concentration, makes standard curve.Fluorescence quantitative PCR detection is with Cq values>31 are determined as feminine gender, wherein Cq values<31 and
Amplification curve well can directly be determined as the positive；Need of the Cq values between 30~31 repeat to test, and testing can obtain good twice
Good S type amplification curves, can determine that as the positive.
2.6 specific test
The important feline viral sexually transmitted disease cause of disease of selected part, predominantly DNA virus, including FPV, HSV-1, CHV, PRV
4 kinds of viral detection strains as quantitative fluorescent PCR specific test of cat disease, the FHV-1 identified does positive control, set simultaneously
Determine blank control, specific test is parallel to do 3 repetitions.
2.7 sensitivity tests
FHV is made 10-1~10-12Times dilute, after concussion is well mixed, by the poison disease vaccination diluted to being paved with list
In 96 orifice plates of layer LMH cells (each dilution factor does 8 parallel repetitions), in 37 DEG C, CO22h is adsorbed in cell culture incubator, is abandoned
Fall to contain after adsorption liquid, add 100 μ LDMEM cell culture fluids (2% serum) per hole, in 37 DEG C, CO2Continue to train in cell culture incubator
Support 5d.Observe cytopathy and record daily simultaneously.Virus TCID is calculated by Reed Muench methods50, as a result for
108TCID50/ml。
It is 10 to take infection titer8TCID50/ ml FHV-1 virus liquids, 10 times of gradient dilutions are made of PBS, and dilution range is 10-1
~10-12.Using the genome of above-mentioned sample as template, fluorescent quantitation is carried out according to the reaction system after optimization and reaction condition
PCR is reacted, and reaction product is analyzed through 2% agarose gel electrophoresis.Standard PCR detection similarly is carried out to above-mentioned sample, and
It is compared with quantitative fluorescent PCR sensitiveness.To reaction product carry out electrophoretic analysis after with quantitative fluorescent PCR product gel electrophoresis
As a result it is compared, difference of the two kinds of detection methods of analysis in sensitiveness.
2.8 stability and replica test
It is 10 to the standard concentration of dilution in the interior replica test of group10Copy/μ L~104Copy/μ L genome is made
3 parallel repetitions are carried out for template, the detection of quantitative fluorescent PCR is completed under same reaction system and reaction condition.Weight between group
3 subgradient diluted concentrations are 10 by renaturation experiment10Copy/μ L~104The genome of copy/μ L standard items is as template in phase
With 3 fluorescence quantitative PCR detections of progress under reaction system and reaction condition.The coefficient of variation CV% of Cq values is calculated respectively to test
Demonstrate,prove the repeatability and stability of detection architecture.
3 results and analysis
Purpose fragment PCR is expanded
FHV C-27 pnca genes (sequence FJ478159) expand obtained product through PCR, through 2% agarose gel electrophoresis,
Observed under ultraviolet gel imager, using DL2000Maker as standard, occur a specific band at about 200bp, with expection
Size 206bp meets, and preliminary judgement is FHV C-27 pnca gene fragments, as a result sees Fig. 1.
The identification of recombinant plasmid
FHV C-27 pnca gene fragments are cloned into pMD18-T carriers, and construction recombination plasmid is identified through PCR, in about 200bp
There is a specific band respectively in place, with expected clip size 206bp (such as Fig. 2).Through sequencing identification, in the recombinant plasmid of structure
It is correctly inserted into target gene fragment.
The determination of the end reaction condition of 3.1FHV qPCR detection methods
By the optimization of the conditions such as annealing temperature, extension of time, the cycle-index in repeated multiple times qPCR courses of reaction, really
FHV PCR optimal reaction systems (being shown in Table 2) are determined.Optimal amplification condition：95 DEG C of pre-degenerations 30s, 94 DEG C of denaturation 5s, 60 DEG C of annealing
20s, 72 DEG C of extension 90s, totally 30 circulations, 72 DEG C extend 10min eventually.The DNA extracted by the system of foundation with FHV strains makees
For template, qPCR amplifications are carried out, the genetic fragment size amplified is consistent with expected size.PCR primer send Beijing six directions Hua Da
Gene science limited company is sequenced, the homologys of the FHV gene orders as a result delivered with GenBank 98.7~
99.6%.
Table 2FHV qPCR reaction systems
The preparation of 3.2 standard positive quality-control products
Positive colony is identified that sequencing result is compared with FHV-1 type strains nucleotide sequence in GenBank through sequencing
Right, its homology is 100%.Illustrate to be successfully prepared positive plasmid standard items, can as fluorescence quantitative PCR detection standard
Reference substance.
The foundation of 3.3 quantitative fluorescent PCR standard curves
Using the plasmid concentration of 10 times of gradient dilutions as 1 × 1010Copy/μ L~1 × 104Copy/μ L are carried out as standard items
Amplification, can obtain more neat amplification curve (such as Fig. 3), amplification efficiency is 1.904, and slope is -3.575, shows plasmid concentration
From 104~1010Copy/μ L have good linear relationship (such as Fig. 4).
For the analysis of solubility curve, primer free dimer and non-specific occurs single specific peak at 80 DEG C and in temperature
Property peak (such as Fig. 5).After the completion of fluorescent quantitative PCR, PCR primer carries out electroresis appraisal with 2.0% Ago-Gel, as a result shows
Show at the equal 200bp of standard items there is band, it is consistent with quantitative fluorescent PCR result of determination.
Specificity, sensitiveness, the replica test result of 3.4SYBR Green I PCR detection methods
3.4.1 fluorescent quantitative PCR detection method specific detection
Quantitative fluorescent PCR is respectively less than 31 to the Cq values of FHV-1 genome amplifications, and amplification curve is substantially, is determined as the positive.
Negative control CRFK cells are straight line without amplification.Quantitative fluorescent PCR is used as template to FPV, HSV-1, CHV, PRV genome
Expanded, be straight line without amplification, that is, be determined as feminine gender.2% agar is carried out to above-mentioned fluorescent quantitative PCR result simultaneously
The electrophoresis of sugared gel, as a result shows, the sample containing FHV-1 genomes detects specific band at about 200bp, other
4 kinds of cat disease viral genome samples are not detected by amplified fragments, as a result consistent with quantitative fluorescent PCR result of determination.Therefore, explanation
The FHV fluorescent quantitative PCR detection methods that this research is set up have good specificity.
3.4.2 fluorescent quantitative PCR detection method sensitivity Detection
It is respectively 10 with dilution intervals-1~10-12Different dilution factor viral genomes and its stoste of genome be
Template carries out FHV-1 fluorescence quantitative PCR detections, and the softwares of application Light Cycler 480 carry out data processing, and what is obtained is flat
Equal Cq values.As a result show, FHV-1 dilution factors are 10-1~10-6When can effectively be expanded, average Cq values respectively less than 31.It is right
FHV Monitoring lower-cut is 10-6Dilution, equivalent to 102TCID50/ml.2% agar is carried out to above-mentioned fluorescent quantitative PCR result
The electrophoresis of sugared gel, concentration is 10-1~10-6FHV-1 genomic samples detect about 206bp band.Similarly carry out conventional
PCR detects and electrophoretic analysis that as a result concentration is 10-1~10-5The genomic samples of FHV-1 kinds deposited near about 200bp
In a specific band, it is consistent with expected clip size for 206bp, therefore it is 10 that its sensitivity, which reaches dilution factor,3TCID50/
ml.Illustrating the method for the detection FHV SYBR Green I fluorescent quantitations PCR that this research is set up has higher sensitiveness.
The Cq values of table difference dilution factor FHV kinds
3.4.3 fluorescent quantitative PCR detection method repeatability and Detection of Stability
To 10 times of gradient dilutions 1 × 1010Copy/μ L~1 × 104Copy/μ L standard items carry out the group of quantitative fluorescent PCR
Replica test between interior replica test level group, the coefficient of variation (CV%) of detection Cq values is respectively less than 5%.Prove that this research is set up
Fluorescent quantitative PCR detection method repeatability, have good stability.
The present invention has been successfully established a kind of FHV SYBR Green I fluorescent quantitation PCR detection methods, as a result shows to be built
Vertical method can rapidly and accurately detect FHV.According to the studies above result, the SYBR Green I fluorescence that this research institute sets up is determined
Amount PCR detection method has good application.
SEQUENCE LISTING
<110>Qingdao Agricultural University
<120>A kind of method for detecting feline herpetovirus
<130>
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 26
<212> DNA
<213> 1
<400> 1
acgctacaat tatactcaag ccagaa 26
<210> 2
<211> 22
<212> DNA
<213> 2
<400> 2
tcagctgtta tcttcggatc ca 22
Claims (6)
1. a kind of primer pair, described primer pair, the sequence of its upstream and downstream primer is respectively SEQ ID NO:1 and SEQ ID NO:
2。
2. primer pair described in claim 1 is preparing the application in being used to detect the biological products of feline herpetovirus.
3. application as claimed in claim 2, it is characterised in that described biological products are kit.
4. a kind of kit with detection feline herpetovirus, it is characterised in that include claim 1 institute in described kit
The primer pair stated.
5. application of the primer pair described in claim 1 in the detection that non-diseases diagnoses with the feline herpetovirus of therapeutic purposes.
6. a kind of detection method diagnosed for non-diseases with the feline herpetovirus of therapeutic purposes, it is characterised in that described side
The step of method includes is as follows：
1) nucleic acid for extracting sample to be detected is standby；
2) primer described in usage right requirement 1, carries out SYBR Green I fluorescent quantitations PCR detection, wherein reaction system by
Following components is constituted：
PCR reaction conditions：95 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 50s, 60 DEG C of annealing 45s, 72 DEG C of extension 30s, totally 30 are followed
Ring, 72 DEG C extend 7min eventually；
3) foundation of standard curve：
Using feline herpetovirus genome as template, expanded using above-mentioned sense primer and anti-sense primer, by the mesh of acquisition
Fragment be cloned into pMD18-T carriers, prepare standard items, by template of standard items carry out quantitative fluorescent PCR amplification, set up mark
Directrix curve；
4) according to step 3) amplification condition detected sample is entered performing PCR amplification, it is determined whether there is feline herpetovirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710340186.9A CN106978511A (en) | 2017-05-15 | 2017-05-15 | A kind of method for detecting feline herpetovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710340186.9A CN106978511A (en) | 2017-05-15 | 2017-05-15 | A kind of method for detecting feline herpetovirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106978511A true CN106978511A (en) | 2017-07-25 |
Family
ID=59342149
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710340186.9A Withdrawn CN106978511A (en) | 2017-05-15 | 2017-05-15 | A kind of method for detecting feline herpetovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106978511A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108467905A (en) * | 2018-05-28 | 2018-08-31 | 青岛维特莱博生物科技有限公司 | A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus |
| CN108841998A (en) * | 2018-07-03 | 2018-11-20 | 苏州点晶生物科技有限公司 | Detect primed probe group, quick detection kit and the method for feline herpetovirus I type nucleic acid |
| CN111187855A (en) * | 2020-02-06 | 2020-05-22 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting Feline Herpes Virus (FHV) |
| CN111848785A (en) * | 2020-07-10 | 2020-10-30 | 青岛博隆基因工程有限公司 | Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules |
| CN112921122A (en) * | 2021-03-26 | 2021-06-08 | 广西大学 | Multiplex PCR (polymerase chain reaction) rapid detection kit for common feline viruses and primer group thereof |
| CN113862401A (en) * | 2021-12-03 | 2021-12-31 | 北京市动物疫病预防控制中心 | LAMP primer group for detecting feline herpesvirus type I, fluorescence visualization rapid detection kit and method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726613A (en) * | 2015-03-18 | 2015-06-24 | 上海市动物疫病预防控制中心 | Kit and method for detecting feline infectious rhinotracheitis virus |
-
2017
- 2017-05-15 CN CN201710340186.9A patent/CN106978511A/en not_active Withdrawn
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726613A (en) * | 2015-03-18 | 2015-06-24 | 上海市动物疫病预防控制中心 | Kit and method for detecting feline infectious rhinotracheitis virus |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108467905A (en) * | 2018-05-28 | 2018-08-31 | 青岛维特莱博生物科技有限公司 | A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus |
| CN108841998A (en) * | 2018-07-03 | 2018-11-20 | 苏州点晶生物科技有限公司 | Detect primed probe group, quick detection kit and the method for feline herpetovirus I type nucleic acid |
| CN111187855A (en) * | 2020-02-06 | 2020-05-22 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting Feline Herpes Virus (FHV) |
| CN111187855B (en) * | 2020-02-06 | 2023-11-17 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting Feline Herpesvirus (FHV) |
| CN111848785A (en) * | 2020-07-10 | 2020-10-30 | 青岛博隆基因工程有限公司 | Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules |
| CN111848785B (en) * | 2020-07-10 | 2022-09-06 | 青岛博隆基因工程有限公司 | Feline herpesvirus antibody sequences, tetrapeptide chain molecules, immunoglobulin molecules |
| CN112921122A (en) * | 2021-03-26 | 2021-06-08 | 广西大学 | Multiplex PCR (polymerase chain reaction) rapid detection kit for common feline viruses and primer group thereof |
| CN113862401A (en) * | 2021-12-03 | 2021-12-31 | 北京市动物疫病预防控制中心 | LAMP primer group for detecting feline herpesvirus type I, fluorescence visualization rapid detection kit and method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106978511A (en) | A kind of method for detecting feline herpetovirus | |
| CN104328218B (en) | Synchronize nucleic acid and the detection method thereof of the liquid phase genetic chip of detection five boar virus | |
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN105112559B (en) | A kind of kit and its application for being used to detect coronavirus | |
| CN110567951B (en) | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof | |
| CN102337351B (en) | Typing detection kit for influenza virus | |
| CN106868224A (en) | The RT PCR methods of detection pig blue-ear disease poison classical strainses, highly pathogenic mutant strain and the strains of NADC 30 | |
| CN107034309A (en) | The real-time fluorescence RPA kits of quick detection PRV, test strips RPA kits and application thereof | |
| Piralla et al. | Enterovirus genotype EV-104 in humans, Italy, 2008–2009 | |
| CN105603123A (en) | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits | |
| CN106399585A (en) | Universal PCR primers and method for detecting group I aviadenovirus and detection kit | |
| CN110669870A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for serotype of Palima serogroup virus | |
| CN106521036A (en) | Quadruple PCR detection method capable of identifying canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2 | |
| CN111187756A (en) | Areca-nut yellows-related virus and detection method thereof | |
| CN108165666A (en) | Detection CPV2a, CPV2b and CPV2c and the method for differentiating wild type and vaccine type | |
| CN108624713A (en) | A kind of porcine pseudorabies vaccine virus differentiates the method and kit of detection with wild poison | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN110643740B (en) | Real-time fluorescent quantitative RT-PCR detection primer, probe and detection kit for Pariemam serogroup virus | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN107974514A (en) | A kind of reagent, detection method and application for pig A type Senecan viral diagnosis | |
| CN107287352A (en) | The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection | |
| CN103993102A (en) | Multiple fluorescent PCR method and kit for simultaneous detection of human adenovirus, human mycoplasma pneumonia and bocavirus | |
| Qian et al. | Clustered regularly interspaced short palindromic Repeat/Cas12a mediated multiplexable and portable detection platform for GII genotype Porcine Epidemic Diarrhoea Virus Rapid diagnosis | |
| CN103173535A (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for quantitatively detecting KRECs gene and application thereof | |
| CN105296675A (en) | Nucleic acid detecting kit for influenza B viruses and preparation method of nucleic acid detecting kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20170725 |