CN108467905A - A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus - Google Patents
A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus Download PDFInfo
- Publication number
- CN108467905A CN108467905A CN201810526060.5A CN201810526060A CN108467905A CN 108467905 A CN108467905 A CN 108467905A CN 201810526060 A CN201810526060 A CN 201810526060A CN 108467905 A CN108467905 A CN 108467905A
- Authority
- CN
- China
- Prior art keywords
- detection
- pcr reaction
- kit
- feline herpetovirus
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Nucleic acid combinations, kit and the methods of detection feline herpetovirus, are related to feline herpetovirus detection technique field.The Nucleic acid combinations of detection feline herpetovirus disclosed by the invention include for detecting the base sequence of feline herpetovirus sense primer and the downstream primer as shown in SEQ ID NO.2 as shown in SEQ ID NO.1.There is stronger specificity and higher sensitivity using Nucleic acid combinations detection feline herpetovirus, be conducive to the accuracy for improving testing result.
Description
Technical field
The present invention relates to feline herpetovirus detection technique fields, in particular to a kind of core of detection feline herpetovirus
Acid combination, kit and method.
Background technology
Feline herpetovirus (FHV) is to belong to large-scale virus (100~130nm diameters), has big envelope and bifilar DNA,
In being proliferated in nucleus, and form intranuclear inclusion.
It is the most common virus infection of cat that cat nose bronchitis (also referred to as cat nose branch) is shown after cat infection FHV.
Its classical symptom is based on cat respiratory tract infection caused by virus, and the frequent sneezing of similar flu is had a running nose, cough, fever,
Cat spirit is poor, and give up food.Due to the eye conjunctiva of virus infraction cat, so, also a feature is that the cat of illness will appear and drop tears
So that purulent secretion, chemosis, the serious ulcer of the cornea that can lead to cat are even blinded.
And there is complicated for operation, poor specificity, sensitive in the kit for being directed to cat feline herpetovirus viral diagnosis at present mostly
Spend the defects of low and testing result accuracy is not high.
In consideration of it, special propose the present invention.In consideration of it, special propose the present invention.
Invention content
The purpose of the present invention is to provide a kind of Nucleic acid combinations of detection feline herpetovirus, and cat is detected using the Nucleic acid combinations
Herpesviral has many advantages, such as that specific good, high sensitivity and testing result are reliable.
Another object of the present invention is to provide a kind of kits of detection feline herpetovirus, and cat is detected using the kit
Herpesviral has many advantages, such as that easy to operate, specific good, high sensitivity and testing result are reliable.
Another object of the present invention is to provide a kind of methods of detection feline herpetovirus, and cat is detected using the detection method
Herpesviral has many advantages, such as that easy to operate, detection speed is fast, specific good, high sensitivity and testing result are reliable.
The invention is realized in this way：
A kind of Nucleic acid combinations of detection feline herpetovirus comprising the base sequence such as SEQ for detecting feline herpetovirus
Sense primer shown in ID NO.1 and the downstream primer as shown in SEQ ID NO.2.
It is provided by the invention detection feline herpetovirus Nucleic acid combinations, including sense primer shown in SEQ ID NO.1 and
Downstream primer shown in SEQ ID NO.2, the primer pair are utilized according to the gene order of Simplex Virus Type I envelope glycoprotein D
The BLAST of 5.0 softwares of Primer Premier and NCBI analysis designs obtain, and avoid the interference between primer, hairpin structure
With the FAQs such as dimer.
Sense primer (SEQ ID NO.1)：TACTTCAAGCCTTACGACCA；
Downstream primer (SEQ ID NO.2)：TATCAATGCCACCATCCC.
Primer amplification clip size 189bp.
The Nucleic acid combinations not only can detect feline herpetovirus by fluorescence quantifying PCR method, can also utilize regular-PCR
Feline herpetovirus is detected in conjunction with agarose gel electrophoresis.
There is stronger specificity and higher sensitivity using Nucleic acid combinations detection feline herpetovirus, be conducive to improve
The accuracy and reliability of testing result.
A kind of kit of detection feline herpetovirus comprising Nucleic acid combinations as described above.
Further, in some embodiments of the present invention, the kit further includes：Fluorescence quantitative PCR reaction solution.
Further, in some embodiments of the present invention, also contain in the fluorescence quantitative PCR reaction solution：SYBR
Green I、dNTPs、Mg2+And thermal starting archaeal dna polymerase.
SYBR Green I dyestuffs can be detected feline herpetovirus by real time fluorescence quantifying PCR method, true
It protects on the basis of specificity and sensitivity, also greatly increases detection speed and the convenience of detection.SYBR Green I are
A kind of dyestuff with green excitation wavelength being incorporated into all dsDNA minor grooves region.Under free state, SYBR
Green I send out faint fluorescence, but once combined with double-stranded DNA, and fluorescence greatly enhances.Therefore, SYBR Green I
Fluorescence signal intensity is related to the quantity of double-stranded DNA, and double-stranded DNA number existing for PCR system can be detected according to fluorescence signal
Amount.
Further, in some embodiments of the present invention, the kit further includes：Positive criteria product and feminine gender are right
According to product.
Further, in some embodiments of the present invention, positive criteria product is to contain positive nucleic acid sequence
PMD18-T carriers.
Positive nucleic acid sequence is downstream primer shown in sense primer and SEQ ID NO.2 shown in SEQ ID NO.1
Amplified fragments.
Further, in some embodiments of the present invention, negative controls ddH2O。
A method of detection feline herpetovirus comprising：Nucleic acid combinations as described above are added to quantitative fluorescent PCR
Reaction system carries out quantitative fluorescent PCR reaction.
The method of detection feline herpetovirus provided by the invention, carries out PCR using Nucleic acid combinations as described above, has behaviour
Make the advantages that convenient, detection speed is fast, specificity is good, high sensitivity and testing result are reliable.
Further, in some embodiments of the present invention, contain in PCR reaction systems：SYBR Green I、
dNTPs、Mg2+And thermal starting archaeal dna polymerase.
Further, in some embodiments of the present invention, in PCR reaction systems, a concentration of 2-20 μ of sense primer
Mol/L, a concentration of 2-20 μm of ol/L of downstream primer.
Primer concentration is too high or too low to be had an impact amplification.In some embodiments of the invention, will draw
Object concentration controls the range in 2-20 μm of ol/L, can be to avoid causing mispairing and non-specific amplification, and reduces and formed between primer
The probability of dimer is conducive to improve expanding effect.
Preferably, in some embodiments of the present invention, in PCR reaction systems, a concentration of 10 μ of sense primer
Mol/L, a concentration of 10 μm of ol/L of downstream primer.
Preferably, in some embodiments of the present invention, the annealing temperature of quantitative fluorescent PCR reaction is 55-60 DEG C.
Preferably, in some embodiments of the present invention, the annealing temperature of quantitative fluorescent PCR reaction is 58 DEG C.
Preferably, in some embodiments of the present invention, the condition of quantitative fluorescent PCR reaction includes：95 DEG C of pre-degenerations
3min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 45s, 38-42 recycles.
Annealing temperature is to influence for example specific key factor of PCR amplification effect, and the Nucleic acid combinations of the present invention are come
It says, temperature is quickly cooled to 55-60 DEG C after denaturation, it is possible to reduce the non-specific binding of primer and template improves amplification
Specificity.
Detection method provided by the invention can with high specific, high sensitivity, quickly, it is quantitative accurately to feline herpetovirus
Fluorescence quantitative PCR detection is carried out, while also being had with the detection work and experiment cat Standardization Research of cat to carrying out experiment from now on
Positive facilitation, while by the detection to feline herpetovirus Carriage, the formulation for cat quality control standard provides
Reference frame.
Description of the drawings
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the canonical plotting in experimental example of the present invention；
Fig. 2 is the solubility curve figure in experimental example of the present invention.
Specific implementation mode
It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, builds according to normal condition or manufacturer
The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase
Product.
The feature and performance of the present invention are described in further detail with reference to embodiments.
Viral sample is prevented veterinary laboratories by Qingdao Agricultural University and is provided.
Reverse transcription reagent box (AT301) is purchased from Quan Shijin Bioisystech Co., Ltd；
Embodiment 1
It is provided in this embodiment detection feline herpetovirus kit include：
Primer pair for detecting feline herpetovirus, fluorescence quantitative PCR reaction solution, positive criteria product and negative control
Product.
Fluorescence quantitative PCR reaction solution (being purchased from MCE (China)) contains：SYBR Green I、dNTPs、Mg2+And thermal starting
Archaeal dna polymerase.
The primer pair includes sense primer and downstream primer, and sense primer base sequence is：5’-
TACTTCAAGCCTTACGACCA-3’(SEQ ID NO.1)；Downstream primer base sequence is：5’-
TATCAATGCCACCATCCC-3’(SEQ ID NO.2)。
The primer pair amplifies clip size is 189bp.
Positive criteria product is prepared via a method which：Using feline herpetovirus DNA as template, with above-mentioned sense primer under
Trip primer is expanded, and amplified fragments are connected to pMD18-T plasmid vectors, are transferred to competent cell Escherichia coli, through resistance screening,
It takes positive monoclonal bacterium colony to continue to cultivate, plasmid is extracted using plasmid extraction kit (OMEGA BIO-TEK), plasmid is through sequencing
And comparison, check correct rear use.
Negative controls are ddH2O。
Fluorescent quantitation inspection is carried out to feline herpetovirus using the kit provided in this embodiment for detecting feline herpetovirus
The method of survey：
1 quantitative fluorescent PCR reaction system：
2 μ L of sample to be tested DNA profiling, 10 μ L of fluorescence quantitative PCR reaction solution, 10 μm of ol/L of sense primer, 10 μ of downstream primer
Mol/L plus ddH2O to 20 μ L.
If sample is RNA virus, after RNA need to being extracted, reverse transcription at after cDNA be used as template.
2 95 DEG C of quantitative fluorescent PCR reaction condition pre-degeneration 3min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C extend
45s, 40 cycles.
3 result judgements
In specific detection, positive control and negative control can be set up simultaneously, according to amplification curve judging result,
Positive control has apparent amplification curve, negative control not to have amplification curve appearance, at this point, negative and positive control is all
It sets up, can be judged；If sample to be tested amplification curve Ct values>40, or without amplification curve, it is determined as feminine gender, if Ct values<40 and
Amplification curve well can directly be determined as the positive.
Experimental example 1
Make standard curve
Above-mentioned positive criteria product is subjected to 10 times of gradient dilutions, takes 1.0 × 10 respectively1、1.0×102、1.0×103、1.0
×104、1.0×105、1.0×106It is fixed to carry out fluorescence using each dilution as template as described in Example 1 for copy/μ L
PCR amplification is measured, the standard curve of amplified reaction is obtained, as shown in Figure 1, equation of linear regression is：Y=-3.4049x+35.439,
R2=0.9914.Use the feline herpetovirus kit that embodiment 1 provides in plasmid concentration for 10 as a result,1-106Copy/μ L's
There is good linear relationship in concentration range.
Experimental example 2
The results are shown in Figure 2 for solubility curve, the solution temperature T of amplified productionmIt is 77.1-77.6 DEG C, no non-specificity
Product peak and primer dimer.
Experimental example 3
Sensitivity technique
Take positive criteria product stoste 1.2 × 106Copy/μ L carries out 10 times of gradient dilutions to 1.2 × 101, using embodiment 1
Kit and method carry out fluorescent quantitative PCR, determine its minimum detection limit, the results are shown in Table 1,1.2 ×
101There is good amplification curve, C in copies/ μ L concentrationTValue is 31.23, is less than 40, can realize the detection to sample,
Illustrate that the kit of embodiment 1 has higher sensitivity.
Table 1
| Positive criteria product (copies/ μ L) | CTValue |
| 1.2×106 | 14.78 |
| 1.2×105 | 17.66 |
| 1.2×104 | 20.15 |
| 1.2×103 | 23.68 |
| 1.2×102 | 28.57 |
| 1.2×101 | 31.23 |
Experimental example 4
Specific detection
Feline calicivirus (FCV), FRtV, cat whiting born of the same parents reduce syndrome virus (FPV), canine distemper virus (CDV), feline herpesvirus disease
The DNA or cDNA of malicious (FHV) and cat enteric coronavirus viral ((FECV)) are template, using the kit and method of embodiment 1
Fluorescent quantitative PCR is carried out, the results show that only feline herpetovirus sample has amplification curve, other viruses do not have apparent
Thus amplification curve illustrates there is good specificity using the feline herpetovirus detection kit and method of embodiment 1.
Experimental example 5
Repeatability
3 positive criteria products are chosen, quantitative fluorescent PCR is carried out using the kit and method of embodiment 1；The results show that
The C of positive criteria producttBe worth repetitive test CV values be less than 1%, illustration method it is reproducible.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, any made by repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>The Qingdao bio tech ltd Wei Telaibo
<120>A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
tacttcaagc cttacgacca 20
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<400> 2
tatcaatgcc accatccc 18
Claims (11)
1. a kind of Nucleic acid combinations of detection feline herpetovirus, which is characterized in that it includes the base for detecting feline herpetovirus
Sequence sense primer and the downstream primer as shown in SEQ ID NO.2 as shown in SEQ ID NO.1.
2. a kind of kit of detection feline herpetovirus, which is characterized in that it includes Nucleic acid combinations described in claim 1.
3. the kit of detection feline herpetovirus according to claim 2, which is characterized in that the kit further includes：
Fluorescence quantitative PCR reaction solution.
4. the kit of detection feline herpetovirus according to claim 3, which is characterized in that
Contain in the fluorescence quantitative PCR reaction solution：SYBR Green I、dNTPs、Mg2+And thermal starting archaeal dna polymerase.
5. the kit of detection feline herpetovirus according to claim 3, which is characterized in that the kit further includes：
Positive criteria product and negative controls.
6. a kind of method of detection feline herpetovirus, which is characterized in that it includes：Nucleic acid combinations described in claim 1 are added
Enter to quantitative fluorescent PCR reaction system, carries out quantitative fluorescent PCR reaction.
7. according to the method described in claim 6, it is characterized in that, in quantitative fluorescent PCR reaction system, the concentration of sense primer
For 2-20 μm of ol/L, a concentration of 2-20 μm of ol/L of downstream primer.
8. the method according to the description of claim 7 is characterized in that containing in quantitative fluorescent PCR reaction system：SYBR Green
I、dNTPs、Mg2+And thermal starting archaeal dna polymerase.
9. according to claim 6-8 any one of them methods, which is characterized in that quantitative fluorescent PCR reaction annealing temperature be
55-60℃。
10. according to the method described in claim 9, it is characterized in that, the annealing temperature of quantitative fluorescent PCR reaction is 58 DEG C.
11. according to the method described in claim 10, it is characterized in that, the condition of quantitative fluorescent PCR reaction includes：95 DEG C of pre- changes
Property 3min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 45s, 38-42 recycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810526060.5A CN108467905A (en) | 2018-05-28 | 2018-05-28 | A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810526060.5A CN108467905A (en) | 2018-05-28 | 2018-05-28 | A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108467905A true CN108467905A (en) | 2018-08-31 |
Family
ID=63261553
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810526060.5A Pending CN108467905A (en) | 2018-05-28 | 2018-05-28 | A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108467905A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109338015A (en) * | 2018-11-05 | 2019-02-15 | 苏州蝌蚪生物技术有限公司 | Detect primer, trapping nucleic acids gold label test strip, kit and the application of FHV-1 virus |
| CN111187855A (en) * | 2020-02-06 | 2020-05-22 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting Feline Herpes Virus (FHV) |
| CN114214460A (en) * | 2021-12-24 | 2022-03-22 | 苏州中科先进技术研究院有限公司 | Primer probe composition, kit and method for detecting feline herpes virus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106978511A (en) * | 2017-05-15 | 2017-07-25 | 青岛农业大学 | A kind of method for detecting feline herpetovirus |
| CN107586884A (en) * | 2017-10-25 | 2018-01-16 | 东北农业大学 | A kind of RT PCR primer groups for feline infectious peritonitis virus detection, kit and its application containing the primer sets |
-
2018
- 2018-05-28 CN CN201810526060.5A patent/CN108467905A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106978511A (en) * | 2017-05-15 | 2017-07-25 | 青岛农业大学 | A kind of method for detecting feline herpetovirus |
| CN107586884A (en) * | 2017-10-25 | 2018-01-16 | 东北农业大学 | A kind of RT PCR primer groups for feline infectious peritonitis virus detection, kit and its application containing the primer sets |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109338015A (en) * | 2018-11-05 | 2019-02-15 | 苏州蝌蚪生物技术有限公司 | Detect primer, trapping nucleic acids gold label test strip, kit and the application of FHV-1 virus |
| CN111187855A (en) * | 2020-02-06 | 2020-05-22 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting Feline Herpes Virus (FHV) |
| CN111187855B (en) * | 2020-02-06 | 2023-11-17 | 广州普世利华科技有限公司 | RDA method and kit for rapidly detecting Feline Herpesvirus (FHV) |
| CN114214460A (en) * | 2021-12-24 | 2022-03-22 | 苏州中科先进技术研究院有限公司 | Primer probe composition, kit and method for detecting feline herpes virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106957927B (en) | African swine fever fluorescent PCR detection reagent, African swine fever fluorescent PCR detection kit and application thereof | |
| CN111235316B (en) | Primer probe for identifying novel coronavirus and application of primer probe in triple fluorescence RPA | |
| CN105624330B (en) | 12 boar common virus and bacterium Taqman-MGB PCR kit for fluorescence quantitative and method are detected simultaneously | |
| CN108103245B (en) | Method for detecting lentivirus quality index combination and application thereof | |
| CN104195268B (en) | Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C | |
| CN108467905A (en) | A kind of Nucleic acid combinations, kit and the method for detection feline herpetovirus | |
| CN110777220A (en) | Primer group, probe, RPA test strip kit and identification method | |
| CN108866243B (en) | Porcine enterocoronavirus 4-fold fluorescent quantitative PCR detection kit | |
| CN113584226A (en) | Multiple fluorescent quantitative primer and probe for differential diagnosis of African swine fever virus P72/MGF/CD2v and application thereof | |
| CN108893559A (en) | A kind of Nucleic acid combinations, kit and method detecting cat coronavirus | |
| CN114015815B (en) | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof | |
| CN106834549A (en) | The cross primer amplification immune chromatography test paper of detection pseudorabies virus street strain is combined the primer and probe groups and kit of method | |
| CN100352944C (en) | Fluorescence quantitative kit PCR for quick testing fine | |
| CN105002284A (en) | Haemophilus paragallinarum fluorogenic quantitative PCR detection method | |
| CN109234464A (en) | For detecting primer and probe, the PCR kit for fluorescence quantitative and methods and applications of Seneca Valley virus | |
| CN112981007A (en) | Kit for detecting Han beach type hantavirus and detection method thereof | |
| CN108998575B (en) | Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus | |
| CN115725788A (en) | Primer and TaqMan probe for detecting feline parvovirus and application thereof | |
| CN105331741B (en) | A kind of the HRM detection method and primer of quick identification mouse encephalomyelitis virus and rat Taylor's virus | |
| CN117210615B (en) | TaqMan fluorescent quantitative RT-PCR detection method and application of porcine Mannich virus | |
| CN104342500B (en) | Detect the primer of foot and mouth disease Asia 1 C-type virus C, detection kit and preparation method | |
| CN105018605A (en) | Method for rapid detection and identification of Seoul virus | |
| CN110923364A (en) | Method for detecting multiple viruses in sample by utilizing multiple quantitative PCR technology | |
| CN109234463A (en) | For detecting primer and probe, the PCR kit for fluorescence quantitative and methods and applications of transmissible gastro-enteritis virus | |
| Qian et al. | Development of a triplex real-time quantitative PCR for detection and differentiation of genotypes I and II African swine fever virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180831 |