CN111825676B

CN111825676B - Dihydropyrimidine compounds and application thereof in medicines

Info

Publication number: CN111825676B
Application number: CN202010284198.6A
Authority: CN
Inventors: 任青云; 张英俊; 刘辛昌; 颜光华; 王猛; 雷斗兴; 王兴安; 王恒; 陈允甫; 赖庆莹; 尹丽华; 李静; 郭亮洪
Original assignee: Guangdong HEC Pharmaceutical
Current assignee: Guangdong HEC Pharmaceutical
Priority date: 2019-04-15
Filing date: 2020-04-13
Publication date: 2023-10-17
Anticipated expiration: 2040-04-13
Also published as: CN111825676A

Abstract

The invention relates to a dihydropyrimidine compound and application thereof as a medicament, in particular to application thereof as a medicament for treating and preventing hepatitis B. Specifically, the invention relates to a compound shown in a general formula (I) or (Ia) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, wherein each variable is defined as in the specification. The invention also relates to the use of the compounds of the general formula (I) or (Ia) or stereoisomers, tautomers, nitrogen oxides, solvates, metabolites and pharmaceutically acceptable salts thereof as medicaments, in particular as medicaments for the treatment and prophylaxis of hepatitis B.

Description

Dihydropyrimidine compounds and application thereof in medicines

Technical Field

The invention belongs to the field of medicines. In particular, the invention relates to dihydropyrimidine compounds and their use as medicaments, especially as medicaments for the treatment and/or prophylaxis of hepatitis b. The invention also relates to compositions of these dihydropyrimidine compounds with other antiviral agents, and their use for the treatment and/or prevention of Hepatitis B Virus (HBV) infection.

Background

Hepatitis b virus belongs to the family of hepatiridae. It may cause acute and/or persistent progressive chronic diseases. Hepatitis b virus can also cause many other clinical manifestations in pathological forms-especially chronic inflammation of the liver, cirrhosis and canceration of hepatocytes. In addition, co-infection with hepatitis D can have adverse effects during the course of the disease.

Conventional drugs approved for the treatment of chronic hepatitis are interferon and lamivudine (lamivudine). However, interferon has only moderate activity and has high toxic and side effects; although lamivudine (lamivudine) has good activity, its resistance increases rapidly during the course of treatment and is often after stopping the treatmentIC of lamivudine (3-TC) with rebound effect ₅₀ The value was 300nM (Science, 299 (2003), 893-896).

Deres et al report heteroaromatic ring substituted dihydropyrimidine (HAP) compounds represented by Bay41-4109 and Bay39-5493, which can inhibit HBV replication by preventing normal nucleocapsid formation. Bay41-4109 shows better drug metabolism property in clinical study (Science, 299 (2003), 893-896), and through the study of the action mechanism, the heteroaromatic ring substituted dihydropyrimidine compound changes the included angle between dimers forming nucleocapsid through the action of the heteroaromatic ring substituted dihydropyrimidine compound and 113-143 amino acid residues of core protein, so that unstable swelling nucleocapsid is formed, and degradation of core protein is accelerated (biochem. Pharmacol.66 (2003), 2273-2279).

There is still a need for new compounds that can be effectively used as antiviral drugs, in particular as drugs for the treatment and/or prophylaxis of hepatitis b.

Disclosure of Invention

The invention relates to novel dihydropyrimidine compounds and application thereof in preparing medicaments for treating and preventing HBV infection. In particular, the invention relates to a novel dihydropyrimidine compound and a pharmaceutically acceptable composition thereof, and the compound has the advantages of good pharmacokinetic property, good solubility, good stability, basically no induction effect on liver drug enzymes, less toxicity and the like, can effectively inhibit HBV infection, and has good application prospect in anti-HBV aspect.

In one aspect, the present invention relates to a compound of formula (I) or (Ia) or a stereoisomer, tautomer, nitroxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of a compound of formula (I) or (Ia),

wherein each R ¹ 、R ^1b And R is ^1a Independently hydrogen, deuterium, F, cl, br, I, cyano, methyl, ethyl, methoxy, ethoxy, methylAmino, ethylamino, nitro, 4-trifluoromethylphenyl, 3, 5-bis (trifluoromethyl) phenyl or trifluoromethyl;

R ² Is C _1-6 Alkyl, C _1-6 Haloalkyl, C _3-6 Cycloalkyl or heterocyclyl consisting of 5 to 6 ring atoms;

R ³ is C ₆ -C ₁₀ Aryl or heteroaryl consisting of 5 to 6 ring atoms, wherein said C ₆ -C ₁₀ Aryl and heteroaryl consisting of 5-6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 groups selected from deuterium, F, cl, br, OH, CN, C _1-6 Alkyl, hydroxy C _1-6 Alkyl, C _1-6 alkyl-OC (=o) -, C _1-6 alkyl-OC (=o) -C _1-6 Alkylene, HOOC-C _1-6 Alkylene, C _1-6 alkoxy-C _1-6 Alkylene and C _1-6 alkyl-S (=o) ₂ -substituted with a substituent;

w is CH or N;

X ¹ is-C (=O) -, -S (=O) ₂ -or- (CR) ⁵ R ⁶ ) _j -；

Each R is ⁴ 、R ^4a 、R ^4b And R is ⁵ Independently hydrogen, deuterium, F, cl, br, amino, C _1-4 Alkoxy, C _1-6 Alkyl, NH ₂ C(＝O)-、C _1-6 alkyl-OC (=o) -, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-4 Alkylene or C _1-6 A haloalkyl group;

R ⁶ deuterium, F, cl, br, amino, C _1-6 Alkyl, NH ₂ C(＝O)-、C _1-6 alkyl-OC (=o) -, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-4 Alkylene or C _1-6 A haloalkyl group;

or R is ⁵ 、R ⁶ And together with the carbon atoms to which they are attached form C _3-6 Cycloalkyl or carbonyl;

each R is ⁹ Independently hydrogen, deuterium, F, cl, br, amino, C _1-6 Alkyl, NH ₂ C(＝O)-、C _1-6 alkyl-OC (=o) -, carboxyl C _1-6 Alkylene, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-4 Alkylene or C _1-6 A haloalkyl group;

R ^x Is hydrogen, R ⁷ R ⁸ NC(＝O)-、R ^7a R ^8a NC(＝O)-(CR ⁵ R ⁶ )-、R ⁷ R ⁸ NC(＝O)-C _2-6 Alkylene-, R ⁷ R ⁸ NC(＝O)-C _2-6 Alkenylene-, R ¹¹ -S(＝O) ₂ NR ¹⁰ -C _0-6 Alkylene-or R ^11a -S(＝O) ₂ NR ¹⁰ -C _2-6 Alkenylene-, wherein R is ⁷ R ⁸ NC(＝O)-C _2-6 alkylene-of-C _2-6 Alkylene-, R ⁷ R ⁸ NC(＝O)-C _2-6 alkenylene-in-C _2-6 Alkenylene-, R ¹¹ -S(＝O) ₂ NR ¹⁰ -C _0-6 alkylene-of-C _0-6 Alkylene group-and R ^11a -S(＝O) ₂ NR ¹⁰ -C _2-6 alkenylene-in-C _2-6 Alkenylene-each independently unsubstituted or substituted with 1, 2 or 3 members selected from deuterium, F, cl, br, OH, CN, C _1-6 Alkyl, hydroxy C _1-6 Alkyl and C _1-6 Substituted by a substituent of haloalkyl;

R ^y is hydrogen, F, R ^7b R ^8b NC(＝O)-C _0-6 Alkylene-, R ^7b R ^8b NC(＝O)-C _2-6 Alkenylene-, R ^11a -S(＝O) ₂ NR ¹⁰ -C _0-6 Alkylene-or R ^11a -S(＝O) ₂ NR ¹⁰ -C _2-6 Alkenylene-, wherein R is ^7b R ^8b NC(＝O)-C _0-6 alkylene-of-C _0-6 Alkylene-, R ^7b R ^8b NC(＝O)-C _2-6 alkenylene-in-C _2-6 Alkenylene-, R ^11a -S(＝O) ₂ NR ¹⁰ -C _0-6 alkylene-of-C _0-6 Alkylene group-and R ^11a -S(＝O) ₂ NR ¹⁰ -C _2-6 alkenylene-in-C _2-6 Alkenylene-each independently unsubstituted or substituted with 1, 2 or 3 members selected from deuterium, F, cl, br, OH, CN, C _1-6 Alkyl, hydroxy C _1-6 Alkyl and C _1-6 Substituted by a substituent of haloalkyl;

each R is ⁷ Independently hydrogen, deuterium, C _1-6 Alkyl, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-3 Alkylene or C _1-6 A haloalkyl group;

each R is ⁸ Independently deuterium, C _1-6 Alkyl, C _3-6 Cycloalkyl, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-3 Alkylene or C _1-6 A haloalkyl group;

or R is ⁷ 、R ⁸ And together with the nitrogen atom to which they are attached form a heterocyclic group consisting of 3 to 6 ring atoms;

R ^7a is hydrogen, deuterium, C _1-6 Alkyl, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-3 Alkylene or C _1-6 A haloalkyl group;

R ^8a is deuterium, C _1-6 Alkyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-3 Alkylene or C _1-6 A haloalkyl group;

or R is ^7a 、R ^8a And together with the nitrogen atom to which they are attached form a heterocyclic group consisting of 3 to 6 ring atoms;

R ^7b is hydrogen, deuterium, C _1-6 Alkyl, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-3 Alkylene or C _1-6 A haloalkyl group;

R ^8b is hydrogen, deuterium, C _1-6 Alkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-3 Alkylene or C _1-6 A haloalkyl group;

or R is ^7b 、R ^8b And together with the nitrogen atom to which they are attached form a heterocyclic group consisting of 3 to 6 ring atoms;

each R is ¹⁰ Independently hydrogen, deuterium, C _1-6 Alkyl, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-4 Alkylene or C _1-6 A haloalkyl group;

each R is ¹¹ Independently C _2-6 Alkyl, C _3-6 Cycloalkyl, heterocyclyl consisting of 3-6 ring atoms, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-4 Alkylene or C _1-6 A haloalkyl group;

each R is ^11a Independently C _1-6 Alkyl, C _3-6 Cycloalkyl, heterocyclyl consisting of 3-6 ring atoms, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-4 Alkylene or C _1-6 A haloalkyl group;

m is 0, 1, 2, 3 or 4;

j is 1, 2 or 3.

In some embodiments, R as described in the present invention ² Is methyl, ethyl, n-propyl, isopropyl, C _1-4 Haloalkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl;

R ³ is phenyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the phenyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 groups selected from deuterium, F, cl, br, OH, CN, methyl, ethyl, n-propyl, isopropyl, tert-butyl, hydroxy C _1-4 Alkyl, C _1-4 alkyl-OC (=o) -, C _1-4 alkyl-OC (=o) -C _1-3 Alkylene-, HOOC-C _1-3 Alkylene-, C _1-4 alkoxy-C _1-3 Alkylene-and C _1-4 alkyl-S (=o) ₂ -substituted with a substituent.

In some embodiments, each R as described herein ⁴ 、R ^4a 、R ^4b And R is ⁵ Independently hydrogen, deuterium, F, cl, br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, NH ₂ C(＝O)-、C _1-4 alkyl-OC (=o) -, hydroxy C _1-4 Alkyl, methoxy, ethoxy, n-propoxy, isopropoxy, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

R ⁶ deuterium, F, cl, br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH ₂ C(＝O)-、C _1-4 alkyl-OC (=o) -, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

or R is ⁵ 、R ⁶ And together with the carbon atoms to which they are attached form cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or carbonyl;

each R is ⁹ Independently hydrogen, deuterium, F, cl, br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, NH ₂ C(＝O)-、C _1-4 alkyl-OC (=o) -, carboxyl C _1-4 Alkylene, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group.

In some embodiments, R as described in the present invention ^x Is hydrogen, R ⁷ R ⁸ NC(＝O)-、R ^7a R ^8a NC(＝O)-(CR ⁵ R ⁶ )-、R ⁷ R ⁸ NC(＝O)-C _2-4 Alkylene-, R ⁷ R ⁸ NC(＝O)-C _2-4 Alkenylene-, R ¹¹ -S(＝O) ₂ NR ¹⁰ -C _0-4 Alkylene-or R ^11a -S(＝O) ₂ NR ¹⁰ -C _2-4 Alkenylene-, wherein R is ⁷ R ⁸ NC(＝O)-C _2-4 alkylene-of-C _2-4 Alkylene-, R ⁷ R ⁸ NC(＝O)-C _2-4 alkenylene-in-C _2-4 Alkenylene-, R ¹¹ -S(＝O) ₂ NR ¹⁰ -C _0-4 alkylene-of-C _0-4 Alkylene group-and R ^11a -S(＝O) ₂ NR ¹⁰ -C _2-4 alkenylene-in-C _2-4 Alkenylene-each independently unsubstituted or substituted with 1, 2 or 3 members selected from deuterium, F, cl, br, OH, CN, C _1-4 Alkyl, hydroxy C _1-4 Alkyl and C _1-4 Substituted by a substituent of haloalkyl;

R ^y is hydrogen, F, R ^7b R ^8b NC(＝O)-C _0-4 Alkylene-, R ^7b R ^8b NC(＝O)-C _2-4 Alkenylene-, R ^11a -S(＝O) ₂ NR ¹⁰ -C _0-4 Alkylene-or R ^11a -S(＝O) ₂ NR ¹⁰ -C _2-4 Alkenylene-, wherein R is ^7b R ^8b NC(＝O)-C _0-4 alkylene-of-C _0-4 Alkylene-, R ^7b R ^8b NC(＝O)-C _2-6 alkenylene-in-C _2-4 Alkenylene-, R ^11a -S(＝O) ₂ NR ¹⁰ -C _0-4 alkylene-of-C _0-4 Alkylene group-and R ^11a -S(＝O) ₂ NR ¹⁰ -C _2-4 alkenylene-in-C _2-4 Alkenylene-each independently unsubstituted or substituted with 1, 2 or 3 members selected from deuterium, F, cl, br, OH, CN, C _1-4 Alkyl, hydroxy C _1-4 Alkyl and C _1-4 Substituted by a substituent of haloalkyl;

wherein each R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ^7a 、R ^8a 、R ^7b 、R ^8b 、R ¹⁰ 、R ¹¹ And R is ^11a Having the meaning described in the present invention.

In some embodiments, R as described in the present invention ^x Is hydrogen, R ⁷ R ⁸ NC(＝O)-、R ^7a R ^8a NC(＝O)-(CR ⁵ R ⁶ )-、R ⁷ R ⁸ NC(＝O)-(CH ₂ ) ₂ -、R ⁷ R ⁸ NC(＝O)-(CH ₂ ) ₃ -、R ⁷ R ⁸ NC(＝O)-CH＝CH-、R ⁷ R ⁸ NC(＝O)-CH＝CH-CH ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -CH ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₃ -、R ^11a -S(＝O) ₂ NR ¹⁰ -ch=ch-or R ^11a -S(＝O) ₂ NR ¹⁰ -CH＝CH-CH ₂ -, wherein said R ⁷ R ⁸ NC(＝O)-(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -、R ⁷ R ⁸ NC(＝O)-(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ -、R ⁷ R ⁸ -ch=ch-, R in NC (=o) -ch=ch-, and ⁷ R ⁸ NC(＝O)-CH＝CH-CH ₂ -ch=ch-CH in = ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -CH ₂ -CH in ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ -、R ^11a -S(＝O) ₂ NR ¹⁰ -ch=ch-or R of-ch=ch- ^11a -S(＝O) ₂ NR ¹⁰ -CH＝CH-CH ₂ -ch=ch-CH in = ₂ Each independently unsubstituted or substituted with 1, 2 or 3 groups selected from deuterium, F, cl, br, OH, CN, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, hydroxy C _1-3 Alkyl and C _1-3 Substituted by a substituent of haloalkyl;

R ^y is hydrogen, F, R ^7b R ^8b NC(＝O)-、R ^7b R ^8b NC(＝O)-CH ₂ -、R ^7b R ^8b NC(＝O)-(CH ₂ ) ₂ -、R ^7b R ^8b NC(＝O)-(CH ₂ ) ₃ -、R ^7b R ^8b NC(＝O)-CH＝CH-、R ^7b R ^8b NC(＝O)-CH＝CH-CH ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -、R ^11a -S(＝O) ₂ NR ¹⁰ -CH ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₃ -、R ^11a -S(＝O) ₂ NR ¹⁰ -ch=ch-or R ^11a -S(＝O) ₂ NR ¹⁰ -CH＝CH-CH ₂ -, wherein said R ^7b R ^8b NC(＝O)-CH ₂ -CH in ₂ -、R ^7b R ^8b NC(＝O)-(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -、R ^7b R ^8b NC(＝O)-(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ -、R ^7b R ^8b -ch=ch-, R in NC (=o) -ch=ch-, and ^7b R ^8b NC(＝O)-CH＝CH-CH ₂ -ch=ch-CH in = ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -CH ₂ -CH in ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ -、R ^11a -S(＝O) ₂ NR ¹⁰ -ch=ch-and R of-ch=ch- ^11a -S(＝O) ₂ NR ¹⁰ -CH＝CH-CH ₂ -ch=ch-CH in = ₂ Each independently unsubstituted or substituted with 1, 2 or 3 groups selected from deuterium, F, cl, br, OH, CN, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, hydroxy C _1-4 Alkyl and C _1-4 Substituted by a substituent of haloalkyl;

In some embodiments, each R as described herein ⁷ Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

each R is ⁸ Independently deuterium, methyl, ethyl, n-propyl, isopropylN-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

or R is ⁷ 、R ⁸ And together with the nitrogen atom to which they are attached form an aziridinyl, azetidinyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl group;

R ^7a is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

R ^8a deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

or R is ^7a 、R ^8a And together with the nitrogen atom to which they are attached form an aziridinyl, azetidinyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl group;

each R is ^7b Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

each R is ^8b Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

or R is ^7b 、R ^8b And together with the nitrogen atom to which they are attached form an aziridinyl, azetidinyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl group.

In some embodimentsIn the invention, each R ¹⁰ Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

each R is ¹¹ Independently ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, aziridinyl, azetidinyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

each R is ^11a Independently methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, aziridinyl, azetidinyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, hydroxyC _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group.

On the other hand, the invention also provides a pharmaceutical composition which comprises the compound and pharmaceutically acceptable auxiliary materials.

In some embodiments, the pharmaceutical compositions of the present invention further comprise other anti-HBV agents.

In some embodiments, the pharmaceutical composition of the invention, wherein the other anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator or an interferon.

In some embodiments, the pharmaceutical composition of the invention, wherein the additional anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, cil Mo Baijie, cladvudine, emtricitabine, faprasuavir, interferon, baganine CP, clomiphene, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, miltefoster, nitazoxanide, polyethylene glycol interferon alpha-2 a, ribavirin, luo Raosu-a, cizopyran, euforavac, an Puli near, phosphazid, heplisav, interferon alpha-2 b, levamisole or propargite.

In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the manufacture of a medicament for preventing, treating or alleviating a viral disease in a patient.

In some embodiments, the use of the invention, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

In other embodiments, the use of the invention, wherein the disease caused by hepatitis b infection is cirrhosis or hepatocellular carcinoma.

In another aspect, the invention relates to the use of said compound or pharmaceutical composition for the manufacture of a medicament for preventing, treating or alleviating a hepatitis b disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound according to the invention or a pharmaceutical composition according to the invention.

Another aspect of the invention relates to a method of preventing, treating or alleviating HBV conditions in a patient comprising administering to the patient a pharmaceutically acceptable effective dose of a compound of the invention.

Another aspect of the invention relates to a method of preventing, treating or alleviating HBV disorders in a patient comprising administering to the patient a pharmaceutically acceptable effective dose of a pharmaceutical composition comprising a compound of the invention.

Another aspect of the invention relates to the use of a compound of the invention for the manufacture of a medicament for preventing or treating, and lessening the severity of, HBV disorders in a patient.

Another aspect of the invention relates to the use of a pharmaceutical composition comprising a compound of the invention for the manufacture of a medicament for preventing or treating HBV disorders in a patient and reducing the severity thereof.

In another aspect, the invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or pharmaceutical composition of the invention in an amount effective to inhibit HBV. In still other embodiments, the method further comprises contacting the cell with an additional anti-HBV therapeutic agent.

Another aspect of the invention relates to a method of treating HBV disease in a patient, comprising administering to a patient in need thereof a therapeutically effective amount of a compound of the invention or a pharmaceutical composition thereof. In still other embodiments, the method further comprises administering to a patient in need of treatment a therapeutically effective amount of an additional anti-HBV agent.

Another aspect of the invention relates to a method of inhibiting HBV infection in a patient, the method comprising administering to a patient in need of treatment a therapeutically effective amount of a compound of the invention or a pharmaceutical composition thereof. In still other embodiments, the method further comprises administering to a patient in need of treatment a therapeutically effective amount of an additional anti-HBV agent.

Another aspect of the invention relates to methods for the preparation, isolation and purification of compounds comprised by formula (I) or formula (Ia).

The foregoing merely outlines certain aspects of the invention and is not limited in this regard. These and other aspects are described more fully below.

Detailed description of the invention

Definitions and general terms

The present invention will be described in detail with reference to certain specific details, examples of which are provided with an explanation of the structural formulae and chemical formulae. The invention is intended to cover all alternatives, modifications and equivalents, which may be included within the scope of the invention as defined by the appended claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein that can be used in the practice of the present invention. The invention is in no way limited to the description of methods and materials. There are numerous documents and similar substances which differ or contradict the present application, including but in no way limited to the definition of terms, the use of terms, the described techniques, or the scope of control as per the present application.

The invention will apply to the following definitions unless otherwise indicated. For the purposes of the present invention, the chemical elements are described in terms of the periodic table of the elements, CAS version and handbook of chemicals, 75, ^th ed, 1994. In addition, the general principles of organic chemistry are found in "Organic Chemistry," Thomas Sorrell, university Science Books, sausalato 1999,and"March's Advanced Organic Chemistry," by Michael B.Smith and Jerry March, john Wiley &Sons, new York:2007, and thus all references are incorporated herein by reference.

The compounds of the invention may be optionally substituted with one or more substituents, as described in the present invention, such as the compounds of the general formula above, or as specific examples within the examples, subclasses, and classes of compounds encompassed by the invention.

In general, the term "substituted" means that one or more hydrogen atoms in a given structure are replaced with a specific substituent. An optional substituent group may have a substituent substituted at each substitutable position of the group unless otherwise indicated. When more than one position in a given formula can be substituted with one or more substituents selected from a particular group, then the substituents may be the same or different at each position. Wherein the substituents may be, but are not limited to, deuterium, F, cl, br, OH, C _1-8 Alkyl, C _1-8 Alkoxy, HOOC- (CR) ⁷ R ⁸ ) _q -or C _1-8 Alkoxy- (CR) ⁷ R ⁸ ) _k -O-, wherein q, k, R are substituted with substituents of formula (I) ⁷ And R is ⁸ Having the meaning described in the present invention.

In the various parts of the present specification, substituents of the compounds of the invention are disclosed in terms of the type or scope of groups. It is specifically noted that the present invention includes each individual subcombination of the individual members of these group classes and ranges. For example, the term "C _1-6 Alkyl "means in particular methyl, ethyl, C independently disclosed ₃ Alkyl, C ₄ Alkyl, C ₅ Alkyl and C ₆ An alkyl group.

The term "alkyl" as used herein includes saturated straight or branched chain monovalent hydrocarbon radicals of 1 to 20 carbon atoms, wherein the alkyl radicals may independently be optionally substituted by one or more substituents as described herein. Some embodiments are where the alkyl group contains 1-12 carbon atoms, some other embodiments are where the alkyl group contains 1-10 carbon atoms, some other embodiments are where the alkyl group contains 1-8 carbon atoms, some other embodiments are where the alkyl group contains 1-6 carbon atoms, some other embodiments are where the alkyl group contains 1-4 carbon atoms, and some other embodiments are where the alkyl group contains 1-3 carbon atoms. Further examples of alkyl groups include, but are not limited to, methyl (Me, -CH) ₃ ) Ethyl (Et, -CH) ₂ CH ₃ ) N-propyl (n-Pr, -CH) ₂ CH ₂ CH ₃ ) Isopropyl (i-Pr, -CH (CH) ₃ ) ₂ ) N-butyl (n-Bu, -CH) ₂ CH ₂ CH ₂ CH ₃ ) 2-methylpropyl or isobutyl (i-Bu, -CH) ₂ CH(CH ₃ ) ₂ ) 1-methylpropyl or sec-butyl (s-Bu, -CH (CH) ₃ )CH ₂ CH ₃ ) Tert-butyl (t-Bu, -C (CH) ₃ ) ₃ ) N-pentyl (-CH) ₂ CH ₂ CH ₂ CH ₂ CH ₃ ) 2-pentyl (-CH (CH) ₃ )CH ₂ CH ₂ CH ₃ ) 3-pentyl (-CH (CH) ₂ CH ₃ ) ₂ ) 2-methyl-2-butyl (-C (CH) ₃ ) ₂ CH ₂ CH ₃ ) 3-methyl-2-butyl (-CH (CH) ₃ )CH(CH ₃ ) ₂ ) 3-methyl-1-butyl (-CH) ₂ CH ₂ CH(CH ₃ ) ₂ ) 2-methyl-1-butyl (-CH) ₂ CH(CH ₃ )CH ₂ CH ₃ ) N-hexyl (-CH) ₂ CH ₂ CH ₂ CH ₂ CH ₂ CH ₃ ) 2-hexyl (-CH (CH) ₃ )CH ₂ CH ₂ CH ₂ CH ₃ ) 3-hexyl (-CH (CH) ₂ CH ₃ )(CH ₂ CH ₂ CH ₃ ) 2-methyl-2-pentyl (-C (CH) ₃ ) ₂ CH ₂ CH ₂ CH ₃ ) 3-methyl-2-pentyl (-CH (CH) ₃ )CH(CH ₃ )CH ₂ CH ₃ ) 4-methyl-2-pentyl (-CH (CH) ₃ )CH ₂ CH(CH ₃ ) ₂ ) 3-methyl-3-pentyl (-C (CH) ₃ )(CH ₂ CH ₃ ) ₂ ) 2-methyl-3-pentyl (-CH (CH) ₂ CH ₃ )CH(CH ₃ ) ₂ ) 2, 3-dimethyl-2-butyl (-C (CH) ₃ ) ₂ CH(CH ₃ ) ₂ ) 3, 3-dimethyl-2-butyl (-CH (CH) ₃ )C(CH ₃ ) ₃ ) N-heptyl, n-octyl, and the like.

The term "alkylene" refers to a saturated divalent or polyvalent hydrocarbyl radical resulting from the removal of two or more hydrogen atoms from a saturated straight or branched chain hydrocarbyl radical. Unless otherwise specified, alkylene groups contain 1 to 12 carbon atoms. In some embodiments, the alkylene group contains 1 to 6 carbon atoms; in other embodiments, the alkylene group contains 1 to 4 carbon atoms; in some embodiments, the alkylene group contains 1 to 3 carbon atoms; in still other embodiments, the alkylene group contains 1 to 2 carbon atoms. Examples of alkylene groups include, but are not limited to, methylene (-CH) ₂ (-), ethylene (-CH) ₂ CH ₂ (-), isopropylidene (-CH) ₂ CH ₂ CH ₂ (-), isopropylidene (-CH (CH) ₃ )CH ₂ (-), etc.

The terms "hydroxyalkyl" and "hydroxyalkoxy" denote alkyl or alkoxy groups, optionally substituted with one or more hydroxy groups, wherein "hydroxyalkyl", "hydroxyalkylene" and "hydroxyalkyl" are used interchangeably, examples of which include, but are not limited to, hydroxymethyl (-CH) ₂ OH), hydroxyethyl group (-CH ₂ CH ₂ OH,-CHOHCH ₃ ) Hydroxypropyl (-CH) ₂ CH ₂ CH ₂ OH,-CH ₂ CHOHCH ₃ ,-CHOHCH ₂ CH ₃ ) Hydroxy methoxy (-OCH) ₂ OH), and the like.

The term "haloalkyl", "haloalkenyl" or "haloalkoxy"Represents alkyl, alkenyl or alkoxy groups substituted by one or more halogen atoms, wherein alkyl, alkenyl and alkoxy have the meaning described in the present invention. Examples include, but are not limited to, difluoroethyl (-CH) ₂ CHF ₂ ,-CF ₂ CH ₃ ,-CHFCH ₂ F) Trifluoroethyl group (-CH) ₂ CF ₃ ,-CF ₂ CH ₂ F,-CFHCHF ₂ ) Trifluoromethyl (-CF) ₃ ) Trifluoromethoxy (-OCF) ₃ ) Fluorovinyl (-ch=chf, -cf=ch) ₂ ) Etc.

The term "alkenyl" denotes a straight or branched monovalent hydrocarbon radical of 2 to 12 carbon atoms wherein at least one C-C is sp ² Double bonds, wherein the alkenyl groups may be independently optionally substituted with one or more substituents as described herein, including groups having "anti" "cis" or "E" "Z" positioning, specific examples of which include, but are not limited to, vinyl (-CH=CH) ₂ ) Propenyl (-ch=ch) ₂ CH ₃ ) Allyl (-CH) ₂ CH＝CH ₂ ) And so on.

The term "alkoxy" means that the alkyl group is attached to the remainder of the molecule through an oxygen atom, wherein the alkyl group has the meaning as described herein. Unless otherwise specified, the alkoxy groups contain 1 to 12 carbon atoms. In some embodiments, the alkoxy group contains 1 to 8 carbon atoms; in other embodiments, the alkoxy group contains 1 to 6 carbon atoms; in other embodiments, the alkoxy group contains 1 to 4 carbon atoms; in still other embodiments, the alkoxy group contains 1 to 3 carbon atoms, and in still other embodiments, the alkyl group contains 1 to 2 carbon atoms. The alkoxy group may be optionally substituted with one or more substituents described herein.

Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH) ₃ ) Ethoxy (EtO, -OCH) ₂ CH ₃ ) 1-propoxy (n-PrO, n-propoxy, -OCH) ₂ CH ₂ CH ₃ ) 2-propoxy (i-PrO, i-propoxy, -OCH (CH) ₃ ) ₂ ) 1-butoxy (n-BuO, n-butoxy),-OCH ₂ CH ₂ CH ₂ CH ₃ ) 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH) ₂ CH(CH ₃ ) ₂ ) 2-butoxy (s-BuO, s-butoxy, -OCH (CH) ₃ )CH ₂ CH ₃ ) 2-methyl-2-propoxy (t-BuO, t-butoxy, -OC (CH) ₃ ) ₃ ) 1-pentoxy (n-pentoxy, -OCH) ₂ CH ₂ CH ₂ CH ₂ CH ₃ ) 2-pentoxy (-OCH (CH) ₃ )CH ₂ CH ₂ CH ₃ ) 3-pentoxy (-OCH (CH) ₂ CH ₃ ) ₂ ) 2-methyl-2-butoxy (-OC (CH) ₃ ) ₂ CH ₂ CH ₃ ) 3-methyl-2-butoxy (-OCH (CH) ₃ )CH(CH ₃ ) ₂ ) 3-methyl-l-butoxy (-OCH) ₂ CH ₂ CH(CH ₃ ) ₂ ) 2-methyl-l-butoxy (-OCH) ₂ CH(CH ₃ )CH ₂ CH ₃ ) And so on.

The term "alkynyl" denotes a straight or branched chain monovalent hydrocarbon radical containing 2 to 12 carbon atoms, at least one of which is a sp triple bond, wherein the alkynyl group may be independently optionally substituted with one or more substituents described herein, some embodiments of which are alkyl groups containing 2 to 12 carbon atoms, other embodiments of which are alkyl groups containing 2 to 8 carbon atoms, still other embodiments of which are alkyl groups containing 2 to 6 carbon atoms, and still other embodiments of which are alkyl groups containing 2 to 4 carbon atoms. Specific examples include, but are not limited to, ethynyl (-C≡CH), propargyl (-CH) ₂ C.ident.CH), propynyl (-C.ident.C-CH ₃ ) Propargyl (-CH) ₂ CH ₂ C≡CH、-CH ₂ C≡CCH ₃ 、-C≡CCH ₂ CH ₃ and-CH (CH) ₃ ) C.ident.CH) and propargyl (-CH) ₂ CH ₂ CH ₂ C≡CH、-CH ₂ CH ₂ C≡CCH ₃ 、-CH ₂ C≡CCH ₂ CH ₃ 、-C≡CCH ₂ CH ₂ CH ₃ 、-CH ₂ CH(CH ₃ )C≡CH、-CH(CH ₃ )CH ₂ C≡CH、-C(CH ₃ ) ₂ C≡CH、-CH(CH ₃ )C≡CCH ₃ and-C≡CCH (CH) ₃ ) ₂ ) Etc.

The term "cycloalkyl" denotes a monovalent or polyvalent saturated monocyclic, bicyclic or tricyclic ring system containing 3 to 12 carbon atoms. In one embodiment, cycloalkyl groups contain 3 to 12 carbon atoms; in another embodiment, cycloalkyl groups contain 3 to 8 carbon atoms; in another embodiment, cycloalkyl groups contain 3 to 7 carbon atoms; in still other embodiments, cycloalkyl groups contain 3 to 6 carbon atoms. The cycloalkyl groups may independently be unsubstituted or substituted with one or more substituents described herein.

The term "heterocyclyl" refers to a mono-, bi-or tricyclic ring system containing 3 to 12 ring atoms, which is non-aromatic, saturated or partially unsaturated, mono-or polyvalent, wherein at least one ring atom is selected from nitrogen, sulfur or oxygen atoms. Wherein the heterocyclyl group may be optionally substituted with one or more substituents described herein. Unless otherwise indicated, -CH for heterocyclyl ₂ The group may optionally be replaced by-C (=o) -or-C (=s) -. The sulfur atom of the ring may optionally be oxidized to an S-oxide. The nitrogen atom of the ring may optionally be oxidized to an N-oxide. In some embodiments, the heterocyclyl is a monocyclic heterocyclyl consisting of 5 to 7 atoms. In some embodiments, the heterocyclyl is a monocyclic heterocyclyl consisting of 5 to 6 atoms. In some embodiments, the heterocyclyl is a bicyclic heterocyclyl consisting of 7-12 ring atoms. In some embodiments, the heterocyclyl is a bicyclic heterocyclyl consisting of 8-10 ring atoms. In some embodiments, a heterocyclyl is a 4-atom composition heterocyclyl, meaning a monovalent or multivalent, saturated or partially unsaturated, non-aromatic monocyclic ring comprising 4 ring atoms, at least one of which is selected from the group consisting of nitrogen, sulfur and oxygen atoms. In other embodiments, heterocyclyl is a 5 atom composition heterocyclyl, meaning a mono-or polyvalent, saturated or partially unsaturated, non-aromatic monocyclic ring containing 5 ring atoms, at least one of which is selected from the group consisting of nitrogen, sulfur and oxygen atoms. In other embodiments, a heterocyclyl is a 6 atom constituent heterocyclyl, meaning a monovalent or multivalent, saturated or containing 6 ring atoms A partially unsaturated, non-aromatic monocyclic ring in which at least one ring atom is selected from nitrogen, sulfur and oxygen atoms.

Examples of "heterocyclyl" include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thiaalkyl, piperazinyl, homopiperazinyl, oxolanyl, aziridinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, azepanyl, oxacycloheptyl, oxazepinyl, diazaperzinyl, thiazepinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1, 3-dioxanyl, pyrazolinyl, dithianyl, dihydrothienyl, pyrazolidinyl imidazolinyl, imidazolidinyl, 1,2,3, 4-tetrahydroisoquinolinyl, 3-azabicyclo [3.1.0] hexyl, 3-azabicyclo [4.1.0] heptyl, aza [2.2.2] quinolyl, 2-dioxanyl, and N-2.2-dioxanyl. Examples of heterocyclic groups also include 1, 1-dioxothiomorpholino, examples of which the ring carbon atom is substituted with oxo (=o) include, but are not limited to, pyrimidinedione groups, 1,2, 4-thiadiazole-5 (4H) -keto groups, 1,2, 4-oxadiazole-5 (4H) -keto groups, 1H-1,2, 4-triazole-5 (4H) -keto groups, and the like, examples of which the ring carbon atom is substituted with group = S include, but are not limited to, 1,2, 4-oxadiazole-5 (4H) -thioketone groups, 1,3, 4-oxadiazole-2 (3H) -thioketone groups, and the like.

The terms "heterocyclylalkyl" and "heterocyclylalkylene" are used interchangeably to refer to an alkyl group substituted with a heterocyclyl group, examples of which include, but are not limited to, pyrrole-2-methyl, morpholine-4-methyl.

The term "heterocyclylalkoxy" refers to an alkoxy group substituted with a heterocyclic group in which the oxygen atom is attached to the remainder of the molecule, examples of which include, but are not limited to, pyrrole-2-methoxy, piperidine-2-ethoxy.

The term "heterocyclylalkylamino" refers to an alkylamino group substituted with a heterocyclyl group wherein the nitrogen atom is attached to the remainder of the molecule; wherein heterocyclyl, alkyl and alkylamino groups have the meaning as described herein, such examples include, but are not limited to, 2-morpholinoethylamino and the like.

The term "heteroatom" means one or more of O, S, N, P and Si, including N, S and any oxidation state forms of P; primary, secondary, tertiary and quaternary ammonium salt forms; or a form in which the hydrogen on the nitrogen atom of the heterocycle is substituted, for example, N (like N in 3, 4-dihydro-2H-pyrrolyl), NH (like NH in pyrrolidinyl) or NR (like NR in N-substituted pyrrolidinyl), R representing a substituent as described in the present invention.

The term "halogen" or "halogen atom" refers to F, cl, br or I.

The term "unsaturated" as used herein means that the moiety contains one or more unsaturations.

The term "aryl" means a monocyclic, bicyclic and tricyclic carbocyclic ring system containing 6 to 14 ring atoms, or 6 to 12 ring atoms, or 6 to 10 ring atoms, wherein at least one ring system is aromatic, wherein each ring system contains rings of 3 to 7 atoms, and wherein one or more points of attachment are attached to the remainder of the molecule. The term "aryl" may be used interchangeably with the term "aromatic ring". Examples of aryl groups may include phenyl, naphthyl and anthracenyl. The aryl groups may independently be optionally substituted with one or more substituents described herein.

The term "heteroaryl" refers to monocyclic, bicyclic, and tricyclic ring systems containing 5 to 12 ring atoms, wherein at least one ring is aromatic and at least one aromatic ring contains one or more heteroatoms, wherein each ring system contains a ring of 5 to 7 ring atoms and one or more points of attachment are attached to the remainder of the molecule. The term "heteroaryl" may be used interchangeably with the terms "aromatic heterocycle", "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is a monocyclic heteroaryl consisting of 5-7 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, heteroaryl is a monocyclic heteroaryl consisting of 5-6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, heteroaryl is a bicyclic heteroaryl consisting of 7-12 ring atoms comprising 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, heteroaryl is a bicyclic heteroaryl consisting of 8-10 ring atoms comprising 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, heteroaryl is a bicyclic heteroaryl consisting of 9-10 ring atoms comprising 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen.

Examples of heteroaryl rings include, but are not limited to, the following monocyclic rings: 1,2, 4-oxadiazol-5 (4H) -thione, 1,2, 4-thiadiazol-5 (4H) -one, 1,2, 4-oxadiazol-5 (4H) -one, 1,3, 4-oxadiazol-2 (3H) -thione, 1H-1,2, 4-triazole-5 (4H) -one, 2-furyl, 3-furyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl 5-pyrimidinyl, pyridazinyl (e.g., 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (e.g., 5-tetrazolyl), triazolyl (e.g., 2-triazolyl and 5-triazolyl), 2-thienyl, 3-thienyl, pyranyl, pyrazolyl (e.g., 2-pyrazolyl), isothiazolyl, 1,2, 3-oxadiazolyl, 1,2, 5-oxadiazolyl, 1,2, 4-oxadiazolyl, 1,2, 3-triazolyl, 1,2, 3-thiodiazolyl, 1,3, 4-thiodiazolyl, 1,2, 5-thiodiazolyl, pyrazinyl, 1,3, 5-triazinyl, diazolyl, thiadiazolyl, triazinyl, and the like; the following bicyclic rings are also included, but are in no way limited to: benzothiazolyl, benzimidazolyl, benzofuranyl, benzothienyl, indolyl (e.g., 2-indolyl), purinyl, quinolinyl (e.g., 2-quinolinyl, 3-quinolinyl, 4-quinolinyl), isoquinolinyl (e.g., 1-isoquinolinyl, 3-isoquinolinyl, or 4-isoquinolinyl), and the like.

The term "M-M ₁ "consisting of ring atoms" means that the cyclic group consists of M-M ₁ And the ring atoms comprise carbon atoms and/or O, N, S, P and other hetero atoms. For example, "a heterocyclic group consisting of 3 to 6 ring atoms" represents a heterocyclic group consisting of 3, 4, 5 or 6 ring atoms。

The terms "heteroarylalkyl" and "heteroarylalkylene" are used interchangeably to denote an alkyl group substituted with one or more of the same or different heteroaryl groups, where the alkyl and heteroaryl groups have the meanings as described herein, examples of which include, but are not limited to, pyridine-2-ethyl, thiazole-2-methyl, imidazole-2-ethyl, pyrimidine-2-propyl, and the like.

The term "sulfonyl", whether used alone or in combination with other terms like "alkylsulfonyl", refers to the divalent radical-SO, respectively ₂ -. The term "alkylsulfonyl" refers to an alkyl-substituted sulfonyl group forming an alkylsulfonyl group (e.g.: -SO) ₂ CH ₃ )。

The terms "aralkyl" and "arylalkyl" are used interchangeably to refer to aryl-substituted alkyl groups, wherein the aryl and alkyl groups have the meanings as described herein. Some of these are, for example, aralkyl groups or arylalkyl groups refer to "lower aralkyl" groups, i.e., aryl groups attached to C _1-6 An alkyl group. Further embodiments are where an aralkyl group or arylalkyl group refers to an aryl group attached to C _1-3 An alkyl group. Specific examples thereof include phenylmethyl (i.e., benzyl), diphenylmethyl, phenethyl, and the like.

The terms "alkylamino" and "alkylamino" are used interchangeably and include "N-alkylamino" and "N, N-dialkylamino" in which the hydrogen atoms in the amino groups are each independently substituted with one or two alkyl groups. Wherein some embodiments are, alkylamino is one or two C ₁ -C ₁₂ Alkyl groups are attached to lower alkylamino groups formed on the nitrogen atom. In other embodiments, the alkylamino group is one or two C ₁ -C ₆ Alkyl groups are attached to lower alkylamino groups formed on the nitrogen atom. In other embodiments, the alkylamino group is one or two C ₁ -C ₄ Alkyl groups are attached to lower alkylamino groups formed on the nitrogen atom. In still other embodiments, the alkylamino group is one or twoC ₁ -C ₃ Alkyl groups are attached to lower alkylamino groups formed on the nitrogen atom. Suitable alkylamino groups may be mono-or di-alkylamino, examples of alkylamino include, but are not limited to, N-methylamino, N-ethylamino, N, N-dimethylamino, N, N-diethylamino, N-ethyl-N-propylamino, and the like.

The terms "cycloalkylalkyl" and "cycloalkylalkylene" are used interchangeably to mean that an alkyl group may be substituted with one or more identical or different cycloalkyl groups, where cycloalkyl and alkyl groups have the meanings as described herein. Examples include, but are not limited to, cyclohexylmethylene, cyclopropylethylene, and the like.

The terms "alkoxyalkyl" and "alkoxyalkylene" are used interchangeably to mean that an alkyl group may be substituted with one or more identical or different alkoxy groups, where alkoxy and alkyl groups have the meaning as described herein. Examples include, but are not limited to, cyclohexylmethyl, cyclopropylethyl, methoxyethyl, ethoxymethyl, and the like.

As described herein, a ring system (represented by formula a) wherein a substituent is depicted as a ring attached to the center by a bond represents that the substituent may be substituted at any substitutable position on the ring, as represented by formulas b, c, d, e, f, g and h.

In addition, unless explicitly indicated otherwise, the descriptions used throughout this document "… and … are each independently", "… and … are each independently" and "… and … are each independently" are interchangeable, "and are to be understood in a broad sense to mean that the particular items expressed between the same symbols in different groups do not affect each other, or that the particular items expressed between the same symbols in the same groups do not affect each other. For example, as shown in formula p, a plurality of R ⁷ The specific options of (a) are not affected by each other.

As described in the present invention, two connection points are connected with the rest of the molecule in the system, for example, as shown in formula q, which means that either the E end or the E' end is connected with the rest of the molecule, i.e. under the condition that the molecular structure is reasonable, the connection modes of the two ends can be interchanged.

Unless otherwise indicated, the structural formulae described herein include all isomeric forms (e.g., enantiomers, diastereomers, and geometric isomers (or conformations), such as R, S configuration containing an asymmetric center, the (Z), (E) isomers of double bonds, and the conformational isomers of (Z), (E).

The term "prodrug" as used herein means a compound that is converted in vivo to a compound of formula (I). Such conversion is effected by hydrolysis of the prodrug in the blood or enzymatic conversion to the parent structure in the blood or tissue. The prodrug of the invention can be ester, and in the prior invention, the ester can be phenyl ester, aliphatic (C _1-24 ) Esters, acyloxymethyl esters, carbonates, carbamates and amino acid esters. For example, one compound of the invention may contain a hydroxyl group, i.e., it may be acylated to provide the compound in a prodrug form. Other prodrug forms include phosphates, such as those obtained by phosphorylation of a hydroxyl group on the parent. For a complete discussion of prodrugs, reference may be made to the following documents: higuchi and V.stella, pro-drugs as Novel Delivery Systems, vol.14of the A.C.S. symposium Series, edward B.Roche, ed., bioreversible Carriers in Drug Design, american Pharmaceutical Association and Pergamon Press,1987,J.Rautio et al,Prodrugs:Design and Clinical Applications,Nature Review Drug Discovery,2008,7,255-270,and S.J.Hecker et al,Prodrugs of Phosphates and Phosphonates,Journal of Medicinal Chemistry,2008,51，2328-2345。

All tautomeric forms of the compounds of the invention are included within the scope of the invention unless otherwise indicated. In addition, unless otherwise indicated, the structural formulae of the compounds described herein include enriched isotopes of one or more different atoms.

"metabolite" refers to a product obtained by metabolizing a specific compound or salt thereof in vivo. The metabolites of a compound may be identified by techniques well known in the art and their activity may be characterized by employing the assay methods as described herein. Such products may be obtained by oxidation, reduction, hydrolysis, amidization, deamination, esterification, degreasing, enzymatic cleavage, etc. of the administered compound. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a compound of the present invention with a mammal for a period of time sufficient.

The definition and use of stereochemistry in the present invention is generally referred to in the following documents: S.P. Parker, ed., mcGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, new York; and Eliel, e.and Wilen, s., "Stereochemistry of Organic Compounds", john Wiley & Sons, inc., new York,1994. The compounds of the invention may contain asymmetric or chiral centers and thus exist as different stereoisomers. All stereoisomeric forms of the compounds of the invention, including, but in no way limited to, diastereomers, enantiomers, atropisomers, and mixtures thereof, such as racemic mixtures, form part of the present invention. Many organic compounds exist in optically active form, i.e. they have the ability to rotate the plane of plane polarized light. In describing optically active compounds, the prefix D, L or R, S is used to denote the absolute configuration of the chiral center of the molecule. The prefix d, l or (+), (-) is used to name the sign of the compound plane polarization rotation, where (-) or l means that the compound is left-handed and the prefix (+) or d means that the compound is right-handed. The chemical structures of these stereoisomers are identical, but their stereoisomers are different. The particular stereoisomer may be an enantiomer, and the mixture of isomers is commonly referred to as an enantiomeric mixture. 50: mixtures of enantiomers of 50 are referred to as racemic mixtures or racemates, which may result in no stereoselectivity or stereospecificity during chemical reactions. The terms "racemic mixture" and "racemate" refer to a mixture of two enantiomers in equimolar amounts, lacking optical activity.

The term "tautomer" or "tautomeric form" refers to isomers of structures of different energies that can be interconverted by a low energy barrier. For example, proton tautomers (i.e., proton-shifted tautomers) include tautomerism by proton shift, such as keto-enol and imine-enamine isomerisation. Valency (valence) tautomers include tautomers that reorganize into bond electrons. Unless otherwise indicated, all tautomeric forms of the compounds of the invention are within the scope of the invention.

As used herein, "pharmaceutically acceptable salts" refers to organic and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as in the literature: S.M. Berge et al describe pharmaceutically acceptable salts in detail in J.pharmaceutical Sciences,66:1-19,1977. Pharmaceutically acceptable non-toxic acid forming salts include, but are not limited to, inorganic acid salts formed by reaction with amino groups such as hydrochloride, hydrobromide, phosphate, sulfate, perchlorate, and organic acid salts such as acetate, oxalate, maleate, tartrate, citrate, succinate, malonate, or by other methods described in the literature such as ion exchange. Other pharmaceutically acceptable salts include adipic acid salts, malic acid salts, 2-hydroxypropionic acid salts, alginates, ascorbic acid salts, aspartic acid salts, benzenesulfonic acid salts, benzoic acid salts, bisulfate salts, boric acid salts, butyric acid salts, camphoric acid salts Salts, cyclopentylpropionates, digluconates, dodecyl sulfate, ethane sulfonate, formate, fumaric acid, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, caproate, hydroiodinate, 2-hydroxy-ethane sulfonate, lactoaldehyde, lactate, laurate, lauryl sulfate, malate, malonate, methanesulfonate, 2-naphthalene sulfonate, nicotinate, nitrate, oleate, palmitate, pamoate, pectate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, stearate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Salts obtained by suitable bases include alkali metals, alkaline earth metals, ammonium and N ⁺ (C _1-4 Alkyl group ₄ Is a salt of (a). The present invention also contemplates quaternary ammonium salts formed from any compound containing a group of N. The water-soluble or oil-soluble or dispersible product may be obtained by quaternization. Alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. The pharmaceutically acceptable salts further include suitable, non-toxic ammonium, quaternary ammonium salts and amine cations that are resistant to counter ion formation, such as halides, hydroxides, carboxylates, sulphates, phosphates, nitrates, C _1-8 Sulfonate and aromatic sulfonate.

"solvate" according to the present invention refers to an association of one or more solvent molecules with a compound according to the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethylsulfoxide, ethyl acetate, acetic acid, aminoethanol. The term "hydrate" refers to an association of solvent molecules that are water.

The term "protecting group" or "Pg" refers to a substituent that is commonly used to block or protect a particular functionality when reacted with another functional group. For example, an "amino protecting group" refers to a substituent attached to an amino group to block or protect the functionality of an amino group in a compound, and suitable amino protecting groups include acetyl, trifluoroacetyl, t-Butoxycarbonyl (BOC), benzyloxycarbonyl (CBZ), and 9-fluorenylmethoxycarbonyl (Fmoc). Similarly, "Hydroxy protecting groups "refer to the functionality that a substituent of a hydroxy group serves to block or protect the hydroxy group, suitable protecting groups include acetyl and silyl. "carboxyl protecting group" refers to the functionality of a substituent of a carboxyl group to block or protect the carboxyl group, and typically the carboxyl protecting group includes-CH ₂ CH ₂ SO ₂ Ph, cyanoethyl, 2- (trimethylsilyl) ethyl, 2- (trimethylsilyl) ethoxymethyl, 2- (p-toluenesulfonyl) ethyl, 2- (p-nitrobenzenesulfonyl) ethyl, 2- (diphenylphosphino) ethyl, nitroethyl, and the like. General description of protecting groups can be found in the literature: t W.Greene, protective Groups in Organic Synthesis, john Wiley&Sons,New York,1991；and P.J.Kocienski,Protecting Groups,Thieme,Stuttgart,2005。

Description of the Compounds of the invention

The compounds and pharmaceutically acceptable compositions thereof of the present invention are effective in inhibiting HBV infection.

R ³ is C ₆ -C ₁₀ Aryl or heteroaryl consisting of 5 to 6 ring atoms, wherein said C ₆ -C ₁₀ Aryl and heteroaryl consisting of 5 to 6 ring atoms are each independently unsubstitutedOr is substituted with 1, 2, 3, 4 or 5 groups selected from deuterium, F, cl, br, OH, CN, C _1-6 Alkyl, hydroxy C _1-6 Alkyl, C _1-6 alkyl-OC (=o) -, C _1-6 alkyl-OC (=o) -C _1-6 Alkylene, HOOC-C _1-6 Alkylene, C _1-6 alkoxy-C _1-6 Alkylene and C _1-6 alkyl-S (=o) ₂ -substituted with a substituent;

w is CH or N;

X ¹ is-C (=O) -, -S (=O) ₂ -or- (CR) ⁵ R ⁶ ) _j -；

each R is ⁸ Independently deuterium, C _1-6 Alkyl, C _3-6 Cycloalkyl, hydroxy C _1-6 Alkyl, C _1-4 Alkoxy C _1-3 Alkylene orC _1-6 A haloalkyl group;

m is 0, 1, 2, 3 or 4;

j is 1, 2 or 3.

each R is ⁸ Independently deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

R ^7a is hydrogen, deuterium, methyl, ethylRadical, n-propyl, isopropyl, n-butyl, tert-butyl and hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

In some embodiments, each R as described herein ¹⁰ Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

each R is ¹¹ Independently is ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, aziridinyl, azetidinyl, oxetanyl, pyrrolidinyl, pyrazolidinylImidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group;

In another aspect, the present invention relates to compounds of one of the following or stereoisomers, tautomers, nitroxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof, but in no way limited to these compounds:

/>

In some embodiments, the pharmaceutical composition of the invention, wherein the additional anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, cil Mo Baijie, cladvudine, emtricitabine, faprasuavir, interferon, baganine CP, clomiphene, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, miltefoster, nitazoxanide, polyethylene glycol interferon alpha-2 a, ribavirin, luo Raosu-a, cizopyran, euforavac, an Puli near, phosphazid, hepisav, interferon alpha-2 b, levamisole or propigermanium.

In another aspect, the compounds of the invention or the pharmaceutical compositions are used for the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient.

In some embodiments, the use of the compounds or the pharmaceutical compositions of the invention, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

In other embodiments, the use of the compounds or the pharmaceutical compositions of the invention, wherein the disease caused by hepatitis b infection is cirrhosis or hepatocellular carcinoma.

In another aspect, the invention relates to a method of preventing, treating or alleviating a viral disease in a patient, wherein the method comprises administering to the patient a pharmaceutically acceptable effective dose of a compound or pharmaceutical composition of the invention.

In some embodiments, the methods of the invention, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

In other embodiments, the methods of the invention, wherein the disease caused by hepatitis b infection is cirrhosis or hepatocellular carcinoma.

In another aspect, the invention relates to the use of said compound or pharmaceutical composition for the manufacture of a medicament for preventing, treating or alleviating a hepatitis b disease in a patient.

Another aspect of the invention relates to the use of a pharmaceutical composition comprising a compound of the invention for the manufacture of a medicament for preventing or treating HBV disorders in a patient, and for reducing the severity thereof.

Some of these embodiments are mammals, and other examples are humans. In other embodiments, the use further comprises contacting the cell with an anti-HBV therapeutic agent.

Another aspect of the invention relates to a method of treating HBV disease in a patient, comprising administering to a patient in need thereof a therapeutically effective amount of a compound of the invention or a pharmaceutical composition thereof.

Still other embodiments are methods further comprising administering to a patient in need of treatment a therapeutically effective dose of an additional anti-HBV therapeutic agent.

Another aspect of the invention relates to a method of inhibiting HBV infection in a patient, the method comprising administering to a patient in need of treatment a therapeutically effective amount of a compound of the invention or a pharmaceutical composition thereof. In still other embodiments, the method further comprises administering to a patient in need of treatment a therapeutically effective dose of an additional anti-HBV therapeutic agent.

The invention also relates to the application of the compound and pharmaceutically acceptable salts thereof in the production of medical products for effectively inhibiting HBV infection. The compounds of the invention are also useful for the manufacture of a medicament for alleviating, preventing, controlling or treating a condition of hepatitis b in a patient.

Unless otherwise indicated, all stereoisomers, geometric isomers, tautomers, nitroxides, hydrates, solvates, metabolites, pharmaceutically acceptable salts and prodrugs of the compounds of the invention are within the scope of the invention.

In particular, salts are pharmaceutically acceptable salts. The term "pharmaceutically acceptable" includes substances or compositions that must be suitable for chemical or toxicological treatment, in relation to the other components that make up the formulation and the mammal being treated.

Salts of the compounds of the present invention also include salts of the isolated enantiomers of the compounds of formula (I) or (Ia) or intermediates used in the preparation or purification of the compounds of formula (I) or (Ia), but are not necessarily pharmaceutically acceptable salts.

If the compounds of the present invention are basic, the desired salts may be prepared by any suitable method provided in the literature, for example, using mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like. Or organic acids such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, malic acid, 2-hydroxypropionic acid, citric acid, oxalic acid, glycolic acid and salicylic acid; pyranose acids, such as glucuronic acid and galacturonic acid; alpha-hydroxy acids such as citric acid and tartaric acid; amino acids such as aspartic acid and glutamic acid; aromatic acids such as benzoic acid and cinnamic acid; sulfonic acids such as p-toluene sulfonic acid, benzene sulfonic acid, methane sulfonic acid, ethane sulfonic acid, trifluoromethane sulfonic acid, and the like, or combinations thereof.

If the compounds of the invention are acidic, the desired salts can be prepared by suitable methods, e.g., using inorganic or organic bases, such as amines (primary, secondary, tertiary), alkali metal hydroxides, ammonium, N ⁺ (R ¹⁴ ) ₄ Salts and alkaline earth metal hydroxides, and the like. Suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, amines, such as primary, secondary and tertiary amines, N ⁺ (R ¹⁴ ) ₄ Salts of (A), e.g. R ¹⁴ Is H, C _1-4 Alkyl, C _6-10 Aryl, C _6-10 Aryl C _1-4 Alkyl, etc., and cyclic amines such as piperidine, morpholine, piperazine, etc., and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Also included are suitable, non-toxic ammonium, quaternaryAmmonium salts and amine cations resistant to counter-ion formation, e.g. halides, hydroxides, carboxylates, sulphates, phosphates, nitrates, C _1-8 Sulfonate and aromatic sulfonate.

Pharmaceutical compositions, formulations, administration and use of the compounds and pharmaceutical compositions of the invention

According to another aspect, the pharmaceutical composition of the invention is characterized by comprising a compound of formula (I) or (Ia), a compound of the list of the invention, or a compound of the examples, and a pharmaceutically acceptable adjuvant. The compound in the pharmaceutical composition can effectively inhibit hepatitis B virus, is suitable for treating diseases caused by the virus, especially acute and chronic persistent HBV virus infection, and chronic viral diseases caused by HBV can cause serious pathological changes, and chronic hepatitis B virus infection can cause liver cirrhosis and/or hepatocellular carcinoma in many cases.

For the compounds of the invention, the areas of disease treatment that may be mentioned are, for example: treatment of acute and chronic viral infections that may lead to infectious hepatitis, e.g., hepatitis B virus infection. The compounds of the invention are particularly suitable for the treatment of chronic hepatitis B infection and acute and chronic hepatitis B virus infection.

The present invention includes pharmaceutical formulations containing, in addition to non-toxic, inert pharmaceutically suitable excipients, one or more compounds of formula (I) or (Ia) of the present invention or pharmaceutical compositions thereof or containing one or more active ingredients of formula (I) or (Ia) or pharmaceutical compositions of the present invention.

The pharmaceutical preparations described above may also contain other active pharmaceutical ingredients than the compounds of the formula (I) or (Ia).

The compounds of the invention exist in free form or as suitable, pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adducts or derivatives that can be administered directly or indirectly according to the needs of the patient, the compounds described in other aspects of the present invention, metabolites thereof, or residues thereof.

As described herein, the pharmaceutical compositions of the present invention comprise any of the compounds of formula (I) or (Ia) of the present invention, further comprising pharmaceutically acceptable excipients, such as, for example, any solvents, solid excipients, diluents, binders, disintegrants, or other liquid excipients, dispersants, flavoring or suspending agents, surfactants, isotonicity agents, thickening agents, emulsifiers, preservatives, solid binders or lubricants, and the like, as used herein, are suitable for the particular target dosage form. As described in the following documents: in Remington, the Science and Practice of Pharmacy,21st edition,2005,ed.D.B.Troy,Lippincott Williams&Wilkins,Philadelphia,and Encyclopedia of Pharmaceutical Technology,eds.J.Swarbrick and J.C.Boylan,1988-1999,Marcel Dekker,New York, in combination with the teachings of the literature herein, shows that different excipients can be used In the preparation of pharmaceutically acceptable compositions and their well-known methods of preparation. In addition to the extent to which any conventional adjuvant is incompatible with the compounds of the present invention, such as any adverse biological effects produced or interactions with any other component of the pharmaceutically acceptable composition in a deleterious manner, their use is also contemplated by the present invention.

Substances that may be pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum proteins; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; a partial glyceride mixture of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silicon; magnesium trisilicate; polyvinylpyrrolidone; polyacrylate; a wax; polyethylene-polyoxypropylene-block polymers; lanolin; sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; a gum powder; malt; gelatin; talc powder; adjuvants such as cocoa butter and suppository waxes; oils such as peanut oil, cotton seed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycol compounds such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic salt; ringer's solution; ethanol; phosphate buffer solution; and other non-toxic suitable lubricants such as sodium lauryl sulfate and magnesium stearate; a colorant; a release agent; coating the clothing material; a sweetener; a flavoring agent; a perfume; preservatives and antioxidants.

The pharmaceutical composition of the compounds of the invention may be administered in any of the following ways: oral administration, spray inhalation, topical administration, rectal administration, nasal administration, topical administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or administration by means of an external reservoir. The preferred mode is oral administration, intramuscular injection, intraperitoneal administration or intravenous injection.

The compounds of the present invention or pharmaceutical compositions thereof may be administered in unit dosage form. The administration dosage form may be liquid dosage form or solid dosage form. The liquid dosage form can be true solution, colloid, microparticle, or suspension. Other dosage forms such as tablet, capsule, dripping pill, aerosol, pill, powder, solution, suspension, emulsion, granule, suppository, lyophilized powder for injection, clathrate, implant, patch, liniment, etc.

Oral tablets and capsules may contain excipients such as binding agents, for example syrup, acacia, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, such as lactose, sucrose, corn starch, calcium phosphate, sorbitol, glycine; lubricants, such as magnesium stearate, talc, polyethylene glycol, silica; disintegrants, such as potato starch; or acceptable wetting agents such as sodium lauryl sulfate. The tablets may be coated by methods known in the pharmaceutical arts.

Oral liquids may be formulated as suspensions, solutions, emulsions, syrups or elixirs with water as an oil, or as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, sorbitol, cellulose methyl ether, glucose syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gel, hydrogenated edible fats and oils, emulsifying agents such as lecithin, sorbitan monooleate, acacia; or non-aqueous adjuvants (possibly containing edible oils) such as almond oil, fats and oils such as glycerol, ethylene glycol, or ethanol; preservatives, such as methyl or propyl parahydroxybenzoate, sorbic acid. Flavoring or coloring agents may be added as desired.

Suppositories may contain conventional suppository bases such as cocoa butter or other glycerides.

For parenteral administration, liquid dosage forms are generally prepared from the compound and a sterile adjuvant. The auxiliary material is water. According to the different concentrations of selected auxiliary materials and medicines, the compound can be dissolved in the auxiliary materials or prepared into suspension solution, and when the injection solution is prepared, the compound is dissolved in water, filtered and sterilized and then filled into a sealed bottle or ampoule.

When topically applied to the skin, the compounds of the present invention may be formulated in the form of an appropriate ointment, lotion, or cream wherein the active ingredient is suspended or dissolved in one or more excipients, which may be used in the ointment formulation include, but are not limited to: mineral oil, liquid vaseline, white vaseline, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; adjuvants that may be used in lotions and creams include, but are not limited to: mineral oil, sorbitan monostearate, tween 60, cetyl esters wax, hexadecene aryl alcohol, 2-octyldodecanol, benzyl alcohol and water.

In general, it has proven advantageous to administer the active compounds of the invention in a total amount of about 0.5 to 500mg, preferably 1 to 100mg/kg body weight per 24 hours, in each case in human medicine or veterinary medicine, if appropriate in a plurality of single doses, in order to achieve the desired effect. The amount of active compound contained in a single dose is preferably about 1-80mg, more preferably 1-50mg/kg body weight, but may not follow the above-mentioned dosages, i.e., depending on the kind and body weight of the subject, the nature and severity of the disease, the type of preparation and the mode of administration of the drug, and the period or interval of administration.

The pharmaceutical composition provided by the invention also comprises an anti-HBV drug. Wherein the anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator or an interferon.

The anti-HBV drugs include lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, cil Mo Baijie, cladvudine, emtricitabine, famprivir, interferon, baganine CP, clomiphene, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, miltefoster, nitazoxanide, polyethylene glycol interferon alpha-2 a, ribavirin, luo Raosu-A, sibzopyran, euforaviac, an Puli, phosphizd, heplisav, interferon alpha-2 b, levamisole or propigermanium, and the like.

In another aspect, the invention relates to the use of a compound or pharmaceutical composition of the invention for the manufacture of a medicament for preventing, treating or alleviating a hepatitis b disease in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of the compound or pharmaceutical composition. Hepatitis B refers to liver diseases caused by hepatitis B virus infection or hepatitis B infection, including acute hepatitis, chronic hepatitis, cirrhosis and stem cell carcinoma. Acute hepatitis b virus infection may be asymptomatic or may be manifested as symptoms of acute hepatitis. Patients with chronic viral infections suffer from active disease and can develop cirrhosis and liver cancer.

The anti-HBV agents may be administered separately from a composition comprising a compound of the invention as part of a multiple dosing regimen. Alternatively, those drugs may be part of a single dosage form, mixed together with the compounds of the invention to form a single composition. If administered as part of a multiple-dose regimen, the two active agents may be delivered to each other simultaneously, sequentially or over a period of time, to achieve the target agent activity.

The amounts of the compounds and pharmaceutical compositions (those comprising a pharmaceutical composition as described herein) that can be combined with the adjuvant materials to produce a single dosage form will vary depending upon the particular mode of administration and the particular mode of administration. Normally, the amount of the pharmaceutical composition of the present invention will not exceed the amount of the composition comprising normal administration as the sole active agent. In another aspect, the amount of the presently disclosed pharmaceutical compositions ranges from about 50% to 100% of the normal amount of the existing pharmaceutical compositions, including the agent as the sole active therapeutic agent. Among those compositions included, the compositions will act synergistically with the compounds of the present invention.

The compounds of the present invention exhibit potent antiviral effects. The compounds have unexpected antiviral activity against HBV and are therefore suitable for the treatment of various diseases caused by viruses, in particular diseases caused by acute and chronic persistent HBV viral infections. Chronic viral diseases caused by HBV can lead to a variety of syndromes of varying severity, and it is well known that chronic hepatitis b virus infection can lead to cirrhosis and/or hepatocellular carcinoma.

Examples of indications treatable with the compounds of the invention are: acute and chronic viral infections, such as hepatitis b virus infection, may result in infectious hepatitis. Particularly preferred are chronic hepatitis b infection and acute hepatitis b virus infection.

The invention also relates to the use of the compounds and pharmaceutical compositions according to the invention for the preparation of a medicament for the treatment and prophylaxis of viral diseases, in particular hepatitis B.

General synthetic method

In general, the compounds of the invention may be prepared by the methods described herein, wherein the substituents are as defined for formula (I) or (Ia), unless otherwise indicated. The following synthetic schemes and examples are provided to further illustrate the teachings of the present invention.

Those skilled in the art will recognize that: the chemical reactions described herein may be used to suitably prepare many other compounds of the present invention, and other methods for preparing the compounds of the present invention are considered to be within the scope of the present invention. For example, the synthesis of those non-exemplified compounds according to the invention can be successfully accomplished by modification methods, such as appropriate protection of interfering groups, by use of other known reagents in addition to those described herein, or by some conventional modification of the reaction conditions, by those skilled in the art. In addition, the reactions disclosed herein or known reaction conditions are also well-known to be applicable to the preparation of other compounds of the present invention.

The examples described below are given unless otherwise indicated that all temperatures are set to degrees celsius (c). Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, arco Chemical Company and Alfa Chemical Company and were used without further purification unless otherwise indicated. The general reagents were purchased from Shandong Chemicals, guangdong Chemicals, guangzhou Chemicals, tianjin Chemie, inc., qingdao Tenglong chemical Co., ltd., and Qingdao ocean chemical works.

The chromatographic column uses silica gel column, and silica gel (200-300 mesh) is purchased from Qingdao ocean chemical plant. Nuclear magnetic resonance spectroscopy with CDC1 ₃ ,DMSO-d ₆ ,CD ₃ OD or acetone-d ₆ TMS (0 ppm) or chloroform (7.25 ppm) was used as a reference standard for the solvent (reported in ppm). When multiple peaks occur, the following abbreviations will be used: s (single, singlet), d (doublet ), t (triplet, multiplet), m (multiplet ), br (broadened, broad), dd (doublet of doublets, doublet), dt (doublet of triplets, doublet), br.s (broadened singlet, broad singlet). Coupling constant J, in units of hertz (Hz).

Low resolution Mass Spectrometry (MS) data were determined by a spectrometer of Agilent 6320 series LC-MS equipped with a G1312A binary pump and a G1316A TCC (column temperature maintained at 30 ℃), a G1329A autosampler and a G1315B DAD detector were applied for analysis, and an ESI source was applied to the LC-MS spectrometer.

Low resolution Mass Spectrometry (MS) data were also determined by a spectrometer of the Agilent6120 series LC-MS equipped with a G1311A quaternary pump and a G1316A TCC (column temperature maintained at 30 ℃), a G1329A autosampler and a G1315D DAD detector were applied for analysis, and an ESI source was applied to the LC-MS spectrometer.

Both spectrometers were equipped with a Agilent Zorbax SB-C18 column, 2.1X130 mm,5 μm format. The injection volume is determined by the sample concentration; the flow rate is 0.6mL/min; the peak of the HPLC was read by recording the UV-Vis wavelengths at 210nm and 254 nm. The mobile phase was a 0.1% acetonitrile formate solution (phase a) and a 0.1% ultrapure formate solution (phase B). Gradient elution conditions are shown in table 1: table 1: gradient elution conditions

Time (min)	A(CH ₃ CN，0.1％HCOOH)	B(H ₂ O，0.1％HCOOH)
			0-3	5-100	95-0
3-6	100	0
			6-6.1	100-5	0-95
6.1-8	5	95

Compound purification was assessed by Agilent 1100 series High Performance Liquid Chromatography (HPLC) with UV detection at 210nm and 254nm on a Zorbax SB-C18 column, 2.1X130 mm,4 μm,10 min, flow rate of 0.6mL/min,5-95% (0.1% aqueous formic acid in acetonitrile) and column temperature maintained at 40 ℃.

The following abbreviations are used throughout the present invention:

synthesis method

The following synthetic schemes list the experimental procedures for preparing the compounds disclosed in the present invention. Wherein each R ¹ 、R ² 、R ³ 、R ^1a 、R ^1b 、R ¹¹ 、R ⁴ 、R ^4a 、R ^b 、R ⁹ 、R ^x 、R ^y 、X ¹ M and n have the meaning as described in the present invention.

Synthesis scheme 1

The compound (a-8) can be produced by the method described in synthetic scheme 1. Firstly, reacting the compound (a-1) with the compound (a-2) under basic conditions (such as DIPEA, etc.) and in a suitable solvent (such as DCM, etc.), to obtain the compound (a-3); then, the compound (a-3) reacts with the compound (a-4) under alkaline conditions (such as cesium carbonate, etc.), a catalyst (such as palladium acetate, etc.), a ligand (such as X-PHOS, t-BuX-PHOS, etc.), and a suitable solvent (such as 1, 4-dioxane, etc.), to produce the compound (a-5); next, the Boc protecting group of the compound (a-5) is removed to obtain a compound (a-6); finally, the compound (a-6) or a salt thereof is reacted with the compound (a-7) (the compound (a-7) can be produced by referring to the synthetic scheme 1 in WO2015074546 and the specific examples thereof) under basic conditions (e.g., potassium carbonate and the like) and in a suitable solvent (e.g., ethanol and the like) to give the compound (a-8).

Synthesis scheme 2

Compound (b-7) can be prepared by the method described in synthetic scheme 2. Wherein R is ^a Is methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C _1-4 Alkyl, C _1-4 Alkoxy C _1-2 Alkylene or C _1-4 A haloalkyl group. Firstly, the compound (b-1) reacts with the compound (a-4) under alkaline conditions (such as cesium carbonate and the like), a catalyst (such as palladium acetate and the like), a ligand (such as X-PHOS, t-BuX-PHOS and the like) and a proper solvent (such as 1, 4-dioxane and the like) to generate a compound (b-2); then, the compound (b-2) undergoes ester hydrolysis under alkaline conditions (such as lithium hydroxide aqueous solution and the like) to produce a compound (b-3); then, the compound (b-3) and the compound (b-4) are subjected to condensation reaction under alkaline conditions (such as DIPEA and the like) and condensing agents (such as HATU and the like) to obtain a compound (b-5); then, removing the Boc protecting group from the compound (b-5) to obtain a compound (b-6); finally, the compound (b-6) is reacted with the compound (a-7) or a salt thereof under basic conditions (e.g., potassium carbonate, etc.) and in a suitable solvent (e.g., ethanol, etc.) to give the compound (b-7).

Synthesis scheme 3

Compound (2 a) can be produced by the method described in synthetic scheme 3, and compound (a-7) is reacted with compound (1 a) under basic conditions (e.g., potassium carbonate, etc.) and in a suitable solvent (e.g., ethanol, etc.) to give compound (2 a).

Detailed Description

The following examples are illustrative of the invention and are not intended to limit the scope of the invention.

Preparation example

In the following preparation examples, the inventors have described in detail the preparation of the compounds of the present invention, taking some of the compounds of the present invention as examples.

Synthesis of fragment F1

Synthetic route for fragment F1:

synthesis of F1-1:

to the flask were added F1-0 (600 mg,3.00 mmol), DCM (10 mL), and DIPEA (1.1 mL,6.1 mmol), and methanesulfonyl chloride (0.30 mL,3.9 mmol) was added while ice-bath. The reaction mixture was reacted at room temperature for 12 hours, then methylene chloride (20 mL) was added to dilute the mixture, and the organic layer was washed with water (20 ml×1), 1M diluted hydrochloric acid (20 ml×1) and saturated brine (20 ml×2) in this order, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the obtained residue was separated by silica gel column chromatography (PE/EA (V/V) =2/1) and purified to give the title compound as a white solid (672 mg, 81%). MS (ESI, neg. Ion) m/z 276.0[ M-H ]] ^- 。

Synthesis of F1-2:

to the reaction flask was added F1-1 (511 mg,1.84 mmol), (R) -3-oxohexahydroimidazo [1,5-a ]]Pyrazine-7 (1H) -carboxylic acid tert-butyl ester (400 mg,1.66 mmol), X-PHOS (80 mg,0.16 mmol), palladium acetate (21 mg,0.09 mmol), cesium carbonate (1.08 g,3.31 mmol) and 1, 4-dioxane (6 mL). The reaction mixture was reacted at 90℃for 4h under nitrogen protection. Cooling to room temperature, filtering, concentrating the filtrate under reduced pressure, and separating the residue by silica gel column chromatography (PE/EA (V/V) =1/1 to EA) to give the title compound as an off-white solid (640 mg, 88.73%). MS (ESI, pos.ion) m/z:383.1[ M+H-56 ] ] ⁺ 。

Synthesis of F1:

to the reaction flask were added F1-2 (301 mg,0.69 mmol), methylene chloride (6 mL) and TFA (2 mL). The reaction mixture was reacted at room temperature for 1h, then concentrated under reduced pressure to give the title compound as a brown oil (309 mg, 99.5%), which was taken on to the next step without purification.

Synthesis of fragment F2

Synthetic route for fragment F2:

synthesis of F2:

with cyclopropylsulfonyl chlorideThe methylsulfonyl chloride in the F1 synthesis method was changed, and the rest of the operations were referred to the F1 synthesis method to give a brown oil F2.MS (ESI, pos.ion) m/z 365.2[ M+H ]] ⁺ 。

Synthesis of fragment F3:

synthetic route for fragment F3:

synthesis of F3:

f3-0 and cyclopropanesulfonyl chloride were used to replace F1-0 and methylsulfonyl chloride, respectively, in the F1 synthesis procedure, the remainder of the procedure was referenced to the F1 synthesis procedure, affording the title compound as a brown oil. MS (ESI, pos.ion) m/z 351.3[ M+H ]] ⁺ 。

Synthesis of fragment F4

Synthetic route for fragment F4:

synthesis of F4-1:

(R) -3-oxo hexahydroimidazo [1,5-a]Pyrazine-7 (1H) -carboxylic acid tert-butyl ester (3 g,12.43 mmol), F4-0 (3.42 g,14.92 mmol), palladium acetate (0.14 g,0.62 mmol), t-Bu XPhos (0.53 g,0.24 mmol) and cesium carbonate (6.08 g,18.65 mmol) were added to 1, 4-dioxane (50 mL) and reacted under nitrogen at 100deg.C with stirring for 12H. The filter cake was rinsed with dichloromethane (200 mL) by suction filtration through celite. The filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) =3/1) to give the title compound as a white solid (3.03 g, 63%). MS (ESI, pos.ion) m/z 334.2[ M+H-56 ] ⁺ 。

Synthesis of F4-2:

f4-1 (3.03 g,7.78 mmol) was dissolved in a mixed solvent of methanol (15 mL) and tetrahydrofuran (15 mL), followed by addition of lithium hydroxide monohydrate (1 g,23.3 mmol) and water (1 mL). The reaction mixture was reacted at 60℃for 1 hour, then concentrated under reduced pressure to giveThe residue was diluted with water (100 mL), adjusted to pH 4-5 with 1M hydrochloric acid, followed by extraction with ethyl acetate (70 mL. Times.3), and the combined organic layers were washed with saturated aqueous sodium chloride, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound as a white solid (2.7 g, 92%). MS (ESI, pos.ion) m/z:398.3[ M+Na ]] ⁺ 。

Synthesis of F4-3:

f4-2 (2.7 g,7.2 mmol), DCM (50 mL) and DIPEA (1.86 g,14.4 mmol) were added sequentially to the dry flask, and after stirring, HATU (2.74 g,7.2 mmol) and methylamine hydrochloride (0.97 g,14.4 mmol) were added. The reaction mixture was stirred at room temperature for 12h, diluted with water (50 mL), adjusted to pH 5-6 with 2M hydrochloric acid under stirring, the organic layer was washed with saturated brine (50 ml×2), dried over anhydrous sodium sulfate, filtered, the solvent was distilled off from the filtrate under reduced pressure, and the crude product was purified by column chromatography over silica gel (PE/EA (V/V) =2/1) to give the title compound as a white solid (1.57 g, 56%). MS (ESI, pos.ion) m/z 333.4[ M+H-56 ] ] ⁺ 。

Synthesis of F4:

f4-3 (1.57 g,4 mmol) and DCM (10 mL) were added sequentially to the dry flask and after stirring at room temperature, TFA (10 mL) was added. The reaction mixture was stirred at room temperature for 4h, then the solvent was evaporated under reduced pressure to give the title compound as a brown oil (1.61 g, 100%).

Synthesis of fragment F5

Synthetic route for fragment F5:

f5-0 was used to replace F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F6

Synthetic route to F6:

f6-0 was substituted for F4-0 in the F4 synthesis and the remainder was made up by reference to the F4 synthesis to afford the title compound as a brown oil.

Synthesis of F7

Synthetic route to F7:

synthesis of F7-1:

to the reaction flask were added F6-2 (3.50 g,9.0 mmol), DMF (28 mL), HATU (4.1 g,11 mmol) and DIPEA (3.1 mL,18 mmol), and after stirring, dibenzylamine (2.1 mL,11 mmol) was added. The reaction mixture was stirred at 25℃for 7h, then water (100 mL) and ethyl acetate (200 mL) were added, and the organic layer was washed with water (100 mL. Times.2) and dried over anhydrous sodium sulfate. The organic layer was concentrated under reduced pressure, and the crude product was purified by column chromatography over silica gel (PE/EA (V/V) =4/1) to give the title compound as a white solid (3.5 g, 68%). MS (ESI, pos.ion) m/z 513.4[ M+H-56 ] ] ⁺ 。

Synthesis of F7-2:

f7-1 (2.0 g,3.5 mmol) and tetrahydrofuran (40 mL) were added to the flask, cooled to-15℃and borane tetrahydrofuran solution (8 mL,8.8mmol,1 mol/L) was added dropwise, and after the addition was completed, the temperature was raised to 55℃and stirred for 16h, cooled to room temperature, quenched by slow addition of MeOH (10 mL), and then heated to reflux for clarification. The solvent was distilled off under reduced pressure. To the residue was added ethyl acetate (200 mL) for dilution, and the organic layer was washed with 1% aqueous sodium hydroxide solution (20 mL) and saturated brine (20 mL) in this order, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE/EA (V/V) =5/1) to give the title compound as a colorless oil (1.2 g, 62%). MS (ESI, pos.ion) m/z:555.4[ M+H ]] ⁺ 。

Synthesis of F7-3:

f7-2 (1.2 g,2.2 mmol), ethyl acetate (20 mL) and palladium on carbon (0.4 g, 10%) were added to the reaction flask. Reacting at 55deg.C for 48h under hydrogen atmosphere, filtering, concentrating solventThe residue was chromatographed on silica gel (DCM/CH ₃ OH (V/V) =30/1) to give the title compound as a white solid (0.3 g, 40%). MS (ESI, pos.ion) m/z 375.2[ M+H ]] ⁺ 。

Synthesis of F7-4:

f7-3 (0.25 g,0.67 mmol), methylene chloride (10 mL) and triethylamine (0.19 mL,1.4 mmol) were added to the flask, followed by methanesulfonyl chloride (0.06 mL,0.8 mmol) with stirring. The reaction mixture was reacted at 25℃for 1h, then concentrated under reduced pressure, and the resulting residue was separated by silica gel column chromatography (DCM/CH ₃ OH (V/V) =30/1) to give the title compound as a white solid (0.30 g, 99%). MS (ESI, pos.ion) m/z 453.2[ M+H ]] ⁺ 。

Synthesis of F7:

f7-4 (250 mg,0.55 mmol), methylene chloride (2 mL), trifluoroacetic acid (2 mL), were added to the flask and reacted at 25℃for 0.5h, and the solvent was concentrated to give a brown oil (0.23 g, 100%). MS (ESI, pos.ion) m/z 353.2[ M+H ]] ⁺ 。

Synthesis of F8

Synthetic route to F8:

f8-0 was used to replace F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F9

Synthetic route to F9:

f9-0 was used to replace F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F10

Synthetic route to F10:

f10-0 was used to replace F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F11

Synthetic route for F11:

f11-0 was used instead of F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F12

Synthetic route to F12:

f12-0 was used to replace F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F13

Synthetic route to F13:

f13-0 was used to replace F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F14

Synthetic route to F14:

f14-0 was used instead of F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F15

Synthetic route to F15:

f15-0 was used to replace F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F16

Synthetic route to F16:

f16-0 was used instead of F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F17

Synthetic route to F17:

f17-0 was used to replace F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of F18

Synthetic route to F18:

f18-0 was used instead of F4-0 in the F4 synthesis, and the rest of the procedure was referred to the F4 synthesis to give a brown oil.

Synthesis of Compound (A)

Synthetic route for compound (a):

in a dry reaction flask were added F1 (309 mg,0.68 mmol), (R) -6- (bromomethyl) -4- (2-chloro-4-fluorophenyl) -2- (thiazol-2-yl) -1, 4-dihydropyrimidine-5-carboxylic acid methyl ester (275 mg,0.62 mmol), absolute ethanol (10 mL) and potassium carbonate (45 mg,3.13 mmol). The reaction mixture was reacted at room temperature for 5h, then ethyl acetate (40 mL) and water (30 mL) were added and extracted, and the organic phase was washed with saturated brine (30 ml×2), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) =50/1) to give the title compound as a yellow solid (321 mg, 73.9%). MS (ESI, pos.ion) m/z 702.0[ M+H ] ] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.64(s,1H),7.87(d,J＝3.1Hz,1H),7.51(d,J＝8.5Hz,2H),7.48(d,J＝3.1Hz,1H),7.30(dd,J＝7.9,5.4Hz,1H),7.19(d,J＝8.5Hz,2H),7.15(dd,J＝8.6,2.5Hz,1H),6.94(td,J＝8.3,2.5Hz,1H),6.22(s,1H),4.41(t,J＝6.1Hz,1H),4.13(d,J＝17.3Hz,1H),4.07(dd,J＝17.6,4.5Hz,1H),4.01(dd,J＝14.3,4.1Hz,1H),3.95–3.86(m,2H),3.61(s,3H),3.47–3.35(m,3H),3.27(td,J＝13.0,3.2Hz,1H),2.92–2.87(m,2H),2.86(s,3H),2.86–2.83(m,1H),2.52(td,J＝11.5,3.2Hz,1H),2.28(t,J＝10.8Hz,1H)。

Example 1

Synthetic route for compound 1:

f2 was used instead of F1 in the synthesis of compound (A), and the rest of the procedure was followed in the synthesis of compound (A) to give compound 1 as a yellow solid (36.3%). MS (ESI, pos.ion) m/z:728.3[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.64(s,1H),7.87(d,J＝3.1Hz,1H),7.51(d,J＝8.5Hz,2H),7.48(d,J＝3.1Hz,1H),7.30(dd,J＝8.0,5.5Hz,1H),7.20(d,J＝8.5Hz,2H),7.15(dd,J＝8.6,2.5Hz,1H),6.94(td,J＝8.3,2.5Hz,1H),6.22(s,1H),4.31(t,J＝6.1Hz,1H),4.14(d,J＝17.3Hz,1H),4.10–4.04(m,1H),4.04–3.97(m,1H),3.95–3.86(m,2H),3.61(s,3H),3.47–3.37(m,1H),3.33–3.22(m,1H),2.94–2.80(m,4H),2.53(dt,J＝11.6,5.8Hz,1H),2.40–2.21(m,2H),1.74(s,1H),1.20–1.11(m,2H),1.01–0.92(m,2H)。

Example 2

Synthetic route to Compound 2

F3 was used in place of F1 in the synthesis of compound (A), and the rest of the procedure was followed in the synthesis of compound (A) to give compound 2 as a yellow solid (33.2%). MS (ESI, pos.ion) m/z:714.3[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.63(s,1H),7.87(d,J＝3.1Hz,1H),7.55(d,J＝8.6Hz,2H),7.48(d,J＝3.1Hz,1H),7.34(d,J＝8.6Hz,2H),7.30(dd,J＝7.7,5.2Hz,1H),7.15(dd,J＝8.6,2.5Hz,1H),6.94(td,J＝8.3,2.5Hz,1H),6.22(s,1H),4.81(t,J＝6.0Hz,1H),4.31(d,J＝6.1Hz,1H),4.17–4.10(m,1H),4.10–4.04(m,1H),4.04–3.97(m,1H),3.96–3.86(m,2H),3.61(s,3H),3.44(dd,J＝9.0,4.7Hz,1H),3.27(td,J＝13.0,3.1Hz,1H),2.90(d,J＝10.7Hz,2H),2.52(dt,J＝11.6,5.8Hz,1H),2.38–2.30(m,1H),2.27(t,J＝11.1Hz,1H),1.74(s,1H),1.19–1.12(m,2H),0.97–0.89(m,2H)。

Example 3

Synthetic route for compound 3:

replacement of F1 in the synthetic procedure for compound (A) with F18 and the remaining procedure followed the synthetic procedure for compound (A) gave compound 3 as a yellow solid (292 mg, 64%). MS (ESI, pos.ion) m/z 684.2[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.62(s,1H),7.87(d,J＝3.1Hz,1H),7.50(dd,J＝15.3,2.5Hz,2H),7.33–7.28(m,1H),7.17(t,J＝8.2Hz,2H),7.06(dd,J＝8.4,1.9Hz,1H),6.94(td,J＝8.3,2.5Hz,1H),6.22(s,1H),5.46(s,1H),4.14(d,J＝17.2Hz,1H),4.10–3.97(m,2H),3.94–3.84(m,2H),3.61(s,3H),3.40(dd,J＝9.1,4.7Hz,1H),3.33–3.22(m,1H),2.96(t,J＝7.6Hz,2H),2.90(d,J＝11.0Hz,2H),2.78(d,J＝4.8Hz,3H),2.55–2.49(m,1H),2.46(t,J＝7.6Hz,2H),2.25(t,J＝10.8Hz,1H).

Example 4

Synthetic route for compound 4:

f5 was used in place of F1 in the synthesis of compound (A), and the rest of the procedure was followed in the synthesis of compound (A) to give compound 4 as a yellow solid (39.5%). MS (ESI, pos.ion) m/z 638.0[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.61(s,1H),7.86(d,J＝3.1Hz,1H),7.77(d,J＝8.7Hz,2H),7.60(d,J＝8.8Hz,2H),7.47(d,J＝3.0Hz,1H),7.29(dd,J＝6.8,4.4Hz,1H),7.14(dd,J＝8.5,2.4Hz,1H),6.93(td,J＝8.3,2.4Hz,1H),6.41(d,J＝4.6Hz,1H),6.21(s,1H),4.18–4.10(m,1H),4.09–4.00(m,2H),3.98–3.86(m,2H),3.60(s,3H),3.46(dd,J＝9.1,4.7Hz,1H),3.27(t,J＝11.0Hz,1H),3.00(d,J＝4.7Hz,3H),2.91(d,J＝10.6Hz,2H),2.54–2.45(m,1H),2.26(t,J＝10.7Hz,1H).

Example 5

Synthetic route for compound 5:

f6 was used in place of F1 in the synthesis of compound (A), and the rest was carried out according to the synthesis procedure of compound (A) to give compound 5 as a yellow solid (0.58 g, 57%). MS (ESI, pos.ion) m/z 666.3[ M+H ] ] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.63(s,1H),7.85(d,J＝2.9Hz,1H),7.45(dd,J＝11.9,5.6Hz,3H),7.29(t,J＝7.3Hz,1H),7.14(d,J＝8.1Hz,3H),6.93(dd,J＝11.2,5.1Hz,1H),6.21(s,1H),5.81(d,J＝3.4Hz,1H),4.06(ddd,J＝35.3,17.9,8.2Hz,4H),3.92–3.84(m,2H),3.60(s,3H),3.40(dd,J＝8.9,4.4Hz,1H),3.25(t,J＝11.1Hz,1H),2.95–2.83(m,4H),2.74(d,J＝4.6Hz,3H),2.43(t,J＝7.7Hz,2H),2.24(t,J＝10.7Hz,1H)。

Example 6

Synthetic route to compound 6:

f8 was used in place of F1 in the synthesis of compound (A), and the rest of the procedure was followed in the synthesis of compound (A) to give compound 6 as a yellow solid (120 mg, 39%). MS (ESI, pos.ion) m/z 680.2[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.62(s,1H),7.87(d,J＝3.1Hz,1H),7.54(d,J＝8.8Hz,2H),7.49(d,J＝3.1Hz,1H),7.36(d,J＝8.8Hz,2H),7.32–7.29(m,1H),7.16(dd,J＝8.6,2.6Hz,1H),6.94(td,J＝8.3,2.6Hz,1H),6.22(s,1H),5.20(s,1H),4.15(d,J＝17.2Hz,1H),4.11–4.05(m,1H),4.05–3.99(m,1H),3.96–3.86(m,2H),3.61(s,3H),3.45(dd,J＝9.1,4.6Hz,1H),3.29(td,J＝13.1,3.3Hz,1H),2.91(d,J＝10.4Hz,2H),2.72(d,J＝4.8Hz,3H),2.52(td,J＝11.6,3.2Hz,1H),2.28(t,J＝10.8Hz,1H),1.58(s,6H).

Example 7

Synthetic route for compound 7:

f9 was used in place of F1 in the synthesis of compound (A), and the rest of the procedure was followed in the synthesis of compound (A) to give compound 7 as a yellow solid (200 mg, 67%). MS (ESI, pos.ion) m/z 664.2[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.62(s,1H),7.87(d,J＝3.1Hz,1H),7.61–7.53(m,3H),7.51–7.44(m,3H),7.32–7.28(m,1H),7.15(dd,J＝8.5,2.5Hz,1H),6.93(td,J＝8.3,2.5Hz,1H),6.33(d,J＝15.6Hz,1H),6.22(s,1H),5.89(d,J＝4.6Hz,1H),4.14(d,J＝17.3Hz,1H),4.10–4.04(m,1H),4.04–3.97(m,1H),3.95–3.86(m,2H),3.61(s,3H),3.44(dd,J＝9.1,4.7Hz,1H),3.27(td,J＝13.0,2.9Hz,1H),2.94(d,J＝4.8Hz,3H),2.90(d,J＝10.7Hz,2H),2.51(td,J＝11.4,2.8Hz,1H),2.25(t,J＝10.7Hz,1H).

Example 8

Synthetic route for compound 8:

f10 was used in place of F1 in the synthesis of the compound (A), and the rest was carried out in the same manner as the synthesis of the compound (A) to obtain the compound 8 as a yellow solid (180 mg, 61%). MS (ESI, pos.ion) m/z 652.2[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.62(s,1H),7.87(d,J＝3.1Hz,1H),7.53(s,1H),7.48(d,J＝3.1Hz,1H),7.45(d,J＝8.3Hz,1H),7.36–7.29(m,2H),7.16(dd,J＝8.6,2.5Hz,1H),6.98–6.88(m,2H),6.22(s,1H),5.51(d,J＝3.3Hz,1H),4.14(d,J＝17.3Hz,1H),4.07(dd,J＝13.5,2.1Hz,1H),4.04–3.98(m,1H),3.96–3.86(m,2H),3.62(s,3H),3.58(s,2H),3.45(dd,J＝9.0,4.6Hz,1H),3.28(td,J＝12.8,3.1Hz,1H),2.90(d,J＝10.3Hz,2H),2.77(d,J＝4.8Hz,3H),2.52(td,J＝11.6,3.2Hz,1H),2.27(t,J＝10.7Hz,1H).

Example 9

Synthetic route for compound 9:

f11 was used in place of F1 in the synthesis of the compound (A), and the rest was carried out in the same manner as the synthesis of the compound (A) to obtain the compound 9 as a yellow solid (100 mg, 41%). MS (ESI, pos.ion) m/z 666.2[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.64(s,1H),7.87(d,J＝3.0Hz,1H),7.54–7.45(m,2H),7.34–7.29(m,2H),7.25(d,J＝8.0Hz,1H),7.16(dd,J＝8.6,2.5Hz,1H),6.97–6.88(m,2H),6.22(s,1H),5.51(s,1H),4.13(d,J＝17.3Hz,1H),4.07(dd,J＝13.7,2.0Hz,1H),4.04–3.97(m,1H),3.95–3.86(m,2H),3.62(s,3H),3.43(dd,J＝9.1,4.5Hz,1H),3.28(td,J＝12.9,3.1Hz,1H),2.98(t,J＝7.6Hz,2H),2.93–2.84(m,2H),2.77(d,J＝4.8Hz,3H),2.53–2.45(m,3H),2.27(t,J＝10.7Hz,1H).

Example 10

Synthetic route for compound 10:

/>

f1 in the synthesis of the compound (A) was replaced with F12, and the rest of the procedure was followed by the synthesis of the compound (A) to give the compound 10 as a yellow solid (240 mg, 80%). MS (ESI, pos.ion) m/z 678.2[ M+H ] ] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.63(s,1H),7.87(d,J＝3.1Hz,1H),7.60–7.53(m,2H),7.48(d,J＝3.1Hz,1H),7.45(d,J＝8.8Hz,2H),7.33–7.29(m,1H),7.16(dd,J＝8.6,2.5Hz,1H),6.94(td,J＝8.3,2.6Hz,1H),6.23(s,1H),6.02(s,1H),5.62(d,J＝4.8Hz,1H),4.16(d,J＝7.1Hz,1H),4.13(d,J＝2.9Hz,1H),4.11–4.05(m,1H),4.04–3.99(m,1H),3.97–3.86(m,2H),3.63(d,J＝10.5Hz,3H),3.45(dd,J＝9.0,4.5Hz,1H),3.28(td,J＝12.9,3.0Hz,1H),2.91(d,J＝4.8Hz,3H),2.89(s,1H),2.57(s,3H),2.55–2.48(m,1H),2.27(t,J＝10.8Hz,1H).

Example 11

Synthetic route for compound 11:

f13 was used in place of F1 in the synthesis of compound (A), and the rest was carried out according to the synthesis procedure of compound (A) to give compound 11 as a yellow solid (320 mg, 80%). MS (ESI, pos.ion) m/z 678.2[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):7.92(d,J＝3.0Hz,1H),7.67–7.58(m,2H),7.46(d,J＝8.2Hz,1H),7.41–7.31(m,2H),7.21–7.13(m,2H),7.02(td,J＝8.5,2.4Hz,1H),6.19(s,1H),5.51(d,J＝4.6Hz,1H),4.83(d,J＝14.6Hz,1H),4.62–4.46(m,2H),4.20(dd,J＝14.7,2.9Hz,1H),4.07(t,J＝9.0Hz,1H),3.84(t,J＝11.9Hz,2H),3.74–3.66(m,1H),3.64(s,3H),3.55(dd,J＝9.6,2.9Hz,1H),3.14–2.96(m,2H),2.74(d,J＝4.5Hz,3H),1.68–1.60(m,2H),1.12–1.04(m,2H).

Example 12

Compounds of formula (I)12 synthesis route:

f14 was used in place of F1 in the synthesis of compound (A), and the rest of the procedure was followed in the synthesis of compound (A) to give compound 12 as a yellow solid (230 mg, 75%). MS (ESI, pos.ion) m/z 678.2[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CD ₃ OD)δ(ppm):7.98(d,J＝3.0Hz,1H),7.80(d,J＝2.8Hz,1H),7.57(d,J＝8.6Hz,2H),7.52–7.45(m,1H),7.37(d,J＝8.6Hz,2H),7.24(dd,J＝8.7,2.4Hz,1H),7.08(td,J＝8.4,2.4Hz,1H),6.19(s,1H),4.39–4.25(m,1H),4.19–4.08(m,2H),4.07–3.98(m,2H),3.62(s,3H),3.61–3.56(m,1H),3.39–3.17(m,5H),2.66(s,3H),1.52–1.45(m,2H),1.07–1.01(m,2H).

Example 13

Synthetic route for compound 13:

replacement of F1 in the synthetic procedure for compound (A) with F15 and the remaining procedure followed the synthetic procedure for compound (A) gave compound 13 as a yellow solid (98 mg, 30%). MS (ESI, pos.ion) m/z 666.2[ M+H ]] ⁺ ； ¹ H NMR(600MHz,CD ₃ OD)δ(ppm):7.97(d,J＝3.0Hz,1H),7.76(d,J＝3.0Hz,1H),7.53(s,1H),7.48–7.41(m,2H),7.28(t,J＝7.9Hz,1H),7.24(dd,J＝8.7,2.4Hz,1H),7.09–7.02(m,2H),6.18(s,1H),4.17–4.11(m,1H),4.07–4.01(m,1H),4.01–3.92(m,3H),3.66–3.58(m,4H),3.57–3.50(m,1H),3.27(t,J＝11.1Hz,1H),2.99(d,J＝9.5Hz,2H),2.70(s,3H),2.46(t,J＝11.1Hz,1H),2.25(t,J＝10.6Hz,1H),1.46(d,J＝7.1Hz,3H).

Example 14

Synthetic route to compound 14:

f16 was used in place of F1 in the synthesis of the compound (A), and the rest was carried out in the same manner as the synthesis of the compound (A) to obtain the compound 14 as a yellow solid (0.42 g, 28%). MS (ESI, pos.ion) m/z 678.2[ M+H ]] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):7.88(d,J＝3.1Hz,1H),7.58(d,J＝8.7Hz,2H),7.50(d,J＝3.1Hz,1H),7.35(d,J＝8.8Hz,2H),7.33–7.29(m,2H),7.16(dd,J＝8.5,2.5Hz,1H),6.96(td,J＝8.4,2.5Hz,1H),6.21(s,1H),5.95(d,J＝4.4Hz,1H),4.30(d,J＝26.8Hz,2H),4.09(t,J＝16.4Hz,2H),3.98(t,J＝9.0Hz,1H),3.63(s,3H),3.47(dd,J＝9.4,4.1Hz,2H),3.18(s,2H),2.96(d,J＝4.8Hz,3H),2.70(s,1H),2.55(s,2H),2.13(d,J＝1.1Hz,3H).

Example 15

Synthetic route for compound 15:

f17 was used in place of F1 in the synthesis of compound (A), and the rest was carried out according to the synthesis procedure of compound (A) to give compound 15 as a yellow solid (487 mg, 80%). MS (ESI, pos.ion) m/z 656.2[ M+H ] ] ⁺ ； ¹ H NMR(400MHz,CDCl ₃ )δ(ppm):9.59(s,1H),8.10(t,J＝9.0Hz,1H),7.86(d,J＝3.1Hz,1H),7.81(dd,J＝15.6,1.9Hz,1H),7.49(d,J＝3.1Hz,1H),7.32–7.28(m,1H),7.16(dd,J＝8.6,2.5Hz,1H),7.09(dd,J＝8.8,2.1Hz,1H),6.94(td,J＝8.4,2.5Hz,1H),6.74(dd,J＝13.5,4.6Hz,1H),6.22(s,1H),4.16(d,J＝17.2Hz,1H),4.11–4.01(m,2H),3.94(dd,J＝19.1,13.1Hz,2H),3.61(s,3H),3.46(dd,J＝9.2,4.8Hz,1H),3.30(td,J＝13.0,3.2Hz,1H),3.04(d,J＝4.3Hz,3H),2.93(d,J＝10.9Hz,2H),2.52(td,J＝11.6,3.2Hz,1H),2.26(t,J＝10.8Hz,1H).

Biological testing

Test 1: anti-HBV EC ₅₀ Test method

HBV cell lines and culture conditions

The chromosomes of hepg2.2.15 cells (SELLS, PNAS,1987 and SELLS, JV, 1988) integrate the complete HBV genome and stably express viral RNAs and viral proteins. HepG2.2.15 cells are able to secrete mature hepatitis B virus particles, HBsAg and HBeAg into the culture medium. HepG2.2.15 was cultured in DMEM medium containing 10% fetal bovine serum, 100U/mL penicillin, 100U/mL streptomycin, 1% non-essential amino acids, 1mM sodium pyruvate 300. Mu.g/mL G418.

The viral particle DNA secreted by hepg2.2.15 cells can be quantified by qPCR methods and the effect of the compound on viral replication is thereby detected.

In vitro anti-HBV Activity assay

HepG2.2.15 cells 8,000 cells per well were inoculated into 96-well cell culture plates, 37 ℃,5% CO ₂ Culturing for 3 days until the cells grow to full holes. On test day 0, old medium was discarded and 200 μl of fresh detection medium (5% fbs) was added.

Compound formulation and cell treatment in antiviral experiments: the compound was dissolved with DMSO to 30mM, further diluted with DMSO to 800 μm, then 4-fold dilutions of 8 dilutions were performed, with a maximum concentration of 800 μm. Serial dilutions of 1 μl of compound were added to the above cell plates at a final experimental concentration of 4 μΜ (200-fold dilution). TDF (tenofovir disoproxil fumarate, selleck, cat S1400) was used as a positive control compound at a maximum concentration of 4. Mu.M. 1. Mu.L of DMSO was added to the negative control wells at a final concentration of 0.5%, and TDF was added to the positive control wells at a final concentration of 1. Mu.M.

qPCR method for detecting virus genome DNA

Primer: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. Viral copy numbers were calculated using SYBR Premix Ex Taq II-Takara DRR081S kit, using 1. Mu.L of cell culture supernatant as a template, using plasmid containing HBV genome as a standard curve, and using the standard curve. Concentration-viral copy number treatment with Graphpad Prism 5 software, EC of compounds on viral replication was calculated by a four-parameter nonlinear regression model ₅₀ . The experimental results are shown in Table 2.

Table 2: EC of the present compounds against HBV replication ₅₀ Value of

Examples	EC ₅₀ (nM)
		Example 1	21
Example 2	6
		Example 3	5
Example 4	8.7
		Example 5	16
Example 6	10
		Example 7	8
Example 8	6
		Example 9	7
Example 10	7
		Example 11	15
Example 12	19
		Example 13	12

Conclusion: experimental data show that the compound has good inhibitory activity on HBV and has good application prospect in the aspect of HBV virus resistance.

Test 2: cytotoxicity and selectivity index

The experimental method comprises the following steps:

serial dilutions of the compound were added to 384 well cytotoxic cell plates, 50 μl of hepg2.2.15 cells (3000 cells/well) were added per well, and the final concentration was 150 μm (200 fold dilution). 37 ℃, CO ₂ The cytotoxic effect of the compounds was detected with CellTiter Glo reagent after 4 days incubation in incubator.

Compound cytotoxicity was calculated using the following formula: cytotoxicity (%) = 100- (assay/DMSO control well mean x 100). Concentration-cytotoxicity (%) data were processed with Graphpad Prism 5 software and CC was calculated by a four-parameter nonlinear regression model ₅₀ 。CC ₅₀ Greater than 50 indicates lower toxicity and results of experiments with compounds of the present invention are shown in Table 3.

Table 3: cytotoxic CC of the present Compounds ₅₀ Value of

Examples	CC ₅₀ (μM)
		Example 1	>100
Example 2	>100
		Example 3	>100
Example 5	>100
		Example 6	>100
Example 7	>100
		Example 11	>100
Example 12	>100
		Example 13	>100

Conclusion: the cytotoxicity experimental data show that the compounds of the invention have small cytotoxicity.

Test 3: pharmacokinetic experiments of the Compounds of the invention in beagle dogs, mice, rats

(1) Pigeon PK test experiment

PK assay of compounds in beagle dogs (ex tslycra laboratory animals inc, henna, weight 10-12kg, male, age 10-12 months, 3 per group orally, 3 per group intravenously):

beagle dogs were given 2.5mg/kg or 5mg/kg by oral gavage or 1mg/kg or 2mg/kg by intravenous injection of the test compound.

Intravenous blood was collected at time points (0.083, 0.25,0.5,1,2,4,6,8 and 24 hours) after administration and collected at EDTA-K addition ₂ Is arranged in the anticoagulation tube. After liquid-liquid extraction, the plasma samples were quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using non-compartmental modeling using WinNonlin 6.3 software.

Conclusion: the pharmacokinetic experiment data show that the compound of the invention has better pharmacokinetic property in beagle bodies and has good application prospect in the aspect of HBV virus resistance.

(2) Mouse PK test experiment:

PK assay of compounds in mice (ex, from tslankda laboratory animal limited, henna, weight 20-25g, male, age 45-60 days, 3 per group orally, 3 per group intravenously):

ICR mice were given 10mg/kg by oral gavage or 2mg/kg by tail vein injection of the test compound or 10 mg/kg.

Blood was collected from orbital veins at time points (0.083,0.25,0.5,1,2,4,6,8 and 24 hours) after administration and collected at EDTA-K addition ₂ Is arranged in the anticoagulation tube. After liquid-liquid extraction, the plasma samples were quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using non-compartmental modeling using WinNonlin 6.3 software.

Conclusion: the pharmacokinetic experiment data show that the compound of the invention has better pharmacokinetic property in mice and has good application prospect in anti-HBV virus aspect.

(3) SD rat PK test experiment:

PK assay of compounds in SD rats (ex malaysia schrader laboratory animals inc., weight 200-250g, male, age 2-3 months, 3 per group orally, 3 per group intravenously):

rats are given 2.5mg/kg or 5mg/kg by oral gavage or 1mg/kg by intravenous injection of test compound.

Intravenous blood was collected at time points (0.083, 0.25, 0.5, 1, 2, 5, 7 and 24 hours) after administration and collected on EDTA-K ₂ Is arranged in the anticoagulation tube. After liquid-liquid extraction, the plasma samples were quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using non-compartmental modeling using WinNonlin 6.3 software.

Conclusion: pharmacokinetic experimental data show that the area under the curve AUC of the compound of the invention _last The compound of the invention has the advantages of large exposure, good absorption in SD rats, stable in vivo and high bioavailability. Therefore, the compound has better pharmacokinetic property in SD rats and has good application prospect in anti-HBV virus aspect.

Test 4: stability test of the inventive Compounds in liver microsomes of different species

Method of hepatic microsomal stability of compounds in different species:

to a 96-well plate, 30. Mu.L of a mixed solution of a blank solution and liver microsomes was added, and 15. Mu.L of a buffer containing a test compound was added to each well, and two samples were prepared in parallel. After pre-incubation at 37℃for 10min, 15. Mu.L of NADPH solution (8 mM) was added at a time point, the final concentration of the test compound was 1. Mu.M, the concentration of liver microsomes was 0.5mg/mL, and the final concentration of NADPH was 2mM. Incubation was performed for 0, 15, 30, 60min, respectively, and 150 μl acetonitrile (containing internal standard) was added to the mixed system after incubation was completed. The acetonitrile diluted sample was centrifuged at 4000rpm for 5min, and 150. Mu.L of the supernatant was taken to LC-MS/MS for analysis.

Conclusion: the compound has better stability in liver microsomes of different species.

Test 5: solubility test method

Experimental test method for solubility of compound

Except for other regulations, the test sample ground into fine powder or the liquid test sample is weighed to be in a solvent with a certain capacity at 25+/-2 ℃ and is shaken vigorously for 30s every 5min, and the dissolution condition within 30min is observed, namely, the complete dissolution is considered when solute particles or liquid drops are not visible. According to the standard of the 2015 edition of the Chinese pharmacopoeia:

By very soluble is meant that 1g (mL) of solute is soluble in less than 1mL of solvent;

soluble means that 1g (mL) of solute can be dissolved in 1-less than 10mL of solvent;

dissolving means that 1g (mL) of solute can be dissolved in 10-less than 30mL of solvent;

slightly soluble means that 1g (mL) of solute can be dissolved in 30-less than 100mL of solvent;

slightly soluble means that solute lg (mL) can be dissolved in 100-less than 1000mL of solvent;

very slightly soluble means that 1g (mL) of solute can be dissolved in 1000-less than 10000mL of solvent;

by practically insoluble or insoluble is meant that 1g (mL) of solute is not completely soluble in 10000mL of solvent.

Conclusion: solubility experimental data show that the compound of the invention has better solubility.

Test 6: hERG test method

Experimental test method of compound on heart

Compound/positive control/negative control, membrane fragment containing hERG channel, tracer with high affinity to hERG channel were added sequentially in 384 well plates and incubated at 25 ℃ at 250rpm for 4 hours. Fluorescence polarization values of each well were measured using a multifunctional microplate reader, and relative inhibition rates and 50% Inhibition Concentrations (IC) of compounds on hERG channels were calculated ₅₀ )。

Conclusion: the hERG test experimental data shows that the compounds of the invention have low toxicity to the heart.

Test 7: liver drug enzyme induction test

Cell culture

All incubations were performed in an incubator at 37 ℃, 5% co2 and 95% humidity.

After resuscitating the cryopreserved human hepatocytes (Baltimore, MD, USA), cell number and cell viability were determined using trypan blue staining and a cell counter. After counting, the hepatocytes were diluted to 70 ten thousand viable cells per ml with pre-heated plating medium. The diluted hepatocyte suspension is inoculated on a 48-well plate with pre-paved collagen according to the ratio of 0.2 mL/well, and is incubated and cultured for at least 4 hours in an incubator, and when the cells are in an adherent state, the incubation culture solution containing 2% substrate matrix glue is used for replacing the seed culture solution.

The working solution for administration is freshly prepared from incubation culture solution every day, and comprises test sample (concentration not lower than 0.1 mu M), CYP1A2, CYP2B6, and CYP3A4 positive inducer omeprazole, phenobarbital, and rifampicin, and DMSO stock solution diluted 1000 times. The information on the administration working fluid is shown in the following table.

After the culture system was established, the upper culture broth of the sandwich medium was discarded, 200. Mu.L of freshly prepared dosing working fluid (containing the test sample, positive control, negative control and matrix control) pre-heated to 37℃was added to each cell culture well, and the cell culture plates were placed in an incubator for continued culture for 24 hours. After 24 hours of incubation, the freshly prepared dosing working fluid was replaced and incubation continued for 24 hours. The entire incubation time was 48 hours. Three replicates were made for each drug concentration and control concentration.

After the cells were incubated with the dosing working solution for 48 hours, the remaining drug solution in the plate was discarded, the wells were washed 2 times with 0.5mL of HBSS solution preheated to 37 ℃ and 100 μl of enzyme-labeled substrate working solution preheated to 37 ℃ was added to each well and incubated for 30 minutes. After 30 minutes incubation, 75 μl of supernatant samples were removed from each well and added to a 96-well deep well plate containing 150 μl of stop solution. The plate was shaken for 10 minutes, centrifuged at 3220g for 20 minutes at 4℃and the supernatant was diluted 1:4 with an aqueous solution containing 0.1% formic acid. After 10 minutes of dilution of the sample shaking plate, the amount of the metabolite produced was measured by liquid chromatography tandem mass spectrometry (LC/MS).

After completion of the enzyme activity detection reaction, the remaining supernatant solution was discarded, and the cells were washed with 0.5mL of pre-warmed HBSS. 280. Mu.L of lysate RLT containing 1% beta-mercaptoethanol was added to each well, the plates were closed, shaken for 10 minutes, and transferred to a-80℃refrigerator for storage.

Cytotoxicity test

The potential toxicity of the test sample is assessed by the release of Lactate Dehydrogenase (LDH) in the hepatocytes. 100. Mu.L of each of the working solutions for administration after 24 hours and 48 hours of incubation with hepatocytes was taken out, and the concentration of lactate dehydrogenase was measured using a commercial LDH kit. Cell lysis solution was used as experimental positive control and incubation medium was used as blank control.

RNA analysis detection

The sample plate was thawed at room temperature and all samples were transferred to a new 48 well cell culture plate. RNA was extracted using a fully automated nucleic acid extraction workstation. Samples with more than 10% of the total amount of the samples are randomly extracted at different positions of the sample plate, OD values of 260nM and 280nM are measured by using an ND2000 micro-spectrophotometer, and the purity of the total RNA is judged by calculating the ratio of the two. Reverse transcription to obtain cDNA. The selected genes were quantitatively analyzed in real time using a CFX connectTM real-time fluorescent quantitative PCR instrument. The reaction conditions were set as follows: two minutes at 50 ℃; ten minutes at 95 ℃; the following two steps are performed for 40 cycles: fifteen seconds at 95℃and one minute at 60 ℃. Endogenous control 18S rRNA served as an internal standard.

Sample analysis and detection

The concentration of the metabolites of three CYP enzyme substrates (Acetaminophen, hydroxyanthrone) and 1-hydroxy midazolam (1' -hydroxy amidazom)) in the hepatocytes after protein precipitation was determined by liquid chromatography tandem mass spectrometry (LC/MS/MS). The analytical methods are shown in Table 4.

Table 4: induction test LCMS analysis method

/>

Gene expression data calculation

The program adopts a delta Ct relative quantitative method to compare the difference of gene expression between different treatment groups, and uses 18S rRNA as an internal reference gene to correct the gene expression quantity of each sample. Purpose(s) The Ct value of the gene minus the Ct value of the reference gene is ΔCt, i.e., ct _{Target gene} –Ct _18S =Δct. The Δct value of the control group subtracted from the Δct value of the treatment group is ΔΔct, i.e., Δct treatment group- Δct control group=ΔΔct. Finally with 2 ^-ΔΔCt Statistical analysis was performed comparing the fold change between the treated and placebo groups.

Enzyme activity data calculation

Experimental data shows the production of enzyme metabolites of CYP1A2, CYP2B6 and CYP3 A4. The change in enzyme activity is manifested by comparison of the fold induction of the corresponding cytochrome enzyme in the presence or absence of the compound. The method for calculating the induction fold and the induction ratio of the control compound are as follows:

fold induction = enzyme activity in test article treated sample/enzyme activity in substrate control treated sample

Induction ratio to control compound= (fold induction of test article treated sample-1)/(fold induction of control compound treated sample-1) ×100%.

Conclusion: the experimental data of the liver drug enzyme induction test show that the compound of the invention has no induction effect on the liver drug enzyme.

Test 8: experiment of influence of human serum on anti-HBV drug effect of compound

Principle of experiment

The chromosomes of hepg2.2.15 cells integrate the complete HBV genome and stably express viral RNA and viral proteins. HepG2.2.15 cells are able to secrete mature hepatitis B virus particles, HBsAg and HBeAg into the culture medium. The viral DNA secreted by hepg2.2.15 cells can be quantified by qPCR, adding different concentrations of human serum while treating the test compound, and thereby detecting the effect of human serum on the antiviral efficacy of the compound.

Experimental method

Compound treatment of HepG2.2.15 cells

Step 1: hepG2.2.15 cells were plated in 96-well cell culture plates 15000 cells per well with 200. Mu.L of cell culture medium per well.

Step 2: at 37 ℃,5% CO ₂ The cells were cultured in the cell incubator for 3 days until the cells grew to full wells.

The method comprises the following steps: on test day 0, old medium was discarded and 200 μl of fresh assay medium containing 2% FBS and varying Human Serum (HS) concentrations, including 0% HS, 5% HS, 10% HS, 20% HS, 40% HS and 50% HS, was added.

Step 4: compound formulation and cell treatment in antiviral experiments: the compound was dissolved with DMSO to 30mM, further diluted with DMSO to 800 μm, then 4-fold dilutions of 8 dilutions were performed, with a maximum concentration of 800 μm. Serial dilutions of 1 μl of compound were added to the cell plates prepared in step 3, with a final experimental concentration of 4 μΜ (200-fold dilution).

Step 5: the experiment set TDF (tenofovir disoproxil fumarate, selleck, cat S1400) as a positive control compound at a maximum concentration of 4. Mu.M under 2% FBS. The negative control wells were added with 1 μldmso at a final experimental concentration of 0.5%.

Step 6:96 well cell test plate was CO at 37 °c ₂ Incubate for 11 days, change every other day (days 2,4,6,8, 10) and add 1. Mu.L of freshly prepared chemical test compound, see steps 3 to 5.

Step 7: 150. Mu.L of supernatant was taken per well on day 11 for qPCR detection of viral DNA.

Step 8: compound formulation and cell treatment in cytotoxicity experiments: serial dilutions of the compound were made up with Bravo liquid handling system, 11 dilutions, 3-fold dilution, and a maximum concentration of 30mM. Serial dilutions of compound with Echo550 were performed in 0.25 μl per well to 384 well cytotoxic cell plates (Greiner 781098). HepG2.2.15 cells were prepared and resuspended in medium of different concentrations of human serum (50%, 40%,20%,10%,5% and 0%). 50. Mu.L (4000 cells) of HepG2.2.15 cells prepared above per well were added to 384 well cytotoxic cell plates at a final experimental concentration of 150. Mu.M (200 fold dilution). CO at 37 DEG C ₂ The cytotoxicity test was performed after incubation in the incubator for 4 days.

qPCR method for detecting virus genome DNA

Step 1: the supernatant under 20% HS test conditions was 2-fold diluted with DPBS, the supernatant under 40% HS test conditions was 4-fold diluted with DPBS, and the supernatant under 50% HS test conditions was 5-fold diluted with DPBS. After mixing, 1. Mu.L was taken for qPCR detection.

Step 2: supernatants from 0%, 5% HS and 10% HS experiments were assayed by qPCR directly at 1. Mu.L.

Step 3: the qPCR reaction system is prepared according to the following components:

SYBR Premix Ex TaqTM II(2×)	10μL
		HBV-For-202(10μM)	0.8μL
HBV-Rev-315(10μM)	0.8μL
		ROX Reference Dye(50×)	0.4μL
viral supernatant	1μL
		Adding water to	20μL

Step 4: the ABI ViiA7 qPCR instrument was set up according to the following conditions

Stage 1:

reps:95 ℃,30s,1 cycle

Stage 2:

reps:95 ℃,5s and 60 ℃,34s,40 cycles

Additive dissolution profile

Cytotoxic effect detection of compounds

Step 1: the PromegaCelltiter-Glo reagent was equilibrated to room temperature.

Step 2: the cytotoxic assay plate medium was discarded and 50 μl DPBS was added per well.

Step 3: mu.L CellTiter-Glo reagent was added to each well.

Step 4: the plate vibrator was set up for 2 minutes.

Step 5: equilibrated at room temperature for 10 minutes in the dark.

Step 6: read on an Envision plate reader (0.1 seconds/well).

Analysis of results

The plasmid containing HBV genome (viral copy number: 2X 10E6,2X 10E5,2X 10E4,2X 10E 3) was used as a standard curve, and the viral copy number was calculated as a standard curve. Data were processed with Graphpad Prism 5 software and concentration-viral copy number curves were plotted and EC was calculated by a four-parameter nonlinear regression model ₅₀ . Cytotoxicity% = 100- (assay/DMSO control well mean x 100). Cytotoxicity% data were processed and plotted using Graphpad Prism5 software and CC was calculated by a four-parameter nonlinear regression model ₅₀ 。

Conclusion: experimental data show that the human serum has small influence on the antiviral efficacy of the compound, and the compound can have good antiviral effect in human body.

While the invention has been described in detail in the foregoing general description, embodiments and experiments, it will be apparent to those skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Claims

1. A compound which is a compound shown as a formula (I) or (Ia) or a stereoisomer or a pharmaceutically acceptable salt of the compound shown as the formula (I) or (Ia),

wherein each R ¹ 、R ^1b And R is ^1a Independently hydrogen, deuterium, F, cl, br, methyl or ethyl;

R ² methyl, ethyl, n-propyl or isopropyl;

R ³ is thiazolyl;

w is N;

X ¹ is-C (=o) -;

each R is ⁴ 、R ^4a 、R ^4b And R is ⁵ Independently hydrogen, deuterium, F, cl, br, amino, methyl, ethyl, n-propyl or isopropyl;

R ⁶ Deuterium, F, cl, br, amino, methyl, ethyl, n-propyl or isopropyl;

or R is ⁵ 、R ⁶ And together with the carbon atoms to which they are attached form cyclopropyl, cyclobutyl, or cyclopentyl;

each R is ⁹ Independently hydrogen or deuterium;

R ^x is R ⁷ R ⁸ NC(＝O)-、R ^7a R ^8a NC(＝O)-(CR ⁵ R ⁶ )-、R ⁷ R ⁸ NC(＝O)-C _2-4 Alkylene-, R ⁷ R ⁸ NC(＝O)-C _2-4 Alkenylene-or R ¹¹ -S(＝O) ₂ NR ¹⁰ -C _0-4 Alkylene-, wherein R is ⁷ R ⁸ NC(＝O)-C _2-4 alkylene-of-C _2-4 Alkylene-, R ⁷ R ⁸ NC(＝O)-C _2-4 alkenylene-in-C _2-4 Alkenylene-and R ¹¹ -S(＝O) ₂ NR ¹⁰ -C _0-4 alkylene-of-C _0-4 Alkylene-each independently being unsubstituted or substituted with 1, 2 or 3 groups selected from deuterium, F, cl, br, OH and C _1-4 Substituted by alkyl; r is R ^y Hydrogen or F; or (b)

R ^x Is hydrogen; r is R ^y Is R ^7b R ^8b NC(＝O)-C _0-4 Alkylene-, R ^7b R ^8b NC(＝O)-C _2-4 Alkenylene-or R ^11a -S(＝O) ₂ NR ¹⁰ -C _0-4 Alkylene-, wherein R is ^7b R ^8b NC(＝O)-C _0-4 alkylene-of-C _0-4 Alkylene-, R ^7b R ^8b NC(＝O)-C _2-4 alkenylene-in-C _2-4 Alkenylene-and R ^11a -S(＝O) ₂ NR ¹⁰ -C _0-4 alkylene-of-C _0-4 Alkylene-each independently being unsubstituted or substituted with 1, 2 or 3 groups selected from deuterium, F, cl, br, OH and C _1-4 Substituted by alkyl;

each R is ⁸ And R is ^8a Independently deuterium, methyl, ethyl, n-propyl or isopropyl;

each R is ^7a 、R ^7b 、R ^8b And R is ⁷ Independently hydrogen, deuterium, methyl, ethyl, n-propyl or isopropyl;

each R is ¹⁰ Independently hydrogen, deuterium, methyl or ethyl;

each R is ¹¹ Independently ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, or cyclopentyl;

Each R is ^11a Independently methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, or cyclopentyl;

m is 0, 1, 2, 3 or 4.

2. The compound of claim 1, wherein R ^x Is R ⁷ R ⁸ NC(＝O)-、R ^7a R ^8a NC(＝O)-(CR ⁵ R ⁶ )-、R ⁷ R ⁸ NC(＝O)-(CH ₂ ) ₂ -、R ⁷ R ⁸ NC(＝O)-(CH ₂ ) ₃ -、R ⁷ R ⁸ NC(＝O)-CH＝CH-、R ⁷ R ⁸ NC(＝O)-CH＝CH-CH ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -CH ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₂ -or R ¹¹ -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₃ -, wherein said R ⁷ R ⁸ NC(＝O)-(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -、R ⁷ R ⁸ NC(＝O)-(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ -、R ⁷ R ⁸ -ch=ch-, R in NC (=o) -ch=ch-, and ⁷ R ⁸ NC(＝O)-CH＝CH-CH ₂ -ch=ch-CH in = ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -CH ₂ -CH in ₂ -、R ¹¹ -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -and R ¹¹ -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ -each independently being unsubstituted or substituted with 1, 2 or 3 substituents selected from deuterium, F, cl, br, OH, methyl, ethyl, n-propyl, isopropyl, n-butyl and tert-butyl; r is R ^y Hydrogen or F; or (b)

R ^x Is hydrogen; r is R ^y Is R ^7b R ^8b NC(＝O)-、R ^7b R ^8b NC(＝O)-CH ₂ -、R ^7b R ^8b NC(＝O)-(CH ₂ ) ₂ -、R ^7b R ^8b NC(＝O)-(CH ₂ ) ₃ -、

R ^7b R ^8b NC(＝O)-CH＝CH-、R ^7b R ^8b NC(＝O)-CH＝CH-CH ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -、R ^11a -S(＝O) ₂ NR ¹⁰ -CH ₂ -、

R ^11a -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₂ -or R ^11a -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₃ -, wherein said R ^7b R ^8b NC(＝O)-CH ₂ -CH in ₂ -、R ^7b R ^8b NC(＝O)-(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -、R ^7b R ^8b NC(＝O)-(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ -、R ^7b R ^8b -ch=ch-, R in NC (=o) -ch=ch-, and ^7b R ^8b NC(＝O)-CH＝CH-CH ₂ -ch=ch-CH in = ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -CH ₂ -CH in ₂ -、R ^11a -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -and R ^11a -S(＝O) ₂ NR ¹⁰ -(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ Each independently unsubstituted or substituted with 1, 2 or 3 substituents selected from deuterium, F, cl, br, OH, CN, methyl, ethyl, n-propyl, isopropyl, n-butyl and tert-butyl.

3. A compound having the structure of one of:

or a stereoisomer or pharmaceutically acceptable salt thereof.

4. A pharmaceutical composition comprising a compound according to any one of claims 1-3, and pharmaceutically acceptable excipients thereof.

5. The pharmaceutical composition of claim 4, further comprising an additional anti-HBV agent.

6. The pharmaceutical composition of claim 5, wherein the other anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator or an interferon.

7. The pharmaceutical composition of claim 5, wherein the additional anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, cil Mo Baijie, clavulan, emtricitabine, famprivir, baganine CP, indomethacin, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, miltebufoster, nitazoxanide, polyethylene glycol interferon alpha-2 a, ribavirin, luo Raosu-a, cizopyran, euforavac, an Puli near, phophazid, heplisav, interferon alpha-2 b, levamisole or propigermanium.

8. Use of a compound according to any one of claims 1 to 3 or a pharmaceutical composition according to any one of claims 4 to 7 in the manufacture of a medicament for the prevention, treatment, therapy or alleviation of a viral disease in a patient, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

9. The use according to claim 8, wherein the disease caused by hepatitis b infection is cirrhosis or hepatocellular carcinoma.