CN111825676A

CN111825676A - Dihydropyrimidine compound and application thereof in medicine

Info

Publication number: CN111825676A
Application number: CN202010284198.6A
Authority: CN
Inventors: 任青云; 张英俊; 刘辛昌; 颜光华; 王猛; 雷斗兴; 王兴安; 王恒; 陈允甫; 赖庆莹; 尹丽华; 李静; 郭亮洪
Original assignee: Sunshine Lake Pharma Co Ltd
Current assignee: Sunshine Lake Pharma Co Ltd
Priority date: 2019-04-15
Filing date: 2020-04-13
Publication date: 2020-10-27
Anticipated expiration: 2040-04-13
Also published as: CN111825676B

Abstract

The invention relates to a dihydropyrimidine compound and application thereof as a medicament, in particular to application of the dihydropyrimidine compound as a medicament for treating and preventing hepatitis B. Specifically, the invention relates to a compound shown in a general formula (I) or (Ia) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, wherein variables are defined in the specification. The invention also relates to a compound shown in the general formula (I) or (Ia) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite and a pharmaceutically acceptable salt thereof as a medicamentThe application, in particular to the application as a medicine for treating and preventing hepatitis B.

Description

Dihydropyrimidine compound and application thereof in medicine

Technical Field

The invention belongs to the field of medicine. In particular, the invention relates to a dihydropyrimidine compound and application thereof as a medicament, especially application thereof as a medicament for treating and/or preventing hepatitis B. The invention also relates to a composition consisting of the dihydropyrimidine compounds and other antiviral agents, and application of the dihydropyrimidine compounds and other antiviral agents in treatment and/or prevention of Hepatitis B Virus (HBV) infection.

Background

Hepatitis b virus belongs to the hepadnaviridae family. It can cause acute and/or persistent progressive chronic disease. Hepatitis b virus also causes many other clinical manifestations in pathological morphology-in particular chronic inflammation of the liver, cirrhosis and canceration of hepatocytes. In addition, co-infection with hepatitis delta can have adverse effects on the progression of the disease.

The conventional drugs licensed for the treatment of chronic hepatitis are interferon and lamivudine (lamivudine). However, interferons have only moderate activity and high toxic side effects; while lamivudine (lamivudine) has good activity, its resistance increases rapidly during treatment and often produces a rebound effect after cessation of treatment, the IC of lamivudine (3-TC)₅₀The value was 300nM (Science 299(2003), 893-896).

Deres et al reported heteroaromatic substituted dihydropyrimidine (HAP) compounds represented by Bay41-4109, Bay39-5493, which are capable of inhibiting HBV replication by preventing normal nucleocapsid formation. Bay41-4109 shows better drug metabolism property in clinical research (Science,299(2003),893-896), and the research on the action mechanism shows that the heteroaromatic ring substituted dihydropyrimidine compounds change the included angle between the dimers forming nucleocapsid through the action with 113-143 amino acid residues of the core protein, leading to the formation of unstable swollen nucleocapsid and accelerating the degradation of the core protein (biochem. Pharmacol.66(2003), 2273-2279).

There is still a need for new compounds that can be effectively used as antiviral agents, in particular as agents for the treatment and/or prevention of hepatitis b.

Disclosure of Invention

The invention relates to novel dihydropyrimidine compounds and their use in the preparation of medicaments for the treatment and prevention of HBV infection. Particularly, the invention relates to a novel dihydropyrimidine compound and a pharmaceutically acceptable composition thereof, the compound has the advantages of good pharmacokinetic property, good solubility, good stability, no induction effect on liver drug enzymes, low toxicity and the like, can effectively inhibit HBV infection, and has good application prospect in the aspect of anti-HBV.

In one aspect, the invention relates to a compound of formula (I) or (Ia) or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of a compound of formula (I) or (Ia),

wherein each R is¹、R^1bAnd R^1aIndependently hydrogen, deuterium, F, Cl, Br, I, cyano, methyl, ethyl, methoxy, ethoxy, methylamino, ethylamino, nitro, 4-trifluoromethylphenyl, 3, 5-bis (trifluoromethyl) phenyl, or trifluoromethyl;

R²is C_1-6Alkyl radical, C_1-6Haloalkyl, C_3-6Cycloalkyl or heterocyclyl consisting of 5 to 6 ring atoms;

R³is C₆-C₁₀Aryl or heteroaryl of 5 to 6 ring atoms, wherein said C₆-C₁₀Aryl and heteroaryl of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3,4 or 5 substituents selected from deuterium, F, Cl, Br, OH, CN, C_1-6Alkyl, hydroxy C_1-6Alkyl radical, C_1-6alkyl-OC (═ O) -, C_1-6alkyl-OC (═ O) -C_1-6Alkylene, HOOC-C_1-6Alkylene radical, C_1-6alkoxy-C_1-6Alkylene and C_1-6alkyl-S (═ O)₂-is substituted with a substituent of;

w is CH or N;

X¹is-C (═ O) -, -S (═ O)₂-or- (CR)⁵R⁶)_j-；

Each R⁴、R^4a、R^4bAnd R⁵Independently hydrogen, deuterium, F, Cl, Br, amino, C_1-4Alkoxy radical, C_1-6Alkyl, NH₂C(＝O)-、C_1-6alkyl-OC (═ O) -, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-4Alkylene or C_1-6A haloalkyl group;

R⁶deuterium, F, Cl, Br, amino, C_1-6Alkyl, NH₂C(＝O)-、C_1-6alkyl-OC (═ O) -, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-4Alkylene or C_1-6A haloalkyl group;

or R⁵、R⁶Together with the carbon atom to which they are attached form C_3-6Cycloalkyl or carbonyl;

each R⁹Independently hydrogen, deuterium, F, Cl, Br, amino, C_1-6Alkyl, NH₂C(＝O)-、C_1-6alkyl-OC (═ O) -, carboxyl C_1-6Alkylene, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-4Alkylene or C_1-6A haloalkyl group;

R^xis hydrogen, R⁷R⁸NC(＝O)-、R^7aR^8aNC(＝O)-(CR⁵R⁶)-、R⁷R⁸NC(＝O)-C_2-6Alkylene-, R⁷R⁸NC(＝O)-C_2-6Alkenylene-, R¹¹-S(＝O)₂NR¹⁰-C_0-6Alkylene-or R^11a-S(＝O)₂NR¹⁰-C_2-6Alkenylene-wherein R is⁷R⁸NC(＝O)-C_2-6Of alkylene-C_2-6Alkylene-, R⁷R⁸NC(＝O)-C_2-6-C in alkenylene-_2-6Alkenylene-, R¹¹-S(＝O)₂NR¹⁰-C_0-6Of alkylene-C_0-6Alkylene-and R^11a-S(＝O)₂NR¹⁰-C_2-6-C in alkenylene-_2-6Alkenylene-each independently being unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, C_1-6Alkyl, hydroxy C_1-6Alkyl and C_1-6Substituted with a substituent of haloalkyl;

R^yis hydrogen, F, R^7bR^8bNC(＝O)-C_0-6Alkylene-, R^7bR^8bNC(＝O)-C_2-6Alkenylene-, R^11a-S(＝O)₂NR¹⁰-C_0-6Alkylene-or R^11a-S(＝O)₂NR¹⁰-C_2-6Alkenylene radical-, wherein said R^7bR^8bNC(＝O)-C_0-6Of alkylene-C_0-6Alkylene-, R^7bR^8bNC(＝O)-C_2-6-C in alkenylene-_2-6Alkenylene-, R^11a-S(＝O)₂NR¹⁰-C_0-6Of alkylene-C_0-6Alkylene-and R^11a-S(＝O)₂NR¹⁰-C_2-6-C in alkenylene-_2-6Alkenylene-each independently being unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, C_1-6Alkyl, hydroxy C_1-6Alkyl and C_1-6Substituted with a substituent of haloalkyl;

each R⁷Independently of one another is hydrogen, deuterium, C_1-6Alkyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-3Alkylene or C_1-6A haloalkyl group;

each R⁸Independently of each other is deuterium, C_1-6Alkyl radical, C_3-6Cycloalkyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-3Alkylene or C_1-6A haloalkyl group;

or R⁷、R⁸And the nitrogen atom to which they are attached form a heterocyclic group of 3 to 6 ring atoms;

R^7ais hydrogen, deuterium, C_1-6Alkyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-3Alkylene or C_1-6A haloalkyl group;

R^8ais deuterium, C_1-6Alkyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-3Alkylene or C_1-6A haloalkyl group;

or R^7a、R^8aAnd the nitrogen atom to which they are attached form a heterocyclic group of 3 to 6 ring atoms;

R^7bis hydrogen, deuterium, C_1-6Alkyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-3Alkylene or C_1-6A haloalkyl group;

R^8bis hydrogen, deuterium, C_1-6Alkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-3Alkylene or C_1-6A haloalkyl group;

or R^7b、R^8bAnd the nitrogen atom to which they are attached form a heterocyclic group of 3 to 6 ring atoms;

each R¹⁰Independently of one another is hydrogen, deuterium, C_1-6Alkyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-4Alkylene or C_1-6A haloalkyl group;

each R¹¹Independently is C_2-6Alkyl radical, C_3-6Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-4Alkylene or C_1-6A haloalkyl group;

each R^11aIndependently is C_1-6Alkyl radical, C_3-6Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-4Alkylene or C_1-6A haloalkyl group;

m is 0, 1,2,3 or 4;

j is 1,2 or 3.

In some embodiments, R is as described herein²Is methyl, ethyl, n-propyl, isopropyl, C_1-4Haloalkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl;

R³is phenyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the phenyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or are each independently unsubstitutedIs substituted by 1,2,3,4 or 5 substituents selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, tert-butyl, hydroxy C_1-4Alkyl radical, C_1-4alkyl-OC (═ O) -, C_1-4alkyl-OC (═ O) -C_1-3Alkylene-, HOOC-C_1-3Alkylene-, C_1-4alkoxy-C_1-3Alkylene-and C_1-4alkyl-S (═ O)₂-is substituted with a substituent of (a).

In some embodiments, each R described herein⁴、R^4a、R^4bAnd R⁵Independently hydrogen, deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(＝O)-、C_1-4alkyl-OC (═ O) -, hydroxy C_1-4Alkyl, methoxy, ethoxy, n-propoxy, isopropoxy, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

R⁶deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(＝O)-、C_1-4alkyl-OC (═ O) -, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

or R⁵、R⁶And together with the carbon atom to which they are attached form a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or carbonyl group;

each R⁹Independently hydrogen, deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(＝O)-、C_1-4alkyl-OC (═ O) -, carboxyl C_1-4Alkylene, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group.

In some embodiments, R is as described herein^xIs hydrogen, R⁷R⁸NC(＝O)-、R^7aR^8aNC(＝O)-(CR⁵R⁶)-、R⁷R⁸NC(＝O)-C_2-4Alkylene-, R⁷R⁸NC(＝O)-C_2-4Alkenylene-, R¹¹-S(＝O)₂NR¹⁰-C_0-4Alkylene-or R^11a-S(＝O)₂NR¹⁰-C_2-4Alkenylene-wherein R is⁷R⁸NC(＝O)-C_2-4Of alkylene-C_2-4Alkylene-, R⁷R⁸NC(＝O)-C_2-4-C in alkenylene-_2-4Alkenylene-, R¹¹-S(＝O)₂NR¹⁰-C_0-4Of alkylene-C_0-4Alkylene-and R^11a-S(＝O)₂NR¹⁰-C_2-4-C in alkenylene-_2-4Alkenylene-each independently being unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, C_1-4Alkyl, hydroxy C_1-4Alkyl and C_1-4Substituted with a substituent of haloalkyl;

R^yis hydrogen, F, R^7bR^8bNC(＝O)-C_0-4Alkylene-, R^7bR^8bNC(＝O)-C_2-4Alkenylene-, R^11a-S(＝O)₂NR¹⁰-C_0-4Alkylene-or R^11a-S(＝O)₂NR¹⁰-C_2-4Alkenylene-wherein R is^7bR^8bNC(＝O)-C_0-4Of alkylene-C_0-4Alkylene-, R^7bR^8bNC(＝O)-C_2-6-C in alkenylene-_2-4Alkenylene-, R^11a-S(＝O)₂NR¹⁰-C_0-4Of alkylene-C_0-4Alkylene-and R^11a-S(＝O)₂NR¹⁰-C_2-4-C in alkenylene-_2-4Alkenylene-each independently being unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, C_1-4Alkyl, hydroxy C_1-4Alkyl and C_1-4Substituted with a substituent of haloalkyl;

wherein each R is⁵、R⁶、R⁷、R⁸、R^7a、R^8a、R^7b、R^8b、R¹⁰、R¹¹And R^11aHave the meaning as described in the present invention.

In some implementationsIn examples, R is as described in the invention^xIs hydrogen, R⁷R⁸NC(＝O)-、R^7aR^8aNC(＝O)-(CR⁵R⁶)-、R⁷R⁸NC(＝O)-(CH₂)₂-、R⁷R⁸NC(＝O)-(CH₂)₃-、R⁷R⁸NC(＝O)-CH＝CH-、R⁷R⁸NC(＝O)-CH＝CH-CH₂-、R¹¹-S(＝O)₂NR¹⁰-、R¹¹-S(＝O)₂NR¹⁰-CH₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH ═ CH-or R^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-, wherein said R⁷R⁸NC(＝O)-(CH₂)₂In- (CH)₂)₂-、R⁷R⁸NC(＝O)-(CH₂)₃In- (CH)₂)₃-、R⁷R⁸-CH-, R-of NC (O) -CH ═ CH —, R —⁷R⁸NC(＝O)-CH＝CH-CH₂-CH of (i-CH)₂-、R¹¹-S(＝O)₂NR¹⁰-CH₂-CH of (A-O-)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₂In- (CH)₂)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₃In- (CH)₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH-or R of-CH-^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-CH of (i-CH)₂Each independently unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-3Alkyl and C_1-3Substituted with a substituent of haloalkyl;

R^yis hydrogen, F, R^7bR^8bNC(＝O)-、R^7bR^8bNC(＝O)-CH₂-、R^7bR^8bNC(＝O)-(CH₂)₂-、R^7bR^8bNC(＝O)-(CH₂)₃-、R^7bR^8bNC(＝O)-CH＝CH-、R^7bR^8bNC(＝O)-CH＝CH-CH₂-、R^11a-S(＝O)₂NR¹⁰-、R^11a-S(＝O)₂NR¹⁰-CH₂-、R^11a-S(＝O)₂NR¹⁰-(CH₂)₂-、R^11a-S(＝O)₂NR¹⁰-(CH₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH ═ CH-or R^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-, wherein said R^7bR^8bNC(＝O)-CH₂-CH of (A-O-)₂-、R^7bR^8bNC(＝O)-(CH₂)₂In- (CH)₂)₂-、R^7bR^8bNC(＝O)-(CH₂)₃In- (CH)₂)₃-、R^7bR^8b-CH-, R-of NC (O) -CH ═ CH —, R —^7bR^8bNC(＝O)-CH＝CH-CH₂-CH of (i-CH)₂-、R^11a-S(＝O)₂NR¹⁰-CH₂-CH of (A-O-)₂-、R^11a-S(＝O)₂NR¹⁰-(CH₂)₂In- (CH)₂)₂-、R^11a-S(＝O)₂NR¹⁰-(CH₂)₃In- (CH)₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH-and R of-CH-^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-CH of (i-CH)₂Each independently unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl and C_1-4Substituted with a substituent of haloalkyl;

In some embodiments, each R described herein⁷Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

each R⁸Independently deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

or R⁷、R⁸And the nitrogen atom to which they are attached form an aziridinyl, azetidinyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl group;

R^7ais hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

R^8adeuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

or R^7a、R^8aAnd the nitrogen atom to which they are attached form an aziridinyl, azetidinyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl group;

each R^7bIndependently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

each R^8bIndependently hydrogen, deuterium, methyl,Ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

or R^7b、R^8bAnd the nitrogen atom to which they are attached form an aziridinyl, azetidinyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl group.

In some embodiments, each R described herein¹⁰Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

each R¹¹Independently is ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, aziridinyl, azetidinyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

each R^11aIndependently methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, aziridinyl, azetidinyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group.

In another aspect, the invention also provides a pharmaceutical composition comprising the compound of the invention and pharmaceutically acceptable excipients.

In some embodiments, the pharmaceutical composition of the present invention further comprises an additional anti-HBV agent.

In some embodiments, the pharmaceutical composition of the invention, wherein the other anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.

In some embodiments, the pharmaceutical composition of the invention, wherein the other anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon, cladribine, emtricitabine, faplovir, interferon, calamine CP, intein, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, mevoxil, nitazoxanide, peginterferon alpha-2 a, ribavirin, roscovitine-a, cizolin, Euforavac, ampirole, phosziphad, Heplisav, interferon alpha-2 b, levamisole, or propafege.

In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient.

In some embodiments, the use of the invention, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

In still other embodiments, the use of the invention, wherein the disease caused by hepatitis b infection is cirrhosis or hepatocellular carcinoma.

In another aspect, the invention relates to the use of a compound or pharmaceutical composition as described herein for the manufacture of a medicament for the prevention, treatment or alleviation of hepatitis b disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound or a pharmaceutical composition as described herein.

Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a compound of the invention.

Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a pharmaceutical composition comprising a compound of the invention.

Another aspect of the invention relates to the use of a compound of the invention for the manufacture of a medicament for the prevention or treatment, and lessening the severity, of an HBV disorder in a patient.

Another aspect of the present invention relates to the use of a pharmaceutical composition comprising a compound of the present invention for the manufacture of a medicament for the prevention or treatment, and lessening the severity, of an HBV disorder in a patient.

Another aspect of the present invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or pharmaceutical composition of the present invention in an amount effective to inhibit HBV. In other embodiments, the method further comprises contacting the cell with another anti-HBV therapeutic agent.

Another aspect of the present invention relates to a method of treating HBV disease in a patient, comprising administering to a patient in need thereof a therapeutically effective amount of a compound of the present invention or a pharmaceutical composition thereof. In still other embodiments, the method further comprises administering to the patient in need of treatment a therapeutically effective amount of an additional anti-HBV agent.

Another aspect of the present invention relates to a method of inhibiting HBV infection in a patient, comprising administering to a patient in need thereof a therapeutically effective amount of a compound of the present invention or a pharmaceutical composition thereof. In still other embodiments, the method further comprises administering to the patient in need of treatment a therapeutically effective amount of an additional anti-HBV agent.

Another aspect of the invention relates to methods for the preparation, isolation and purification of compounds encompassed by formula (I) or formula (Ia).

The foregoing merely summarizes certain aspects of the invention and is not intended to be limiting. These and other aspects will be more fully described below.

Detailed description of the invention

Definitions and general terms

The invention will be described in detail in the literature corresponding to the identified embodiments, and the examples are accompanied by the graphic illustrations of structural formulae and chemical formulae. The present invention is intended to cover all alternatives, modifications and equivalents, which may be included within the scope of the present invention as defined by the appended claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein which can be used in the practice of the present invention. The present invention is in no way limited to the description of methods and materials. There are many documents and similar materials that may be used to distinguish or contradict the present application, including, but in no way limited to, the definition of terms, their usage, the techniques described, or the scope as controlled by the present application.

The following definitions shall apply unless otherwise indicated. For the purposes of the present invention, the chemical elements are described in the periodic table of elements, CAS version and handbook of chemicals, 75,^thed, 1994. In addition, the general principles of Organic Chemistry are described in "Organic Chemistry," Thomas Sorrell, University Science Books, Sausaltio: 1999, and "March's Advanced Organic Chemistry," by Michael B.Smith and Jerry March, John Wiley Chemistry&Sons, New York, 2007, all of which are hereby incorporated by reference.

The compounds of the invention may be optionally substituted with one or more substituents, as described herein, in compounds of the general formula above, or as specifically exemplified, sub-classes, and classes of compounds encompassed by the invention.

In general, the term "substituted" indicates that one or more hydrogen atoms in a given structure are replaced with a particular substituent. Unless otherwise indicated, an optional substituent group may have one substituent substituted at each substitutable position of the group. When more than one position in a given formula can be substituted with one or more substituents selected from a particular group, the substituents may be substituted at each position, identically or differently. Wherein the substituent can be, but is not limited to, deuterium, F, Cl, Br, OH, C_1-8Alkyl radical, C_1-8Alkoxy, HOOC- (CR)⁷R⁸)_q-or C_1-8Alkoxy- (CR)⁷R⁸)_k-O-wherein q, k, R⁷And R⁸Have the meaning as described in the present invention.

In each part of this specification, substituents for the compounds of the present invention are disclosed in terms of group type or range. It is specifically intended that the invention includes each and every independent subcombination of the various members of these groups and ranges. For example, the term "C_1-6Alkyl "means in particular independently disclosed methyl, ethyl, C₃Alkyl radical, C₄Alkyl radical, C₅Alkyl and C₆An alkyl group.

The term "alkyl" as used herein includes saturated straight or branched chain monovalent hydrocarbon groups of 1 to 20 carbon atoms, wherein the alkyl groups may independently be optionally substituted with one or more substituents described herein. In some embodiments, the alkyl group contains 1 to 12 carbon atoms, in other embodiments, the alkyl group contains 1 to 10 carbon atoms, in other embodiments, the alkyl group contains 1 to 8 carbon atoms, in other embodiments, the alkyl group contains 1 to 6 carbon atoms, in other embodiments, the alkyl group contains 1 to 4 carbon atoms, and in other embodiments, the alkyl group contains 1 to 3 carbon atoms. Further examples of alkyl groups include, but are not limited to, methyl (Me, -CH)₃) Ethyl (Et-CH)₂CH₃) N-propyl (n-Pr, -CH)₂CH₂CH₃) Isopropyl (i-Pr, -CH (CH)₃)₂) N-butyl (n-Bu, -CH)₂CH₂CH₂CH₃) 2-methylpropyl or isobutyl (i-Bu, -CH)₂CH(CH₃)₂) 1-methylpropyl or sec-butyl (s-Bu, -CH (CH)₃)CH₂CH₃) T-butyl (t-Bu, -C (CH)₃)₃) N-pentyl (-CH)₂CH₂CH₂CH₂CH₃) 2-pentyl (-CH (CH)₃)CH₂CH₂CH₃) 3-pentyl (-CH (CH)₂CH₃)₂) 2-methyl-2-butyl (-C (CH)₃)₂CH₂CH₃) 3-methyl-2-butyl(-CH(CH₃)CH(CH₃)₂) 3-methyl-1-butyl (-CH)₂CH₂CH(CH₃)₂) 2-methyl-1-butyl (-CH)₂CH(CH₃)CH₂CH₃) N-hexyl (-CH)₂CH₂CH₂CH₂CH₂CH₃) 2-hexyl (-CH (CH)₃)CH₂CH₂CH₂CH₃) 3-hexyl (-CH (CH)₂CH₃)(CH₂CH₂CH₃) 2-methyl-2-pentyl (-C (CH))₃)₂CH₂CH₂CH₃) 3-methyl-2-pentyl (-CH (CH)₃)CH(CH₃)CH₂CH₃) 4-methyl-2-pentyl (-CH (CH)₃)CH₂CH(CH₃)₂) 3-methyl-3-pentyl (-C (CH)₃)(CH₂CH₃)₂) 2-methyl-3-pentyl (-CH (CH)₂CH₃)CH(CH₃)₂) 2, 3-dimethyl-2-butyl (-C (CH)₃)₂CH(CH₃)₂) 3, 3-dimethyl-2-butyl (-CH (CH)₃)C(CH₃)₃) N-heptyl, n-octyl, and the like.

The term "alkylene" denotes a saturated divalent or polyvalent hydrocarbon radical resulting from the removal of two or more hydrogen atoms from a saturated straight or branched hydrocarbon radical. Unless otherwise specified, the alkylene group contains 1 to 12 carbon atoms. In some embodiments, the alkylene group contains 1 to 6 carbon atoms; in other embodiments, the alkylene group contains 1 to 4 carbon atoms; in still other embodiments, the alkylene group contains 1 to 3 carbon atoms; in still other embodiments, the alkylene group contains 1 to 2 carbon atoms. Examples of alkylene groups include, but are not limited to, methylene (-CH)₂-, ethylene (-CH)₂CH₂-, isopropylidene (-CH)₂CH₂CH₂-, isopropylidene (-CH (CH)₃)CH₂-) and the like.

The terms "hydroxyalkyl" and "hydroxyalkoxy" denote alkyl or alkoxy, optionally substituted with one or more hydroxyl groups, whichIn the above, the "hydroxyalkyl group", "hydroxyalkylene group" and "hydroxyalkyl group" may be used interchangeably, and examples thereof include, but are not limited to, hydroxymethyl (-CH)₂OH), hydroxyethyl (-CH)₂CH₂OH,-CHOHCH₃) Hydroxypropyl (-CH)₂CH₂CH₂OH,-CH₂CHOHCH₃,-CHOHCH₂CH₃) Hydroxy methoxy (-OCH)₂OH), and the like.

The terms "haloalkyl", "haloalkenyl" or "haloalkoxy" denote alkyl, alkenyl or alkoxy groups substituted with one or more halogen atoms, wherein alkyl, alkenyl and alkoxy have the meaning described herein. Examples include, but are not limited to, difluoroethyl (-CH)₂CHF₂,-CF₂CH₃,-CHFCH₂F) Trifluoroethyl (-CH)₂CF₃,-CF₂CH₂F,-CFHCHF₂) Trifluoromethyl (-CF)₃) Trifluoromethoxy (-OCF)₃) Fluorovinyl (-CH. CHF, -CF. CH)₂) And the like.

The term "alkenyl" denotes a straight or branched chain monovalent hydrocarbon radical of 2 to 12 carbon atoms, wherein at least one C-C is sp²Double bonds, wherein the alkenyl groups may be independently optionally substituted with one or more substituents described herein, include groups having "trans", "cis" or "E" and "Z" orientation, wherein specific examples include, but are not limited to, vinyl (-CH ═ CH)₂) Propenyl (-CH ═ CH)₂CH₃) Allyl (-CH)₂CH＝CH₂) And so on.

The term "alkoxy" means an alkyl group attached to the rest of the molecule through an oxygen atom, wherein the alkyl group has the meaning as described herein. Unless otherwise specified, the alkoxy group contains 1 to 12 carbon atoms. In some embodiments, alkoxy groups contain 1 to 8 carbon atoms; in other embodiments, the alkoxy group contains 1 to 6 carbon atoms; in other embodiments, the alkoxy group contains 1 to 4 carbon atoms; in still other embodiments, the alkoxy group contains 1 to 3 carbon atoms, and in still other embodiments, the alkyl group contains 1 to 2 carbon atoms. The alkoxy group may be optionally substituted with one or more substituents described herein.

Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH)₃) Ethoxy (EtO, -OCH)₂CH₃) 1-propoxy (n-PrO, n-propoxy, -OCH)₂CH₂CH₃) 2-propoxy (i-PrO, i-propoxy, -OCH (CH)₃)₂) 1-butoxy (n-BuO, n-butoxy, -OCH)₂CH₂CH₂CH₃) 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH)₂CH(CH₃)₂) 2-butoxy (s-BuO, s-butoxy, -OCH (CH)₃)CH₂CH₃) 2-methyl-2-propoxy (t-BuO, t-butoxy, -OC (CH)₃)₃) 1-pentyloxy (n-pentyloxy, -OCH)₂CH₂CH₂CH₂CH₃) 2-pentyloxy (-OCH (CH)₃)CH₂CH₂CH₃) 3-pentyloxy (-OCH (CH))₂CH₃)₂) 2-methyl-2-butoxy (-OC (CH))₃)₂CH₂CH₃) 3-methyl-2-butoxy (-OCH (CH)₃)CH(CH₃)₂) 3-methyl-l-butoxy (-OCH)₂CH₂CH(CH₃)₂) 2-methyl-l-butoxy (-OCH)₂CH(CH₃)CH₂CH₃) And so on.

The term "alkynyl" refers to a straight or branched chain monovalent hydrocarbon radical containing 2 to 12 carbon atoms, at least one of which is a sp triple bond, wherein the alkynyl radical may independently be optionally substituted with one or more substituents described herein, wherein in some embodiments the alkyl radical contains 2 to 12 carbon atoms, in other embodiments the alkyl radical contains 2 to 8 carbon atoms, in other embodiments the alkyl radical contains 2 to 6 carbon atoms, and in yet other embodiments the alkyl radical contains 2 to 4 carbon atoms. Specific examples include, but are not limited to, ethynyl (-C ≡ CH), propargyl (-CH)₂C ≡ CH), propynyl (-C ≡ C-CH)₃) Acetylenic butyl (-CH)₂CH₂C≡CH、-CH₂C≡CCH₃、-C≡CCH₂CH₃and-CH (CH)₃) C ≡ CH) and alkynylpentyl (-CH)₂CH₂CH₂C≡CH、-CH₂CH₂C≡CCH₃、-CH₂C≡CCH₂CH₃、-C≡CCH₂CH₂CH₃、-CH₂CH(CH₃)C≡CH、-CH(CH₃)CH₂C≡CH、-C(CH₃)₂C≡CH、-CH(CH₃)C≡CCH₃and-C ≡ CCH (CH)₃)₂) And so on.

The term "cycloalkyl" denotes a monovalent or polyvalent saturated monocyclic, bicyclic or tricyclic ring system containing from 3 to 12 carbon atoms. In one embodiment, the cycloalkyl group contains 3 to 12 carbon atoms; in another embodiment, cycloalkyl contains 3 to 8 carbon atoms; in another embodiment, cycloalkyl groups contain 3 to 7 carbon atoms; in still other embodiments, the cycloalkyl group contains 3 to 6 carbon atoms. The cycloalkyl groups may be independently unsubstituted or substituted with one or more substituents described herein.

The term "heterocyclyl" refers to a mono-, bi-or tricyclic ring system containing 3 to 12 ring atoms, which is non-aromatic, saturated or partially unsaturated, monovalent or multivalent, wherein at least one ring atom is selected from nitrogen, sulfur or oxygen atoms. Wherein said heterocyclyl group may be optionally substituted with one or more substituents as described herein. Unless otherwise indicated, a-CH of a heterocyclic radical₂-a group may optionally be replaced by-C (═ O) -or-C (═ S) -. The sulfur atom of the ring may optionally be oxidized to the S-oxide. The nitrogen atoms of the ring may optionally be oxidized to the N-oxide. In some embodiments, heterocyclyl is a monocyclic heterocyclyl consisting of 5-7 atoms. In some embodiments, heterocyclyl is a monocyclic heterocyclyl consisting of 5-6 atoms. In some embodiments, heterocyclyl is a bicyclic heterocyclyl consisting of 7-12 ring atoms. In some embodiments, heterocyclyl is a bicyclic heterocyclyl consisting of 8-10 ring atoms. In some embodiments, heterocyclyl is a 4-atom heterocyclyl and refers toA mono-or polyvalent, saturated or partially unsaturated, non-aromatic monocyclic ring comprising 4 ring atoms, wherein at least one ring atom is selected from the group consisting of nitrogen, sulfur and oxygen atoms. In other embodiments, heterocyclyl is a 5-atom heterocyclyl and refers to a monovalent or multivalent, saturated or partially unsaturated, non-aromatic monocyclic ring comprising 5 ring atoms, wherein at least one ring atom is selected from the group consisting of nitrogen, sulfur, and oxygen atoms. In other embodiments, heterocyclyl is a 6-atom heterocyclyl and refers to a monovalent or multivalent, saturated or partially unsaturated, non-aromatic monocyclic ring comprising 6 ring atoms, wherein at least one ring atom is selected from the group consisting of nitrogen, sulfur, and oxygen atoms.

Examples of "heterocyclyl" include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thioxanyl, piperazinyl, homopiperazinyl, oxidopropyl, aziridinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, azepinyl, oxepinyl, oxazepinyl, diazepinyl, thiazepinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1, 3-dioxolanyl, pyrazolinyl, dithianyl, dithiazolyl, dihydrothienyl, pyrazolylimidazolinyl, imidazolidinyl, 1,2,3, 4-tetrahydroisoquinolinyl, 3-azabicyclo [3.1.0] hexyl, 3-azabicyclo [4.1.0] heptyl, azabicyclo [2.2.2] hexyl, 3H-indolquinazinyl, and N-pyridylurea. Examples of heterocyclic groups also include, 1, 1-dioxothiomorpholinyl, examples of which ring carbon atom is substituted with oxo (═ O) include, but are not limited to, pyrimidinedione, 1,2, 4-thiadiazol-5 (4H) -one, 1,2, 4-oxadiazol-5 (4H) -one, 1H-1,2, 4-triazol-5 (4H) -one, and the like, and examples of which ring carbon atom is substituted with group ═ S include, but are not limited to, 1,2, 4-oxadiazol-5 (4H) -thione, 1,3, 4-oxadiazol-2 (3H) -thione, and the like.

The terms "heterocyclylalkyl" and "heterocyclylalkylene" are used interchangeably to refer to an alkyl group substituted with a heterocyclyl group, examples of which include, but are not limited to, pyrrole-2-methyl, morpholine-4-methyl.

The term "heterocyclylalkoxy" refers to an alkoxy group substituted with a heterocyclyl group in which an oxygen atom is attached to the rest of the molecule, examples of which include, but are not limited to, pyrrole-2-methoxy, piperidine-2-ethoxy.

The term "heterocyclylalkylamino" refers to an alkylamino group substituted with a heterocyclyl group in which the nitrogen atom is attached to the remainder of the molecule; wherein the heterocyclic, alkyl and alkylamino groups have the meaning as described herein, examples include, but are not limited to, 2-morpholinoethylamino and the like.

The term "heteroatom" means one or more of O, S, N, P and Si, including N, S and any oxidation state form of P; primary, secondary, tertiary amines and quaternary ammonium salt forms; or a form in which a hydrogen on a nitrogen atom in the heterocycle is substituted, for example, N (like N in 3, 4-dihydro-2H-pyrrolyl), NH (like NH in pyrrolidinyl) or NR (like NR in N-substituted pyrrolidinyl, R representing a substituent as described herein).

The term "halogen" or "halogen atom" refers to F, Cl, Br or I.

The term "unsaturated" as used herein means that the moiety contains one or more degrees of unsaturation.

The term "aryl" denotes monocyclic, bicyclic and tricyclic carbon ring systems containing 6 to 14 ring atoms, or 6 to 12 ring atoms, or 6 to 10 ring atoms, wherein at least one ring system is aromatic, wherein each ring system contains 3 to 7 atoms in the ring and one or more attachment points to the rest of the molecule. The term "aryl" may be used interchangeably with the term "aromatic ring". Examples of the aryl group may include phenyl, naphthyl and anthracenyl. The aryl group may independently be optionally substituted with one or more substituents described herein.

The term "heteroaryl" denotes monocyclic, bicyclic and tricyclic ring systems containing 5 to 12 ring atoms, wherein at least one ring is aromatic and at least one aromatic ring contains one or more heteroatoms, wherein each ring system contains a ring of 5 to 7 ring atoms with one or more attachment points to the rest of the molecule. The term "heteroaryl" may be used interchangeably with the terms "heteroaromatic", "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is a monocyclic heteroaryl consisting of 5 to 7 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, heteroaryl is a monocyclic heteroaryl consisting of 5 to 6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, heteroaryl is a bicyclic heteroaryl consisting of 7-12 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, heteroaryl is a bicyclic heteroaryl consisting of 8-10 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen. In some embodiments, heteroaryl is a bicyclic heteroaryl consisting of 9-10 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from nitrogen, sulfur, and oxygen.

Examples of heteroaromatic rings include, but are not limited to, the following monocyclic rings: 1,2, 4-oxadiazol-5 (4H) -thioketo group, 1,2, 4-thiadiazol-5 (4H) -keto group, 1,2, 4-oxadiazol-5 (4H) -keto group, 1,3, 4-oxadiazol-2 (3H) -thioketo group, 1H-1,2, 4-triazol-5 (4H) -keto group, 2-furyl group, 3-furyl group, N-imidazolyl group, 2-imidazolyl group, 4-imidazolyl group, 5-imidazolyl group, 3-isoxazolyl group, 4-isoxazolyl group, 5-isoxazolyl group, 2-oxazolyl group, 4-oxazolyl group, 5-oxazolyl group, N-pyrrolyl group, 2-pyrrolyl group, 3-pyrrolyl group, 2-pyridyl group, and the like, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, pyridazinyl (e.g. 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (e.g. 5-tetrazolyl), triazolyl (e.g. 2-triazolyl and 5-triazolyl), 2-thienyl, 3-thienyl, pyranyl, pyrazolyl (e.g. 2-pyrazolyl), isothiazolyl, 1,2, 3-oxadiazolyl, 1,2, 5-oxadiazolyl, 1,2, 4-oxadiazolyl, 1,2, 3-triazolyl, 1,2, 3-thiadiazolyl, 1,3, 4-thiadiazolyl, 1,2, 5-thiadiazolyl, pyrazinyl, 1,3, 5-triazinyl, Diazolyl, thiadiazolyl, triazinyl, and the like; the following bicyclic rings are also included, but are in no way limited to these: benzothiazolyl, benzimidazolyl, benzofuranyl, benzothienyl, indolyl (e.g., 2-indolyl), purinyl, quinolyl (e.g., 2-quinolyl, 3-quinolyl, 4-quinolyl), isoquinolyl (e.g., 1-isoquinolyl, 3-isoquinolyl, or 4-isoquinolyl), and the like.

The term "M-M₁"consisting of one ring atom" means that the cyclic group consists of M-M₁And the ring atoms comprise carbon atoms and/or heteroatoms such as O, N, S, P. For example, "a heterocyclic group consisting of 3 to 6 ring atoms" represents that it includes a heterocyclic group consisting of 3,4, 5 or 6 ring atoms.

The terms "heteroarylalkyl" and "heteroarylalkylene" are used interchangeably to mean that the alkyl group is substituted with one or more identical or different heteroaryl groups, wherein the alkyl group and heteroaryl group have the meaning described herein, examples of which include, but are not limited to, pyridine-2-ethyl, thiazole-2-methyl, imidazole-2-ethyl, pyrimidine-2-propyl, and the like.

The term "sulfonyl", whether used alone or in combination with other terms such as "alkylsulfonyl", denotes the divalent radical-SO₂-. The term "alkylsulfonyl" refers to an alkyl-substituted sulfonyl group that forms an alkylsulfonyl group (e.g., -SO)₂CH₃)。

The terms "aralkyl" and "arylalkyl" are used interchangeably to refer to an aryl-substituted alkyl group in which the aryl and alkyl groups have the meanings as set forth herein. In some of these examples, an aralkyl group or arylalkyl group refers to a "lower aralkyl" group, i.e., the aryl group is attached to C_1-6On the alkyl group. In other embodiments, an aralkyl group or an arylalkyl group means that the aryl group is attached to C_1-3On the alkyl group. Specific examples thereof include phenylmethyl (i.e., benzyl), diphenylmethyl, phenylethyl and the like.

The terms "alkylamino" and "alkylamino" are used interchangeably and include "N-alkylamino" and "N, N-dialkylamino" in which the hydrogen atoms in the amino groups are each independently substituted with one or two alkyl groups. Wherein one isIn some embodiments, the alkylamino group is one or two C₁-C₁₂The alkyl group is attached to a nitrogen atom to form a lower alkylamino group. In other embodiments, alkylamino is one or two C₁-C₆The alkyl group is attached to a nitrogen atom to form a lower alkylamino group. In other embodiments, alkylamino is one or two C₁-C₄The alkyl group is attached to a nitrogen atom to form a lower alkylamino group. In still other embodiments, the alkylamino group is one or two C₁-C₃The alkyl group is attached to a nitrogen atom to form a lower alkylamino group. Suitable alkylamino groups can be monoalkylamino or dialkylamino, and examples of alkylamino include, but are not limited to, N-methylamino, N-ethylamino, N-dimethylamino, N-diethylamino, N-ethyl-N-propylamino, and the like.

The terms "cycloalkylalkyl" and "cycloalkylalkylene" are used interchangeably to mean that the alkyl group may be substituted with one or more identical or different cycloalkyl groups, where cycloalkyl and alkyl groups have the meanings as described herein. Examples include, but are not limited to, cyclohexylmethylene, cyclopropylethylene, and the like.

The terms "alkoxyalkyl" and "alkoxyalkylene" are used interchangeably to indicate that an alkyl group may be substituted with one or more of the same or different alkoxy groups, where alkoxy and alkyl groups have the meanings as described herein. Examples include, but are not limited to, cyclohexylmethyl, cyclopropylethyl, methoxyethyl, ethoxymethyl and the like.

As described herein, a ring system formed by a substituent that is bonded to the central ring (as shown in formula a) represents that the substituent may be substituted at any substitutable position on the ring, as shown in formulae b, c, d, e, f, g, and h.

In addition, it should be noted that, unless otherwise statedIt is expressly noted that the description used throughout this document that "each of … and … is independently," "… and … are independently" and "… and … are independently" is interchangeable and should be broadly understood to mean that the particular items expressed between the same symbols do not affect each other in different groups, or that the particular items expressed between the same symbols do not affect each other in the same groups. For example, as shown in formula p, a plurality of R⁷Are not affected by each other.

As described in the present invention, there are two linking sites in the system that are linked to the rest of the molecule, for example, as shown by formula q, which means that either the E or E' end is linked to the rest of the molecule, i.e., the linking modes at the two ends can be interchanged under the condition of reasonable molecular structure.

Unless otherwise indicated, the structural formulae depicted herein include all isomeric forms (e.g., enantiomers, diastereomers, and geometric isomers (or conformers): for example, the R, S configuration containing an asymmetric center, (Z), (E) isomers of double bonds, and (Z), (E) conformers.

The term "prodrug", as used herein, represents a compound that is converted in vivo to a compound of formula (I). Such conversion is effected by hydrolysis of the prodrug in the blood or by enzymatic conversion to the parent structure in the blood or tissue. The prodrug compound of the invention can be ester, and in the prior invention, the ester can be used as the prodrug and comprises phenyl ester and aliphatic (C)_1-24) Esters, acyloxymethyl esters, carbonates,carbamates and amino acid esters. For example, a compound of the present invention contains a hydroxy group, i.e., it can be acylated to provide the compound in prodrug form. Other prodrug forms include phosphate esters, such as those obtained by phosphorylation of a hydroxyl group on the parent. For a complete discussion of prodrugs, reference may be made to the following: T.Higuchi and V.Stella, Pro-drugs as Novel delivery systems, Vol.14of the A.C.S.Sympossium Series, Edward B.Roche, ed., Bioreverted arrays in Drug designs, American Pharmaceutical Association and PergammonPress, 1987, J.Rautio et al, Prodrugs: Design and Clinical Applications, Nature Review Drug Discovery,2008,7,255 and 270, and S.J.Herr et al, Prodrugs of pharmaceuticals and pharmaceuticals, Journal of chemical Chemistry,2008,51, 2328 and 2345.

Unless otherwise indicated, all tautomeric forms of the compounds of the invention are included within the scope of the invention. In addition, unless otherwise indicated, the structural formulae of the compounds described herein include isotopically enriched concentrations of one or more different atoms.

"metabolite" refers to the product of a particular compound or salt thereof obtained by metabolism in vivo. Metabolites of a compound can be identified by techniques well known in the art, and its activity can be characterized by assay methods as described herein. Such products may be obtained by administering the compound by oxidation, reduction, hydrolysis, amidation, deamidation, esterification, defatting, enzymatic cleavage, and the like. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a compound of the present invention with a mammal for a sufficient period of time.

The definition and convention of stereochemistry in the present invention is generally used with reference to the following documents: S.P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E.and Wilen, S., "stereoschemistry of Organic Compounds", John Wiley & Sons, Inc., New York,1994. All stereoisomeric forms of the compounds of the present invention, including, but in no way limited to, diastereomers, enantiomers, atropisomers, and mixtures thereof, such as racemic mixtures, form part of the present invention. Many organic compounds exist in optically active form, i.e., they have the ability to rotate the plane of plane polarized light. In describing optically active compounds, the prefix D, L or R, S is used to indicate the absolute configuration of the chiral center of the molecule. The prefixes d, l or (+), (-) are used to designate the sign of the rotation of plane polarized light of the compound, with (-) or l indicating that the compound is left-handed and the prefix (+) or d indicating that the compound is right-handed. The chemical structures of these stereoisomers are identical, but their stereo structures are different. A particular stereoisomer may be an enantiomer, and a mixture of isomers is commonly referred to as a mixture of enantiomers. 50: 50 is called a racemic mixture or racemate, which may result in no stereoselectivity or stereospecificity during the chemical reaction. The terms "racemic mixture" and "racemate" refer to a mixture of two enantiomers in equimolar amounts, lacking optical activity.

The term "tautomer" or "tautomeric form" means that isomers of structures of different energies may be interconverted through a low energy barrier. For example, proton tautomers (i.e., prototropic tautomers) include tautomers that move through protons, such as keto-enol and imine-enamine isomerizations. Valence (valence) tautomers include tautomers that recombine into bond electrons. Unless otherwise indicated, all tautomeric forms of the compounds of the invention are within the scope of the invention.

As used herein, "pharmaceutically acceptable salts" refer to organic and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as are: berge et al, descriptive acceptable salts in detail in J. pharmaceutical Sciences,66:1-19,1977. Pharmaceutically acceptable non-toxic acid salts include, but are not limited to, the hydrochloride salt of an inorganic acid formed by reaction with an amino groupHydrobromide, phosphate, sulphate, perchlorate, and organic acid salts such as acetate, oxalate, maleate, tartrate, citrate, succinate, malonate, or obtained by other methods described in the literature, such as ion exchange. Other pharmaceutically acceptable salts include adipates, malates, 2-hydroxypropionates, alginates, ascorbates, aspartates, benzenesulfonates, benzoates, bisulfates, borates, butyrates, camphorates, camphorsulfonates, cyclopentylpropionates, digluconates, dodecylsulfates, ethanesulfonates, formates, fumarates, glucoheptonates, glycerophosphates, gluconates, hemisulfates, heptanoates, hexanoates, hydroiodiates, 2-hydroxy-ethanesulfonates, lactobionates, lactates, laurylsulfates, malates, malonates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, palmitates, embonate, pectinates, persulfates, 3-phenylpropionates, alginates, salts of alginic acid, salts of citric acid, malic acid, salts of lactic acid, lauryl sulfate, malic acid, malonic acid, salts of lactic acid, salts of, Picrates, pivalates, propionates, stearates, thiocyanates, p-toluenesulfonates, undecanoates, pentanoates, and the like. Salts obtained with appropriate bases include alkali metals, alkaline earth metals, ammonium and N⁺(C_1-4Alkyl radical)₄A salt. The present invention also contemplates quaternary ammonium salts formed from compounds containing groups of N. Water-soluble or oil-soluble or dispersion products can be obtained by quaternization. Alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Pharmaceutically acceptable salts further include suitable, non-toxic ammonium, quaternary ammonium salts and amine cations resistant to formation of counterions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C_1-8Sulfonates and aromatic sulfonates.

"solvate" of the present invention refers to an association of one or more solvent molecules with a compound of the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, aminoethanol. The term "hydrate" refers to an association of solvent molecules that is water.

The term "protecting group" or "Pg" refers to a substituent that when reacted with another functional group, is typically used to block or protect a particular functionality. For example, "amino protecting group" refers to a substituent attached to an amino group to block or protect the functionality of the amino group in a compound, and suitable amino protecting groups include acetyl, trifluoroacetyl, t-Butoxycarbonyl (BOC), benzyloxycarbonyl (CBZ), and 9-fluorenylmethylenoxycarbonyl (Fmoc). Similarly, "hydroxyl protecting group" refers to the functionality of a substituent of a hydroxyl group to block or protect the hydroxyl group, and suitable protecting groups include acetyl and silyl groups. "carboxy protecting group" refers to the functionality of a substituent of a carboxy group to block or protect the carboxy group, and typical carboxy protecting groups include-CH₂CH₂SO₂Ph, cyanoethyl, 2- (trimethylsilyl) ethyl, 2- (trimethylsilyl) ethoxymethyl, 2- (p-toluenesulfonyl) ethyl, 2- (p-nitrobenzenesulfonyl) ethyl, 2- (diphenylphosphino) ethyl, nitroethyl, and the like. General descriptions of protecting groups can be found in the literature: greene, Protective Groups in Organic Synthesis, John Wiley&Sons,New York,1991；and P.J.Kocienski,Protecting Groups,Thieme,Stuttgart,2005。

Description of the Compounds of the invention

The compound and the pharmaceutically acceptable composition thereof can effectively inhibit HBV infection.

wherein each R is¹、R^1bAnd R^1aIndependently hydrogen, deuterium, F, Cl, Br, I, cyano, methyl, ethyl, methoxy, ethoxy, methylamino, ethylamino,Nitro, 4-trifluoromethylphenyl, 3, 5-bis (trifluoromethyl) phenyl or trifluoromethyl;

w is CH or N;

X¹is-C (═ O) -, -S (═ O)₂-or- (CR)⁵R⁶)_j-；

R^yis hydrogen, F, R^7bR^8bNC(＝O)-C_0-6Alkylene-, R^7bR^8bNC(＝O)-C_2-6Alkenylene-, R^11a-S(＝O)₂NR¹⁰-C_0-6Alkylene-or R^11a-S(＝O)₂NR¹⁰-C_2-6Alkenylene-wherein R is^7bR^8bNC(＝O)-C_0-6Of alkylene-C_0-6Alkylene-, R^7bR^8bNC(＝O)-C_2-6-C in alkenylene-_2-6Alkenylene-, R^11a-S(＝O)₂NR¹⁰-C_0-6Of alkylene-C_0-6Alkylene-and R^11a-S(＝O)₂NR¹⁰-C_2-6-C in alkenylene-_2-6Alkenylene-each independently being unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, C_1-6Alkyl, hydroxy C_1-6Alkyl and C_1-6Substituted with a substituent of haloalkyl;

m is 0, 1,2,3 or 4;

j is 1,2 or 3.

R³is phenyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the phenyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1,2,3,4 or 5 substituents selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, tert-butyl, hydroxyC, C, H, O, N_1-4Alkyl radical, C_1-4alkyl-OC (═ O) -, C_1-4alkyl-OC (═ O) -C_1-3Alkylene-, HOOC-C_1-3Alkylene-, C_1-4alkoxy-C_1-3Alkylene-and C_1-4alkyl-S (═ O)₂-is substituted with a substituent of (a).

In some embodiments, each R described herein⁴、R^4a、R^4bAnd R⁵Independently isHydrogen, deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(＝O)-、C_1-4alkyl-OC (═ O) -, hydroxy C_1-4Alkyl, methoxy, ethoxy, n-propoxy, isopropoxy, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

In some embodiments, R is as described herein^xIs hydrogen, R⁷R⁸NC(＝O)-、R^7aR^8aNC(＝O)-(CR⁵R⁶)-、R⁷R⁸NC(＝O)-(CH₂)₂-、R⁷R⁸NC(＝O)-(CH₂)₃-、R⁷R⁸NC(＝O)-CH＝CH-、R⁷R⁸NC(＝O)-CH＝CH-CH₂-、R¹¹-S(＝O)₂NR¹⁰-、R¹¹-S(＝O)₂NR¹⁰-CH₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH ═ CH-or R^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-, wherein said R⁷R⁸NC(＝O)-(CH₂)₂In- (CH)₂)₂-、R⁷R⁸NC(＝O)-(CH₂)₃In- (CH)₂)₃-、R⁷R⁸-CH-, R-of NC (O) -CH ═ CH —, R —⁷R⁸NC(＝O)-CH＝CH-CH₂-CH of (i-CH)₂-、R¹¹-S(＝O)₂NR¹⁰-CH₂-CH of (A-O-)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₂In- (CH)₂)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₃In- (CH)₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH-or R of-CH-^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-CH of (i-CH)₂Each independently unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-3Alkyl and C_1-3Substituted with a substituent of haloalkyl;

each R⁸Independently is deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butylAlkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

each R^8bIndependently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

In some embodiments, the invention providesEach R¹⁰Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

In another aspect, the present invention relates to compounds, or stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof, of one of the following, but in no way limited to these compounds:

In some embodiments, the pharmaceutical composition of the invention, wherein the other anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon, cladribine, emtricitabine, faplovir, interferon, calamine CP, intein, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, mevoxil, nitazoxanide, peginterferon alpha-2 a, ribavirin, roscovitine-a, cizolin, Euforavac, april, phosziphad, hepliav, interferon alpha-2 b, levamisole, or propafege.

In another aspect, the compounds of the present invention or the pharmaceutical compositions are used for the manufacture of a medicament for the prevention, treatment or alleviation of viral diseases in a patient.

In some embodiments, the compound of the present invention or the pharmaceutical composition is used, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

In still other embodiments, the use of the compound of the present invention or the pharmaceutical composition, wherein the disease caused by hepatitis b infection is liver cirrhosis or hepatocellular carcinoma.

In another aspect, the invention relates to a method of preventing, treating or ameliorating a viral disease in a patient, wherein the method comprises administering to the patient an effective amount of a compound or pharmaceutical composition of the invention that is pharmaceutically acceptable.

In some embodiments, the method of the invention, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

In still other embodiments, the method of the present invention, wherein the disease caused by hepatitis B infection is liver cirrhosis or hepatocellular carcinoma.

In another aspect, the invention relates to the use of the compound or the pharmaceutical composition for the manufacture of a medicament for preventing, treating or alleviating hepatitis b disease in a patient.

In some embodiments, the patient is a mammal, and in other embodiments, the patient is a human. In other embodiments, the use further comprises contacting the cell with an anti-HBV therapeutic agent.

Another aspect of the present invention relates to a method of treating HBV disease in a patient, comprising administering to a patient in need thereof a therapeutically effective amount of a compound of the present invention or a pharmaceutical composition thereof.

In still other embodiments, the method further comprises administering to a patient in need of treatment a therapeutically effective amount of an additional anti-HBV therapeutic agent.

Another aspect of the present invention relates to a method of inhibiting HBV infection in a patient, comprising administering to a patient in need thereof a therapeutically effective amount of a compound of the present invention or a pharmaceutical composition thereof. In still other embodiments, the method further comprises administering to the patient in need of treatment a therapeutically effective amount of an additional anti-HBV therapeutic agent.

The invention also relates to the application of the compound and the pharmaceutically acceptable salt thereof in producing medical products for effectively inhibiting HBV infection and the application of the compound in producing medicaments for effectively inhibiting HBV infection. The compounds of the invention are also useful in the manufacture of a medicament for alleviating, preventing, controlling or treating a condition of hepatitis b in a patient.

Unless otherwise indicated, all stereoisomers, geometric isomers, tautomers, nitrogen oxides, hydrates, solvates, metabolites, pharmaceutically acceptable salts and prodrugs of the compounds of the present invention are within the scope of the present invention.

In particular, the salts are pharmaceutically acceptable salts. The term "pharmaceutically acceptable" includes materials or compositions which must be compatible chemically or toxicologically, with the other components comprising the formulation, and with the mammal being treated.

Salts of the compounds of the present invention also include, but are not necessarily pharmaceutically acceptable salts of intermediates used in the preparation or purification of the compounds of formula (I) or (Ia) or isolated enantiomers of the compounds of formula (I) or (Ia).

If the compounds of the invention are basic, the desired salts may be prepared by any suitable method provided in the literature, for example, using inorganic acids such as hydrochloric, hydrobromic, sulfuric, nitric, and phosphoric acids, and the like. Or using organic acids such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, malic acid, 2-hydroxypropionic acid, citric acid, oxalic acid, glycolic acid, and salicylic acid; pyranonic acids, such as glucuronic acid and galacturonic acid; alpha-hydroxy acids such as citric acid and tartaric acid; amino acids such as aspartic acid and glutamic acid; aromatic acids such as benzoic acid and cinnamic acid; sulfonic acids such as p-toluenesulfonic acid, benzenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, trifluoromethanesulfonic acid, and the like, or combinations thereof.

If the compounds of the invention are acidic, the desired salts can be prepared by suitable methods, e.g., using inorganic or organic bases, such as amines (primary, secondary, tertiary), alkali metal hydroxides, ammonium, N⁺(R¹⁴)₄Salts and alkaline earth metal hydroxides, and the like. Suitable salts include, but are not limited toWithout limitation, organic salts derived from amino acids, such as glycine and arginine, amines, such as primary, secondary and tertiary amines, N⁺(R¹⁴)₄Salts, e.g. R¹⁴Is H, C_1-4Alkyl radical, C_6-10Aryl radical, C_6-10Aryl radical C_1-4Alkyl, etc., and cyclic amines such as piperidine, morpholine, piperazine, etc., and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Also included are suitable, non-toxic ammonium, quaternary ammonium salts and amine cations resistant to formation of counterions, e.g., halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C_1-8Sulfonates and aromatic sulfonates.

Pharmaceutical compositions, formulations, administration of the compounds of the invention and uses of the compounds and pharmaceutical compositions

According to another aspect, the pharmaceutical composition of the invention is characterized by comprising a compound of formula (I) or (Ia), a compound listed in the present invention, or a compound of the examples, and a pharmaceutically acceptable excipient. The compound in the pharmaceutical composition can effectively inhibit hepatitis B virus, and is suitable for treating diseases caused by virus, especially acute and chronic persistent HBV virus infection, wherein chronic viral diseases caused by HBV can cause serious pathological changes, and chronic hepatitis B virus infection can cause cirrhosis and/or hepatocellular carcinoma in many cases.

For the compounds of the invention, the areas of disease treatment that may be mentioned are, for example: treatment of acute and chronic viral infections, which may lead to infectious hepatitis, e.g., hepatitis B virus infection. The compounds of the invention are particularly suitable for the treatment of chronic hepatitis B infections and acute and chronic hepatitis B virus infections.

The invention encompasses pharmaceutical preparations which, in addition to nontoxic, inert, pharmaceutically suitable adjuvants, also contain one or more compounds of the formula (I) or (Ia) according to the invention or pharmaceutical compositions thereof or one or more active ingredients compounds of the formula (I) or (Ia) or pharmaceutical compositions according to the invention.

The above pharmaceutical preparations may also comprise other active pharmaceutical ingredients than the compounds of formula (I) or (Ia).

The compounds of the invention exist in free form or, where appropriate, as pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adduct or derivative that can be administered directly or indirectly in accordance with the needs of the patient, compounds described in other aspects of the invention, metabolites thereof, or residues thereof.

As described herein, the pharmaceutical composition of the present invention comprises any one of the compounds of formula (I) or (Ia) of the present invention, and further comprises pharmaceutically acceptable excipients, such as any solvent, solid excipient, diluent, binder, disintegrant, or other liquid excipient, dispersant, flavoring agent or suspending agent, surfactant, isotonic agent, thickening agent, emulsifier, preservative, solid binder or lubricant, and the like, as used herein, suitable for the particular intended dosage form. As described in the following documents: in Remington, The Science and Practice of Pharmacy,21st edition,2005, ed.D.B.Troy, Lippincott Williams & Wilkins, Philadelphia, and Endencyclopedia of Pharmaceutical Technology, eds.J.Swarbrick and J.C.Boylan,1988-1999, Marcel Dekker, New York, taken together with The contents of The references herein, indicate that different adjuvants can be used In The preparation of pharmaceutically acceptable compositions and their well-known methods of preparation. Except insofar as any conventional adjuvant is incompatible with the compounds of the invention, e.g., any adverse biological effect produced or interaction in a deleterious manner with any other component of a pharmaceutically acceptable composition, their use is contemplated by the present invention.

Substances that may serve as pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum albumin; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; partial glyceride mixtures of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silica; magnesium trisilicate; polyvinylpyrrolidone; polyacrylate esters; a wax; polyethylene-polyoxypropylene-blocking polymers; lanolin; sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gum powder; malt; gelatin; talc powder; adjuvants such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic salt; ringer's solution; ethanol; phosphoric acid buffer solution; and other non-toxic suitable lubricants such as sodium lauryl sulfate and magnesium stearate; a colorant; a release agent; coating the coating material; a sweetener; a flavoring agent; a fragrance; preservatives and antioxidants.

Pharmaceutical compositions of the compounds of the invention may be administered in any of the following ways: oral administration, inhalation spray, topical administration, rectal administration, nasal administration, topical administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or by means of a reservoir of external value. Preferred modes of administration are oral, intramuscular, intraperitoneal or intravenous.

The compounds of the present invention or pharmaceutical compositions thereof may be administered in unit dosage form. The administration dosage form can be liquid dosage form or solid dosage form. The liquid dosage forms can be true solutions, colloids, microparticles, and suspensions. Other dosage forms such as tablet, capsule, dripping pill, aerosol, pill, powder, solution, suspension, emulsion, granule, suppository, lyophilized powder for injection, clathrate, implant, patch, liniment, etc.

Oral tablets and capsules may contain excipients such as binding agents, for example syrup, acacia, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, such as lactose, sucrose, corn starch, calcium phosphate, sorbitol, glycine; lubricants, such as magnesium stearate, talc, polyethylene glycol, silica; disintegrants, such as potato starch; or acceptable humectants such as sodium lauryl sulfate. The tablets may be coated by methods known in the art of pharmacy.

Oral liquids may be in the form of suspensions of hydrated oils, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, sorbitol, cellulose methyl ether, glucose syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gelatin, hydrogenated edible fats and oils, emulsifying agents such as lecithin, sorbitan monooleate, gum arabic; or non-aqueous vehicles (which may include edible oils), such as almond oil, fats and oils such as glycerol, ethylene glycol, or ethanol; preservatives, e.g. methyl or propyl p-hydroxybenzoates, sorbic acid. Flavoring or coloring agents may be added if desired.

Suppositories may contain conventional suppository bases such as cocoa butter or other glycerides.

For parenteral administration, the liquid dosage form is usually prepared from the compound and a sterile excipient. The auxiliary material is preferably water. According to different selected adjuvants and drug concentrations, the compound can be dissolved in adjuvants or made into suspension solution, and can be dissolved in water for injection, filtered, sterilized and filled into sealed bottle or ampoule.

When applied topically to the skin, the compounds of the present invention may be formulated in the form of a suitable ointment, lotion, or cream in which the active ingredient is suspended or dissolved in one or more excipients which may be used in ointment formulations including, but not limited to: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; lotions and creams adjuvants that may be used include, but are not limited to: mineral oil, sorbitan monostearate, tween 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.

In general, it has proven advantageous, both in human medicine and in veterinary medicine, to administer the active compounds according to the invention in a total amount of from about 0.5 to 500mg, preferably from 1 to 100mg, per kg of body weight per 24 hours, if appropriate in divided single doses, in order to achieve the desired effect. The amount of active compound contained in a single dose is preferably about 1 to 80mg, more preferably 1 to 50mg per kg body weight, but may be varied from the above-mentioned dose, i.e., depending on the kind and body weight of the subject to be treated, the nature and severity of the disease, the type of preparation and the mode of administration of the drug, and the period or interval of administration.

The pharmaceutical composition provided by the invention also comprises an anti-HBV medicament. Wherein the anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator or an interferon.

The anti-HBV drugs include lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon interleukin, cladribine, emtricitabine, faprolivir, interferon, calamine CP, intefine, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, mevoxil, nitazoxanide, peginterferon alpha-2 a, ribavirin, rosmarin-A, xifurazol, Euforavac, azapril, Phosphazid, Heplivav, interferon alpha-2 b, levamisole or propafegermanium.

Another aspect of the present invention relates to the use of a compound or pharmaceutical composition of the present invention for the manufacture of a medicament for the prevention, treatment or amelioration of hepatitis B disease in a patient, which comprises administering to the patient a pharmaceutically acceptable effective amount. Hepatitis B disease refers to liver disease caused by hepatitis B virus infection or hepatitis B infection, including acute hepatitis, chronic hepatitis, liver cirrhosis and stem cell carcinoma. Acute hepatitis b virus infection may be asymptomatic or manifest as acute hepatitis symptoms. Patients with chronic viral infections have active disease and can develop cirrhosis and liver cancer.

The anti-HBV agent may be administered separately from a composition comprising a compound of the present invention as part of a multiple dosing regimen. Alternatively, those agents may be part of a single dosage form, mixed together with the compounds of the present invention to form a single composition. If administered as part of a multiple dosing regimen, the two active agents can be delivered to each other simultaneously, sequentially or over a period of time, to achieve the desired agent activity.

The amount of compound and pharmaceutical composition that can be combined with an adjuvant material to produce a single dosage form (those containing one pharmaceutical composition like that described herein) will vary depending on the indication and the particular mode of administration. Normally, the amount of the pharmaceutical composition of the invention will not exceed the amount of the composition normally administered containing as the only active agent. In another aspect, the amount of the presently disclosed pharmaceutical composition ranges from about 50% to 100% of the normal amount of the presently disclosed pharmaceutical composition, including the agent as the sole active therapeutic agent. In those compositions that are included, the compositions will act synergistically with the compounds of the present invention.

The compound of the invention shows stronger antiviral effect. The compounds have unexpected antiviral activity on HBV, and are suitable for treating various diseases caused by viruses, especially diseases caused by acute and chronic persistent HBV virus infection. Chronic viral diseases caused by HBV can lead to a variety of syndromes of varying severity, and chronic hepatitis b virus infection is known to cause cirrhosis and/or hepatocellular carcinoma.

Examples of indications that can be treated with the compounds of the invention are: acute and chronic viral infections that can lead to infectious hepatitis, such as hepatitis b virus infection. Particularly preferred are chronic hepatitis B infection and acute hepatitis B virus infection.

The invention also relates to the use of the compounds and pharmaceutical compositions of the invention for the preparation of medicaments for the treatment and prophylaxis of viral diseases, in particular hepatitis b.

General synthetic methods

In general, the compounds of the invention may be prepared by the methods described herein, wherein the substituents are as defined for formula (I) or (Ia), unless otherwise indicated. The following synthetic schemes and examples serve to further illustrate the context of the invention.

Those skilled in the art will recognize that: the chemical reactions described herein may be used to suitably prepare a number of other compounds of the invention, and other methods for preparing the compounds of the invention are considered to be within the scope of the invention. For example, the synthesis of those non-exemplified compounds according to the present invention can be successfully accomplished by those skilled in the art by modification, such as appropriate protection of interfering groups, by the use of other known reagents in addition to those described herein, or by some routine modification of reaction conditions. In addition, the reactions disclosed herein or known reaction conditions are also recognized as being applicable to the preparation of other compounds of the present invention.

The examples described below, unless otherwise indicated, all temperatures are in degrees Celsius (. degree. C.). Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, Arco Chemical Company and Alfa Chemical Company and were used without further purification unless otherwise indicated. General reagents were purchased from Shantou Wen Long chemical reagent factory, Guangdong Guanghua chemical reagent factory, Guangzhou chemical reagent factory, Tianjin HaoLiyu Chemicals Co., Ltd, Qingdao Tenglong chemical reagent Co., Ltd, and Qingdao Kaseiki chemical plant.

The column used silica gel column, silica gel (200-300 mesh) purchased from Qingdao oceanic plant. Nuclear magnetic resonance spectroscopy with CDC1₃,DMSO-d₆,CD₃OD or acetone-d₆As solvent (reported in ppm) TMS (0ppm) or chloroform (7.25ppm) was used as reference standard. When multiple peaks occur, the following abbreviations will be used: s (singleton), d (doublet), t (triplet ), m (multiplet, multiplet), br (broad ), dd (doublet of doublets), dt (doublet of triplets, double triplet), br. Coupling constant J, in Hertz (Hz).

Low resolution Mass Spectral (MS) data were measured by an Agilent 6320 series LC-MS spectrometer equipped with a G1312A binary pump and a G1316A TCC (column temperature maintained at 30 ℃), a G1329A autosampler and a G1315B DAD detector were used for analysis, and an ESI source was used for the LC-MS spectrometer.

Low resolution Mass Spectral (MS) data were also determined by Agilent6120 series LC-MS spectrometer equipped with a G1311A quaternary pump and a G1316A TCC (column temperature maintained at 30 ℃), a G1329A autosampler and a G1315D DAD detector applied for analysis, and an ESI source applied to the LC-MS spectrometer.

Both spectrometers were equipped with an Agilent Zorbax SB-C18 column, 2.1X 30mm, 5 μm. The injection volume is determined by the sample concentration; the flow rate is 0.6 mL/min; peaks of HPLC were recorded by UV-Vis wavelength at 210nm and 254 nm. The mobile phases were 0.1% formic acid in acetonitrile (phase a) and 0.1% formic acid in ultrapure water (phase B). Gradient elution conditions are shown in table 1: table 1: gradient elution conditions

Time (min)	A(CH₃CN，0.1％HCOOH)	B(H₂O，0.1％HCOOH)
			0-3	5-100	95-0
3-6	100	0
			6-6.1	100-5	0-95
6.1-8	5	95

Compound purification was assessed by Agilent 1100 series High Performance Liquid Chromatography (HPLC) with UV detection at 210nm and 254nm, a Zorbax SB-C18 column, 2.1X 30mm, 4 μm, 10min, flow rate 0.6mL/min, 5-95% (0.1% formic acid in acetonitrile) in (0.1% formic acid in water), the column temperature was maintained at 40 ℃.

The following acronyms are used throughout the invention:

synthesis method

The following synthetic schemes set forth the experimental procedures for preparing the compounds disclosed in the present invention. Wherein each R is¹、R²、R³、R^1a、R^1b、R¹¹、R⁴、R^4a、R^b、R⁹、R^x、R^y、X¹M and n have the meanings as described in the invention.

Synthesis scheme 1

Compounds (a-8) can be prepared by the methods described in FIG. 1. Firstly, reacting a compound (a-1) with a compound (a-2) under basic conditions (such as DIPEA and the like) and a suitable solvent (such as DCM and the like) to obtain a compound (a-3); then, the compound (a-3) is reacted with the compound (a-4) under basic conditions (e.g., cesium carbonate, etc.), a catalyst (e.g., palladium acetate, etc.), a ligand (e.g., X-PHOS, t-BuX-PHOS, etc.), and a suitable solvent (e.g., 1, 4-dioxane, etc.) to produce a compound (a-5); then, the Boc protecting group of the compound (a-5) is removed to obtain a compound (a-6); finally, compound (a-6) or a salt thereof is reacted with compound (a-7) (compound (a-7) can be prepared by referring to synthesis scheme 1 in WO2015074546 and the specific example method therein) under basic conditions (e.g., potassium carbonate, etc.) and a suitable solvent (e.g., ethanol, etc.) to give compound (a-8).

Synthesis scheme 2

Compound (b-7) can be prepared by the method described in FIG. 2. Wherein R is^aIs methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, cyclobutyl, cyclopentyl, cyclohexyl or hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group. First, compound (b-1) is reacted with compound (a-4) under basic conditions (e.g., cesium carbonate, etc.), a catalyst (e.g., palladium acetate, etc.), a ligand (e.g., X-PHOS, t-BuX-PHOS, etc.), and a suitable solvent (e.g., 1, 4-dioxane, etc.) to produce compound (b-2); then, the compound (b-2) undergoes ester hydrolysis reaction under alkaline conditions (such as lithium hydroxide aqueous solution and the like) to generate a compound (b-3); then, the compound (b-3) and the compound (b-4) undergo a condensation reaction under basic conditions (such as DIPEA and the like) and under the conditions of a condensing agent (such as HATU and the like) to obtain a compound (b-5); then, the Boc protecting group of the compound (b-5) is removed to obtain a compound (b-6); finally, the compound (b-6) is reacted with the compound (a-7) or a salt thereof in a suitable solvent (e.g., ethanol, etc.) under basic conditions (e.g., potassium carbonate, etc.) to obtain the compound (b-7).

Synthesis scheme 3

Compound (2a) can be prepared by the method described in synthetic scheme 3, and compound (a-7) is reacted with compound (1a) under basic conditions (e.g., potassium carbonate, etc.) and in a suitable solvent (e.g., ethanol, etc.) to give compound (2 a).

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Preparation examples

In the following preparation examples, the inventors described in detail the preparation of the compounds of the present invention by taking some of the compounds of the present invention as examples.

Synthesis of fragment F1

Synthetic route to fragment F1:

synthesis of F1-1:

f1-0(600mg,3.00mmol), DCM (10mL) and DIPEA (1.1mL,6.1mmol) were added to the reaction flask, and methanesulfonyl chloride (0.30mL,3.9mmol) was added under ice bath. The reaction mixture was reacted at room temperature for 12h, followed by addition of dichloromethane (20mL) for dilution, the organic layer was washed with water (20mL × 1), 1M dilute hydrochloric acid (20mL × 1) and saturated brine (20mL × 2) in this order, dried over anhydrous sodium sulfate, and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 2/1) to give the title compound as a white solid (672mg, 81%). MS (ESI, neg. ion) M/z 276.0[ M-H [ ]]^-。

Synthesis of F1-2:

f1-1(511mg,1.84mmol), (R) -3-oxohexahydroimidazo [1,5-a ] was added to the reaction flask]Pyrazine-7 (1H) -carboxylic acid tert-butyl ester (400mg,1.66mmol), X-PHOS (80mg,0.16mmol), palladium acetate (21mg,0.09mmol), cesium carbonate (1.08g,3.31mmol), and 1, 4-dioxane (6 mL). The reaction mixture was reacted at 90 ℃ for 4h under nitrogen. The temperature was reduced to room temperature, filtration was performed, the filtrate was concentrated under reduced pressure, and the resulting residue was separated by silica gel column chromatography (PE/EA (V/V) ═ 1/1 to EA) to give the title compound as an off-white solid (645mg, 88.73%). MS (ESI, pos. ion) m/z: 383.1[ M + H-56 ]]⁺。

Synthesis of F1:

f1-2(301mg,0.69mmol), dichloromethane (6mL) and TFA (2mL) were added to the reaction flask. The reaction mixture was reacted at room temperature for 1h, then concentrated under reduced pressure to give the title compound as a brown oil (309mg, 99.5%) which was directly used in the next step without purification.

Synthesis of fragment F2

Synthetic route to fragment F2:

synthesis of F2:

the methyl sulfonyl chloride in the synthesis method of F1 was replaced by cyclopropyl sulfonyl chloride, and the rest of the operation was performed according to the synthesis method of F1 to obtain a brown oil F2. MS (ESI, pos.ion) M/z 365.2[ M + H ]]⁺。

Synthesis of fragment F3:

synthetic route to fragment F3:

synthesis of F3:

the title compound was obtained as a brown oil by substituting F3-0 and cyclopropanesulfonyl chloride for F1-0 and methylsulfonyl chloride, respectively, in the synthesis of F1 and the remaining operations were referenced to the synthesis of F1. MS (ESI, pos.ion) M/z 351.3[ M + H ]]⁺。

Synthesis of fragment F4

Synthetic route to fragment F4:

synthesis of F4-1:

reacting (R) -3-oxohexahydroimidazo [1,5-a ]]Pyrazine-7 (1H) -carboxylic acid tert-butyl ester (3g,12.43mmol), F4-0(3.42g,14.92mmol), palladium acetate (0.14g,0.62mmol), t-BuXPhos (0.53g,0.24mmol) and cesium carbonate (6.08g,18.65mmol) were added to 1, 4-dioxane (50mL) and the reaction stirred at 100 ℃ for 12H under nitrogen. The celite was filtered off with suction and the filter cake was rinsed with dichloromethane (200 mL). The filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 3/1) to give the title compound as a white solid (3.03g, 63%). MS (ESI, pos.ion) M/z 334.2[ M + H-56 ]]⁺。

Synthesis of F4-2:

f4-1(3.03g,7.78mmol) was dissolved in a mixed solvent of methanol (15mL) and tetrahydrofuran (15mL), followed by additionLithium hydroxide monohydrate (1g,23.3mmol) and water (1 mL). The reaction mixture was reacted at 60 ℃ for 1h, then concentrated under reduced pressure, and the resulting residue was diluted with water (100mL), then adjusted to pH 4-5 with 1M hydrochloric acid, followed by extraction with ethyl acetate (70 mL. times.3), the combined organic layers were washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound as a white solid (2.7g, 92%). MS (ESI, pos. ion) m/z: 398.3[ M + Na ]]⁺。

Synthesis of F4-3:

f4-2(2.7g,7.2mmol), DCM (50mL) and DIPEA (1.86g,14.4mmol) were added to the dry reaction flask in sequence, and after stirring well, HATU (2.74g,7.2mmol) and methylamine hydrochloride (0.97g,14.4mmol) were added. The reaction mixture was stirred at room temperature for 12h, diluted with water (50mL), adjusted to pH 5-6 with 2M hydrochloric acid with stirring, the organic layer was washed with brine (50mL × 2), dried over anhydrous sodium sulfate, filtered, the filtrate was evaporated under reduced pressure to remove the solvent, and the crude product was purified by silica gel column chromatography (PE/EA (V/V) ═ 2/1) to give the title compound as a white solid (1.57g, 56%). MS (ESI, pos.ion) M/z 333.4[ M + H-56 ]]⁺。

Synthesis of F4:

f4-3(1.57g,4mmol) and DCM (10mL) were added to the dry reaction flask in sequence, and after stirring well at room temperature, TFA (10mL) was added. The reaction mixture was stirred at room temperature for 4h, then the solvent was evaporated under reduced pressure to give the title compound as a brown oil (1.61g, 100%).

Synthesis of fragment F5

Synthetic route to fragment F5:

f5-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F6

Synthetic route to F6:

substitution of F6-0 for F4-0 in the Synthesis of F4 and the remaining manipulations were made with reference to the Synthesis of F4 to give the title compound as a brown oil.

Synthesis of F7

Synthetic route to F7:

synthesis of F7-1:

f6-2(3.50g,9.0mmol), DMF (28mL), HATU (4.1g,11mmol) and DIPEA (3.1mL,18mmol) were added to the reaction flask, and after stirring well, dibenzylamine (2.1mL,11mmol) was added. The reaction mixture was stirred at 25 ℃ for 7h, then water (100mL) and ethyl acetate (200mL) were added, and the organic layer was washed with water (100 mL. times.2) and dried over anhydrous sodium sulfate. The organic layer was concentrated under reduced pressure and the crude product was purified by silica gel column chromatography (PE/EA (V/V) ═ 4/1) to give the title compound as a white solid (3.5g, 68%). MS (ESI, pos.ion) M/z 513.4[ M + H-56 ]]⁺。

Synthesis of F7-2:

adding F7-1(2.0g,3.5mmol) and tetrahydrofuran (40mL) into a reaction bottle, cooling to-15 ℃, dropwise adding a borane tetrahydrofuran solution (8mL,8.8mmol,1mol/L), after dropwise adding, heating to 55 ℃, stirring for reacting for 16h, cooling to room temperature, slowly adding MeOH (10mL), quenching the reaction, and then heating and refluxing to be clear. The solvent was distilled off under reduced pressure. To the residue was added ethyl acetate (200mL) to dilute, and the organic layer was washed successively with a 1% aqueous solution of sodium hydroxide (20mL) and saturated brine (20mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 5/1) to give the title compound as a colorless oil (1.2g, 62%). MS (ESI, pos.ion) m/z: 555.4[ M + H]⁺。

Synthesis of F7-3:

f7-2(1.2g,2.2mmol), ethyl acetate (20mL) and palladium on carbon (0.4g, 10%) were added to the reaction flask. Reacting at 55 deg.C for 48h under hydrogen atmosphere, filtering, concentrating the solvent, and separating the residue by silica gel column chromatography (DCM/CH)₃OH (V/V) ═ 30/1) purificationTo give the title compound as a white solid (0.3g, 40%). MS (ESI, pos. ion) M/z 375.2[ M + H ]]⁺。

Synthesis of F7-4:

f7-3(0.25g,0.67mmol), dichloromethane (10mL) and triethylamine (0.19mL,1.4mmol) were added to the reaction flask, and methanesulfonyl chloride (0.06mL,0.8mmol) was added with stirring. The reaction mixture was reacted at 25 ℃ for 1h, then concentrated under reduced pressure, and the resulting residue was chromatographed on silica gel (DCM/CH)₃OH (V/V) ═ 30/1) to give the title compound as a white solid (0.30g, 99%). MS (ESI, pos.ion) M/z 453.2[ M + H ]]⁺。

Synthesis of F7:

f7-4(250mg,0.55mmol), dichloromethane (2mL), trifluoroacetic acid (2mL) was added to the reaction flask, reacted at 25 ℃ for 0.5h, and the solvent was concentrated to give a brown oil (0.23g, 100%). MS (ESI, pos.ion) M/z 353.2[ M + H ]]⁺。

Synthesis of F8

Synthetic route to F8:

f8-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F9

Synthetic route to F9:

f9-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F10

Synthetic route to F10:

f10-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F11

Synthetic route to F11:

f11-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F12

Synthetic route to F12:

f12-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F13

Synthetic route to F13:

f13-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F14

Synthetic route to F14:

f14-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F15

Synthetic route to F15:

f15-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F16

Synthetic route to F16:

f16-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F17

Synthetic route to F17:

f17-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of F18

Synthetic route to F18:

f18-0 was used in place of F4-0 in the synthesis of F4, and the rest of the procedure was performed according to the synthesis of F4 to give a brown oil.

Synthesis of Compound (A)

Synthetic route for compound (a):

to a dry reaction flask were added F1(309mg,0.68mmol), (R) -6- (bromomethyl) -4- (2-chloro-4-fluorophenyl) -2- (thiazol-2-yl) -1, 4-dihydropyrimidine-5-carboxylic acid methyl ester (275mg,0.62mmol), anhydrous ethanol (10mL) and potassium carbonate (455mg,3.13 mmol). The reaction mixture was reacted at room temperature for 5 hours, followed by addition of ethyl acetate (40mL) and water (30mL) for extraction, washing of the organic phase with saturated brine (30 mL. times.2), drying over anhydrous sodium sulfate, concentration under reduced pressure, and separation of the resulting residue by silica gel column chromatography (DCM/M)eOH (V/V) ═ 50/1) to give the title compound as a yellow solid (321mg, 73.9%). MS (ESI, pos. ion) M/z 702.0[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.64(s,1H),7.87(d,J＝3.1Hz,1H),7.51(d,J＝8.5Hz,2H),7.48(d,J＝3.1Hz,1H),7.30(dd,J＝7.9,5.4Hz,1H),7.19(d,J＝8.5Hz,2H),7.15(dd,J＝8.6,2.5Hz,1H),6.94(td,J＝8.3,2.5Hz,1H),6.22(s,1H),4.41(t,J＝6.1Hz,1H),4.13(d,J＝17.3Hz,1H),4.07(dd,J＝17.6,4.5Hz,1H),4.01(dd,J＝14.3,4.1Hz,1H),3.95–3.86(m,2H),3.61(s,3H),3.47–3.35(m,3H),3.27(td,J＝13.0,3.2Hz,1H),2.92–2.87(m,2H),2.86(s,3H),2.86–2.83(m,1H),2.52(td,J＝11.5,3.2Hz,1H),2.28(t,J＝10.8Hz,1H)。

Example 1

Synthetic route to compound 1:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F2 in the synthesis of compound (A), to give compound 1 as a yellow solid (36.3%). MS (ESI, pos. ion) m/z: 728.3[ M + H]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.64(s,1H),7.87(d,J＝3.1Hz,1H),7.51(d,J＝8.5Hz,2H),7.48(d,J＝3.1Hz,1H),7.30(dd,J＝8.0,5.5Hz,1H),7.20(d,J＝8.5Hz,2H),7.15(dd,J＝8.6,2.5Hz,1H),6.94(td,J＝8.3,2.5Hz,1H),6.22(s,1H),4.31(t,J＝6.1Hz,1H),4.14(d,J＝17.3Hz,1H),4.10–4.04(m,1H),4.04–3.97(m,1H),3.95–3.86(m,2H),3.61(s,3H),3.47–3.37(m,1H),3.33–3.22(m,1H),2.94–2.80(m,4H),2.53(dt,J＝11.6,5.8Hz,1H),2.40–2.21(m,2H),1.74(s,1H),1.20–1.11(m,2H),1.01–0.92(m,2H)。

Example 2

Synthetic route to Compound 2

Replacing F1 in the synthesis method of the compound (A) with F3, and performing the rest operations according to the synthesis operation method of the compound (A) to obtain a compound 2 which is yellowA colored solid (33.2%). MS (ESI, pos. ion) m/z: 714.3[ M + H]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.63(s,1H),7.87(d,J＝3.1Hz,1H),7.55(d,J＝8.6Hz,2H),7.48(d,J＝3.1Hz,1H),7.34(d,J＝8.6Hz,2H),7.30(dd,J＝7.7,5.2Hz,1H),7.15(dd,J＝8.6,2.5Hz,1H),6.94(td,J＝8.3,2.5Hz,1H),6.22(s,1H),4.81(t,J＝6.0Hz,1H),4.31(d,J＝6.1Hz,1H),4.17–4.10(m,1H),4.10–4.04(m,1H),4.04–3.97(m,1H),3.96–3.86(m,2H),3.61(s,3H),3.44(dd,J＝9.0,4.7Hz,1H),3.27(td,J＝13.0,3.1Hz,1H),2.90(d,J＝10.7Hz,2H),2.52(dt,J＝11.6,5.8Hz,1H),2.38–2.30(m,1H),2.27(t,J＝11.1Hz,1H),1.74(s,1H),1.19–1.12(m,2H),0.97–0.89(m,2H)。

Example 3

Synthetic route for compound 3:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F18 in the synthesis of compound (A), to give compound 3 as a yellow solid (296mg, 64%). MS (ESI, pos. ion) M/z 684.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.62(s,1H),7.87(d,J＝3.1Hz,1H),7.50(dd,J＝15.3,2.5Hz,2H),7.33–7.28(m,1H),7.17(t,J＝8.2Hz,2H),7.06(dd,J＝8.4,1.9Hz,1H),6.94(td,J＝8.3,2.5Hz,1H),6.22(s,1H),5.46(s,1H),4.14(d,J＝17.2Hz,1H),4.10–3.97(m,2H),3.94–3.84(m,2H),3.61(s,3H),3.40(dd,J＝9.1,4.7Hz,1H),3.33–3.22(m,1H),2.96(t,J＝7.6Hz,2H),2.90(d,J＝11.0Hz,2H),2.78(d,J＝4.8Hz,3H),2.55–2.49(m,1H),2.46(t,J＝7.6Hz,2H),2.25(t,J＝10.8Hz,1H).

Example 4

Synthetic route for compound 4:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F5 in the synthesis of compound (A), to give compound 4 as a yellow solid (39.5%). MS (ESI, pos).ion)m/z:638.0[M+H]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.61(s,1H),7.86(d,J＝3.1Hz,1H),7.77(d,J＝8.7Hz,2H),7.60(d,J＝8.8Hz,2H),7.47(d,J＝3.0Hz,1H),7.29(dd,J＝6.8,4.4Hz,1H),7.14(dd,J＝8.5,2.4Hz,1H),6.93(td,J＝8.3,2.4Hz,1H),6.41(d,J＝4.6Hz,1H),6.21(s,1H),4.18–4.10(m,1H),4.09–4.00(m,2H),3.98–3.86(m,2H),3.60(s,3H),3.46(dd,J＝9.1,4.7Hz,1H),3.27(t,J＝11.0Hz,1H),3.00(d,J＝4.7Hz,3H),2.91(d,J＝10.6Hz,2H),2.54–2.45(m,1H),2.26(t,J＝10.7Hz,1H).

Example 5

Synthetic route to compound 5:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F6 in the synthesis of compound (A), to give compound 5 as a yellow solid (0.58g, 57%). MS (ESI, pos.ion) M/z 666.3[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.63(s,1H),7.85(d,J＝2.9Hz,1H),7.45(dd,J＝11.9,5.6Hz,3H),7.29(t,J＝7.3Hz,1H),7.14(d,J＝8.1Hz,3H),6.93(dd,J＝11.2,5.1Hz,1H),6.21(s,1H),5.81(d,J＝3.4Hz,1H),4.06(ddd,J＝35.3,17.9,8.2Hz,4H),3.92–3.84(m,2H),3.60(s,3H),3.40(dd,J＝8.9,4.4Hz,1H),3.25(t,J＝11.1Hz,1H),2.95–2.83(m,4H),2.74(d,J＝4.6Hz,3H),2.43(t,J＝7.7Hz,2H),2.24(t,J＝10.7Hz,1H)。

Example 6

Synthetic route to compound 6:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F8 in the synthesis of compound (A), to give compound 6 as a yellow solid (120mg, 39%). MS (ESI, pos.ion) M/z 680.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.62(s,1H),7.87(d,J＝3.1Hz,1H),7.54(d,J＝8.8Hz,2H),7.49(d,J＝3.1Hz,1H),7.36(d,J＝8.8Hz,2H),7.32–7.29(m,1H),7.16(dd,J＝8.6,2.6Hz,1H),6.94(td,J＝8.3,2.6Hz,1H),6.22(s,1H),5.20(s,1H),4.15(d,J＝17.2Hz,1H),4.11–4.05(m,1H),4.05–3.99(m,1H),3.96–3.86(m,2H),3.61(s,3H),3.45(dd,J＝9.1,4.6Hz,1H),3.29(td,J＝13.1,3.3Hz,1H),2.91(d,J＝10.4Hz,2H),2.72(d,J＝4.8Hz,3H),2.52(td,J＝11.6,3.2Hz,1H),2.28(t,J＝10.8Hz,1H),1.58(s,6H).

Example 7

Synthetic route to compound 7:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F9 in the synthesis of compound (A), to give compound 7 as a yellow solid (200mg, 67%). MS (ESI, pos. ion) M/z 664.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.62(s,1H),7.87(d,J＝3.1Hz,1H),7.61–7.53(m,3H),7.51–7.44(m,3H),7.32–7.28(m,1H),7.15(dd,J＝8.5,2.5Hz,1H),6.93(td,J＝8.3,2.5Hz,1H),6.33(d,J＝15.6Hz,1H),6.22(s,1H),5.89(d,J＝4.6Hz,1H),4.14(d,J＝17.3Hz,1H),4.10–4.04(m,1H),4.04–3.97(m,1H),3.95–3.86(m,2H),3.61(s,3H),3.44(dd,J＝9.1,4.7Hz,1H),3.27(td,J＝13.0,2.9Hz,1H),2.94(d,J＝4.8Hz,3H),2.90(d,J＝10.7Hz,2H),2.51(td,J＝11.4,2.8Hz,1H),2.25(t,J＝10.7Hz,1H).

Example 8

Synthetic route to compound 8:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F10 in the synthesis of compound (A), to give compound 8 as a yellow solid (180mg, 61%). MS (ESI, pos.ion) M/z 652.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.62(s,1H),7.87(d,J＝3.1Hz,1H),7.53(s,1H),7.48(d,J＝3.1Hz,1H),7.45(d,J＝8.3Hz,1H),7.36–7.29(m,2H),7.16(dd,J＝8.6,2.5Hz,1H),6.98–6.88(m,2H),6.22(s,1H),5.51(d,J＝3.3Hz,1H),4.14(d,J＝17.3Hz,1H),4.07(dd,J＝13.5,2.1Hz,1H),4.04–3.98(m,1H),3.96–3.86(m,2H),3.62(s,3H),3.58(s,2H),3.45(dd,J＝9.0,4.6Hz,1H),3.28(td,J＝12.8,3.1Hz,1H),2.90(d,J＝10.3Hz,2H),2.77(d,J＝4.8Hz,3H),2.52(td,J＝11.6,3.2Hz,1H),2.27(t,J＝10.7Hz,1H).

Example 9

Synthetic route to compound 9:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F11 in the synthesis of compound (A), to give compound 9 as a yellow solid (100mg, 41%). MS (ESI, pos. ion) M/z 666.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.64(s,1H),7.87(d,J＝3.0Hz,1H),7.54–7.45(m,2H),7.34–7.29(m,2H),7.25(d,J＝8.0Hz,1H),7.16(dd,J＝8.6,2.5Hz,1H),6.97–6.88(m,2H),6.22(s,1H),5.51(s,1H),4.13(d,J＝17.3Hz,1H),4.07(dd,J＝13.7,2.0Hz,1H),4.04–3.97(m,1H),3.95–3.86(m,2H),3.62(s,3H),3.43(dd,J＝9.1,4.5Hz,1H),3.28(td,J＝12.9,3.1Hz,1H),2.98(t,J＝7.6Hz,2H),2.93–2.84(m,2H),2.77(d,J＝4.8Hz,3H),2.53–2.45(m,3H),2.27(t,J＝10.7Hz,1H).

Example 10

Synthetic route to compound 10:

compound 10 was obtained as a yellow solid (240mg, 80%) by following the synthetic procedure for Compound (A) except that F1 in the synthetic procedure for Compound (A) was replaced with F12. MS (ESI, pos. ion) M/z 678.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.63(s,1H),7.87(d,J＝3.1Hz,1H),7.60–7.53(m,2H),7.48(d,J＝3.1Hz,1H),7.45(d,J＝8.8Hz,2H),7.33–7.29(m,1H),7.16(dd,J＝8.6,2.5Hz,1H),6.94(td,J＝8.3,2.6Hz,1H),6.23(s,1H),6.02(s,1H),5.62(d,J＝4.8Hz,1H),4.16(d,J＝7.1Hz,1H),4.13(d,J＝2.9Hz,1H),4.11–4.05(m,1H),4.04–3.99(m,1H),3.97–3.86(m,2H),3.63(d,J＝10.5Hz,3H),3.45(dd,J＝9.0,4.5Hz,1H),3.28(td,J＝12.9,3.0Hz,1H),2.91(d,J＝4.8Hz,3H),2.89(s,1H),2.57(s,3H),2.55–2.48(m,1H),2.27(t,J＝10.8Hz,1H).

Example 11

Synthetic route to compound 11:

compound 11 was obtained as a yellow solid (320mg, 80%) by following the synthetic procedure for Compound (A) except that F1 in the synthetic procedure for Compound (A) was replaced with F13. MS (ESI, pos. ion) M/z 678.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):7.92(d,J＝3.0Hz,1H),7.67–7.58(m,2H),7.46(d,J＝8.2Hz,1H),7.41–7.31(m,2H),7.21–7.13(m,2H),7.02(td,J＝8.5,2.4Hz,1H),6.19(s,1H),5.51(d,J＝4.6Hz,1H),4.83(d,J＝14.6Hz,1H),4.62–4.46(m,2H),4.20(dd,J＝14.7,2.9Hz,1H),4.07(t,J＝9.0Hz,1H),3.84(t,J＝11.9Hz,2H),3.74–3.66(m,1H),3.64(s,3H),3.55(dd,J＝9.6,2.9Hz,1H),3.14–2.96(m,2H),2.74(d,J＝4.5Hz,3H),1.68–1.60(m,2H),1.12–1.04(m,2H).

Example 12

Synthetic route to compound 12:

compound 12 was obtained as a yellow solid (230mg, 75%) by following the synthetic procedure for Compound (A) except that F1 in the synthetic procedure for Compound (A) was replaced with F14. MS (ESI, pos. ion) M/z 678.2[ M + H ]]⁺；¹H NMR(400MHz,CD₃OD)(ppm):7.98(d,J＝3.0Hz,1H),7.80(d,J＝2.8Hz,1H),7.57(d,J＝8.6Hz,2H),7.52–7.45(m,1H),7.37(d,J＝8.6Hz,2H),7.24(dd,J＝8.7,2.4Hz,1H),7.08(td,J＝8.4,2.4Hz,1H),6.19(s,1H),4.39–4.25(m,1H),4.19–4.08(m,2H),4.07–3.98(m,2H),3.62(s,3H),3.61–3.56(m,1H),3.39–3.17(m,5H),2.66(s,3H),1.52–1.45(m,2H),1.07–1.01(m,2H).

Example 13

Synthetic route to compound 13:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F15 in the synthesis of compound (A), to give compound 13 as a yellow solid (98mg, 30%). MS (ESI, pos. ion) M/z 666.2[ M + H ]]⁺；¹H NMR(600MHz,CD₃OD)(ppm):7.97(d,J＝3.0Hz,1H),7.76(d,J＝3.0Hz,1H),7.53(s,1H),7.48–7.41(m,2H),7.28(t,J＝7.9Hz,1H),7.24(dd,J＝8.7,2.4Hz,1H),7.09–7.02(m,2H),6.18(s,1H),4.17–4.11(m,1H),4.07–4.01(m,1H),4.01–3.92(m,3H),3.66–3.58(m,4H),3.57–3.50(m,1H),3.27(t,J＝11.1Hz,1H),2.99(d,J＝9.5Hz,2H),2.70(s,3H),2.46(t,J＝11.1Hz,1H),2.25(t,J＝10.6Hz,1H),1.46(d,J＝7.1Hz,3H).

Example 14

Synthetic route to compound 14:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F16 in the synthesis of compound (A), to give compound 14 as a yellow solid (0.42g, 28%). MS (ESI, pos. ion) M/z 678.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):7.88(d,J＝3.1Hz,1H),7.58(d,J＝8.7Hz,2H),7.50(d,J＝3.1Hz,1H),7.35(d,J＝8.8Hz,2H),7.33–7.29(m,2H),7.16(dd,J＝8.5,2.5Hz,1H),6.96(td,J＝8.4,2.5Hz,1H),6.21(s,1H),5.95(d,J＝4.4Hz,1H),4.30(d,J＝26.8Hz,2H),4.09(t,J＝16.4Hz,2H),3.98(t,J＝9.0Hz,1H),3.63(s,3H),3.47(dd,J＝9.4,4.1Hz,2H),3.18(s,2H),2.96(d,J＝4.8Hz,3H),2.70(s,1H),2.55(s,2H),2.13(d,J＝1.1Hz,3H).

Example 15

Synthetic route to compound 15:

the procedure for the synthesis of compound (A) was followed except that F1 was replaced with F17 in the synthesis of compound (A), to give compound 15 as a yellow solid (487mg, 80%). MS (ESI, pos. ion) M/z 656.2[ M + H ]]⁺；¹H NMR(400MHz,CDCl₃)(ppm):9.59(s,1H),8.10(t,J＝9.0Hz,1H),7.86(d,J＝3.1Hz,1H),7.81(dd,J＝15.6,1.9Hz,1H),7.49(d,J＝3.1Hz,1H),7.32–7.28(m,1H),7.16(dd,J＝8.6,2.5Hz,1H),7.09(dd,J＝8.8,2.1Hz,1H),6.94(td,J＝8.4,2.5Hz,1H),6.74(dd,J＝13.5,4.6Hz,1H),6.22(s,1H),4.16(d,J＝17.2Hz,1H),4.11–4.01(m,2H),3.94(dd,J＝19.1,13.1Hz,2H),3.61(s,3H),3.46(dd,J＝9.2,4.8Hz,1H),3.30(td,J＝13.0,3.2Hz,1H),3.04(d,J＝4.3Hz,3H),2.93(d,J＝10.9Hz,2H),2.52(td,J＝11.6,3.2Hz,1H),2.26(t,J＝10.8Hz,1H).

Biological assay

Test 1: anti-HBV EC₅₀Test method

HBV cell lines and culture conditions

HepG2.2.15 cells (SELLS, PNAS,1987 and SELLS, JV,1988) have the entire HBV genome integrated into their chromosomes and stably express viral RNA and viral proteins. HepG2.2.15 cells secrete mature hepatitis B virus particles, HBsAg and HBeAg into the culture medium. HepG2.2.15 was cultured in DMEM medium containing 10% fetal bovine serum, 100U/mL penicillin, 100U/mL streptomycin, 1% non-essential amino acids, 1mM sodium pyruvate 300. mu.g/mL G418.

Virion DNA secreted by hepg2.2.15 cells can be quantified by qPCR methods and the effect of compounds on viral replication can be detected therefrom.

In vitro anti-HBV Activity assay

HepG2.2.15 cells 8,000 cells per well were plated in 96-well cell culture plates at 37 ℃ with 5% CO₂Culturing for 3 days until the cells grow to full pores. On test day 0, old media was discarded and 200 μ L of fresh assay media (5% FBS) was added.

Compound formulation and cell treatment in antiviral experiments: compounds were dissolved to 30mM in DMSO, further compounds were diluted to 800 μ M in DMSO, then 4-fold dilutions of 8 dilutions were made, with a maximum concentration of 800 μ M. Add 1. mu.L of serially diluted compound per well to the above cell plate, with the highest final concentration tested being 4. mu.M (200-fold dilution). TDF (tenofovir disoproxil fumarate, Selleck, Cat S1400) was used as a positive control compound at a maximum concentration of 4. mu.M. Negative control wells were loaded with 1 μ LDMSO to a final concentration of 0.5% and positive control wells were loaded with TDF to a final concentration of 1 μ M.

qPCR method for detecting virus genome DNA

Primer: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. Using SYBR Premix Ex Taq II-Takara DRR081S kit, 1. mu.L of cell culture supernatant was used as a template, a standard curve was made with a plasmid containing HBV genome, and the virus copy number was calculated from the standard curve. Concentration-viral copy number was processed with Graphpad Prism5 software and EC of compounds on viral replication was calculated by a four-parameter non-linear regression model₅₀. The results are shown in Table 2.

Table 2: EC of the Compounds of the invention on HBV replication₅₀Value of

Examples	EC₅₀(nM)
		Example 1	21
Example 2	6
		Example 3	5
Example 4	8.7
		Example 5	16
Example 6	10
		Example 7	8
Example 8	6
		Example 9	7
Example 10	7
		Example 11	15
Example 12	19
		Example 13	12

And (4) conclusion: experimental data show that the compound has good inhibitory activity on HBV and has good application prospect in the aspect of resisting HBV.

And (3) testing 2: cytotoxic and Selectivity indices

The experimental method comprises the following steps:

serial dilutions of the compounds were added to 384 well cytotoxic cell plates, 50 μ L hepg2.2.15 cells (3000 cells/well) per well, with the highest final concentration tested being 150 μ M (200-fold dilution). 37 ℃ CO₂After 4 days incubation in incubator, chemical combination was detected with CellTiter Glo reagentThe cytotoxic effect of the compound.

Compound cytotoxicity was calculated using the following formula: cytotoxicity (%) ═ 100- (mean value of assay/DMSO control wells × 100). Concentration-cytotoxicity (%) data were processed with Graphpad Prism5 software and CC was calculated by a four-parameter non-linear regression model₅₀。CC₅₀A value of greater than 50 indicates a lower toxicity, and the results of the experiments with the compounds of the invention are shown in Table 3.

Table 3: cytotoxic CC of Compounds of the invention₅₀Value of

Examples	CC₅₀(μM)
		Example 1	>100
Example 2	>100
		Example 3	>100
Example 5	>100
		Example 6	>100
Example 7	>100
		Example 11	>100
Example 12	>100
		Example 13	>100

And (4) conclusion: the cytotoxicity experimental data show that the compound has low toxicity to cells.

And (3) testing: pharmacokinetic experiments of the compounds of the invention in beagle dogs, mice and rats

(1) Beagle PK test experiment

Compounds PK determination assay in beagle dogs (purchased from lakan slykholda laboratory animals ltd., 10-12kg body weight, male, age 10-12 months, 3 per group orally, 3 per group intravenously) assay protocol:

beagle dogs were administered 2.5mg/kg or 5mg/kg by oral gavage or 1mg/kg or 2mg/kg by intravenous injection of the test compound.

Blood was collected intravenously at time points (0.083, 0.25, 0.5, 1,2,4, 6, 8 and 24 hours) after administration and collected at the time of EDTA-K addition₂In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.

And (4) conclusion: the pharmacokinetic experimental data show that the compound has better pharmacokinetic property in beagle dogs and has good application prospect in the aspect of anti-HBV.

(2) Mouse PK test experiment:

PK assay of compounds in mice (purchased from slagoka laboratory animals ltd, han, hu, 20-25g, male, age 45-60 days, 3 per group orally, 3 per group intravenously) assay:

ICR mice were orally gavaged with 10mg/kg or injected via the tail vein with 2mg/kg or 10mg/kg of the test compound.

Blood was collected at time points (0.083, 0.25, 0.5, 1,2,4, 6, 8 and 24 hours) from the orbital vein after administration and collected by adding EDTA-K₂In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.

And (4) conclusion: the pharmacokinetic experiment data show that the compound has better pharmacokinetic property in mice and has good application prospect in the aspect of anti-HBV.

(3) SD rat PK test experiment:

compounds PK determination in SD rats (purchased from slagoka laboratory animals ltd, han, hu, 200-g, male, age 2-3 months, 3 per group orally, 3 per group intravenously) assay:

rats were dosed either 2.5mg/kg or 5mg/kg per oral gavage or 1mg/kg per intravenous injection of the test compound.

Blood was collected intravenously at time points (0.083, 0.25, 0.5, 1,2,5, 7 and 24 hours) after administration and collected by adding EDTA-K₂In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.

And (4) conclusion: pharmacokinetic experiment data show that the area under the curve AUC of the compound of the invention is measured by time_lastThe larger exposure amount is better, which shows that the compound of the invention has good absorption in SD rats, is stable in vivo and has high bioavailability. Therefore, the compound has better pharmacokinetic property in SD rats and has good application prospect in the aspect of anti-HBV.

And (4) testing: stability testing of Compounds of the invention in liver microsomes of different species

Methods for hepatic microsomal stability of compounds in different species:

30. mu.L of a mixed solution of the blank solution and the liver microsomes was added to a 96-well plate, and 15. mu.L of a buffer containing the compound to be detected was added to each well, and two samples were prepared in parallel. After preincubation at 37 ℃ for 10min, 15. mu.L of NADPH solution (8mM) was added at time points, with a final concentration of test compound of 1. mu.M, liver microsome concentration of 0.5mg/mL, and NADPH concentration of 2 mM. Incubate for 0, 15, 30, 60min, respectively, and add 150 μ L acetonitrile (containing internal standard) to the mixed system after incubation. The acetonitrile diluted sample was centrifuged at 4000rpm for 5min and 150. mu.L of the supernatant was taken to LC-MS/MS for analysis.

And (4) conclusion: the compound of the invention has better stability in different types of liver microsomes.

And (5) testing: solubility test method

Experimental test method for solubility of compound

Except for other provisions, the test sample ground into fine powder is weighed or the liquid test sample is weighed to 25 +/-2 ℃ in a solvent with certain volume, the strong shaking is carried out for 30s every 5min, the dissolution condition within 30min is observed, and if no visible solute particles or liquid drops exist, the test sample is regarded as complete dissolution. According to the standard of Chinese pharmacopoeia 2015 edition:

very soluble means that 1g (mL) of solute can be dissolved in less than 1mL of solvent;

soluble means that 1g (mL) of solute can be dissolved in 1-less than 10mL of solvent;

the dissolving means that 1g (mL) of solute can be dissolved in 10-less than 30mL of solvent;

slightly soluble means that 1g (mL) of solute can be dissolved in 30-less than 100mL of solvent;

slightly soluble means that solute lg (mL) can be dissolved in 100-less than 1000mL of solvent;

the minimal dissolution means that 1g (mL) of solute can be dissolved in 1000-less than 10000mL of solvent;

by almost insoluble or insoluble is meant that 1g (mL) of solute is not completely dissolved in 10000mL of solvent.

And (4) conclusion: solubility experimental data show that the compound has better solubility.

And 6, testing: hERG test method

Method for testing heart experiment by compound

In 384 well plates were added compound/positive control/negative control, membrane fragments containing the hERG channel, tracer with high affinity for the hERG channel in sequence and incubated for 4 hours at 25 ℃ and 250 rpm. The fluorescence polarization value of each well is measured by a multifunctional microplate reader, and the relative inhibition rate and 50% Inhibition Concentration (IC) of the compound on the hERG channel are calculated₅₀)。

And (4) conclusion: the hERG test data show that the compound has low toxicity to the heart.

And 7, testing: liver drug enzyme induction test

Cell culture

All incubations were performed in an incubator at 37 ℃, 5% CO2 and 95% humidity.

After thawing frozen human hepatocytes (Baltimore, MD, USA), the number of cells and the cell viability were determined by trypan blue staining and a cell counter. After counting, the hepatocytes were diluted with pre-warmed plating medium to 70 ten thousand viable cells per ml. Inoculating the diluted hepatocyte suspension to a 48-pore plate pre-laid with collagen according to 0.2 mL/pore, incubating and culturing for at least 4 hours in an incubator, and replacing a plate culture solution with an incubation culture solution containing 2% of substrate matrigel when the cells are in an adherent state.

The administration working solution is prepared by using an incubation culture solution freshly every day, and comprises a test sample (the concentration is not lower than 0.1 mu M), positive inducers of CYP1A2, CYP2B6 and CYP3A4, namely omeprazole, phenobarbital and rifampicin, and is obtained by diluting 1000 times of DMSO stock solution. The information on the administration of the working solutions is shown in the following table.

After the culture system is well established, the upper layer culture solution of the sandwich culture medium is discarded, 200 mu L of administration working solution (containing a test sample, a positive control, a negative control and a matrix control) which is preheated to 37 ℃ and is prepared freshly is added into each cell culture hole, and the cell culture plate is placed in an incubator to be continuously cultured for 24 hours. After 24 hours of incubation, the freshly prepared dosing solution was replaced and incubation continued for 24 hours. The total incubation time was 48 hours. Three replicates were run for each drug concentration and control concentration.

After the cells were incubated with the dosing working solution for 48 hours, the remaining drug solution in the plate was discarded, the wells were washed 2 times with 0.5mL HBSS solution preheated to 37 ℃, and 100 μ L of enzyme activity-labeled substrate working solution preheated to 37 ℃ was added to each well for incubation for 30 minutes. After incubation for 30 minutes, 75 μ L of supernatant sample per well was added to a 96-well deep-well plate containing 150 μ L of stop solution. The plate was shaken for 10 minutes, centrifuged at 3220g for 20 minutes at 4 ℃ and the supernatant solution was diluted 1:4 with an aqueous solution containing 0.1% formic acid. After the diluted sample is shaken for 10 minutes, the generation amount of the metabolite is detected by a liquid chromatography tandem mass spectrometry (LC/MS/MS) method.

After completion of the enzyme activity detection reaction, the remaining solution of the supernatant was discarded, and the cells were washed with 0.5mL of preheated HBSS. mu.L of lysis solution RLT containing 1% beta-mercaptoethanol was added to each well, and the plate was closed and shaken for 10 minutes, and then transferred to a refrigerator at-80 ℃ for storage.

Cytotoxicity test

The potential toxicity of the test article was assessed by the amount of Lactate Dehydrogenase (LDH) released in hepatocytes. After 24 hours and 48 hours of incubation with hepatocytes, 100. mu.L of each of the administration solutions was taken out and the concentration of lactate dehydrogenase was measured using a commercial LDH kit. Cell lysis solution was used as a positive control for the experiment and incubation medium as a blank control.

RNA assay detection

The sample plates were thawed at room temperature and all samples were transferred to new 48 well cell culture plates. RNA was extracted using a fully automated nucleic acid extraction workstation. Samples exceeding 10% of the total amount of the samples were randomly sampled at different positions on the sample plate, OD values of 260nM and 280nM were measured using ND2000 microspectrophotometer, and the ratio of the two was calculated to determine the purity of total RNA. Reverse transcription to obtain cDNA. The selected genes were quantitatively analyzed in real time using a CFX connectTM real-time fluorescent quantitative PCR instrument. The reaction conditions were set as follows: two minutes at 50 ℃; ten minutes at 95 ℃; the following two steps are performed for 40 cycles: fifteen seconds at 95 ℃ and one minute at 60 ℃. Endogenous control 18S rRNA was used as an internal standard.

Sample analysis and detection

The concentrations of metabolites of three CYP enzyme substrates (Acetaminophen), Hydroxybupropion (Hydroxybupropion) and 1-Hydroxymidazolam (1' -Hydroxymidazolam)) in hepatocytes after protein precipitation were determined by a liquid chromatography tandem mass spectrometry (LC/MS/MS) method. The analytical methods are shown in Table 4.

Table 4: induction test LCMS analysis method

Calculation of Gene expression data

The project adopts a relative quantitative method of delta Ct to compare the difference of gene expression among different treatment groups, and uses 18SrRNA as an internal reference gene to correct the gene expression quantity of each sample. The Ct value of the target gene minus the Ct value of the reference gene is the delta Ct, i.e. the Ct_{Target gene}–Ct_18SΔ Ct. The Δ Ct value of the blank group was subtracted from the Δ Ct value of the treated group to obtain Δ Δ Ct, i.e., Δ Ct-treated group — Δ Ct blank group ═ Δ Δ Ct. Finally with 2^-ΔΔCtThe method of (3) was performed for statistical analysis and comparison of fold change between treatment and blank control groups.

Calculation of enzyme Activity data

The experimental data show the production of enzymatic metabolites of CYP1a2, CYP2B6 and CYP3a 4. The change in enzymatic activity is manifested by a comparison of the fold induction of the corresponding cytochrome enzymes in the presence or absence of the compound. The fold induction and the induction ratio with the control compound were calculated as follows:

fold induction-enzyme activity in test article treated samples/enzyme activity in matrix control treated samples

The induction ratio to the control compound is (fold induction of sample treated with test-1)/(fold induction of sample treated with control-1) × 100%.

And (4) conclusion: the liver drug enzyme induction test experimental data show that the compound has no induction effect on liver drug enzyme basically.

And (4) testing 8: human serum test for influence of compounds on anti-HBV efficacy

Principle of experiment

HepG2.2.15 cells have integrated complete HBV genome in their chromosomes and stably express viral RNA and viral proteins. HepG2.2.15 cells secrete mature hepatitis B virus particles, HBsAg and HBeAg into the culture medium. Viral DNA secreted by HepG2.2.15 cells can be quantified by a qPCR method, and human serum with different concentrations is added while a test compound is treated, so that the influence of the human serum on the antiviral efficacy of the compound is detected.

Experimental methods

Compound treatment of HepG2.2.15 cells

Step 1: HepG2.2.15 cells were plated in 96-well cell culture plates at 15000 cells per well, 200. mu.L of cell culture medium per well.

Step 2: at 37 ℃ 5% CO₂Culturing in a cell culture box for 3 days until the cells grow to be full of the wells.

Step 3: on test day 0, old media was discarded and 200 μ L of fresh assay media containing 2% FBS and different Human Serum (HS) concentrations, including 0% HS, 5% HS, 10% HS, 20% HS, 40% HS and 50% HS, were added.

And 4, step 4: compound formulation and cell treatment in antiviral experiments: compounds were dissolved to 30mM in DMSO, further compounds were diluted to 800 μ M in DMSO, then 4-fold dilutions of 8 dilutions were made, with a maximum concentration of 800 μ M. Add 1. mu.L of serially diluted compound per well to the cell plate prepared in step 3, with the highest final concentration tested being 4. mu.M (200-fold dilution).

And 5: the experiment was set with TDF (tenofovir disoproxil fumarate, seleck, CatS1400) as a positive control compound in 2% FBS at a maximum concentration of 4 μ M. Negative control wells were loaded with 1 μ of LDMSO at a final concentration of 0.5%.

Step 6: 96-well cell assay plate CO at 37 deg.C₂The mixture is incubated in an incubator for 11 days,the solution was changed every other day (days 2,4, 6, 8, 10) and 1 μ L of freshly prepared test compound was added, as described in steps 3 to 5.

And 7: at day 11, 150. mu.L of supernatant per well was taken for qPCR detection of viral DNA.

And 8: compound preparation and cell treatment in cytotoxicity experiments: serial dilutions of the compounds were made with Bravo liquid handling system, 11 dilutions, 3-fold dilutions, with a maximum concentration of 30 mM. 0.25 μ L of serially diluted compound was added to 384 well cytotoxic cell plates (Greiner 781098) with Echo 550. Hepg2.2.15 cells were prepared and resuspended in media of different human serum concentrations (50%, 40%, 20%, 10%, 5% and 0%). 50 μ L (4000 cells) of HepG2.2.15 cells prepared above per well were added to 384 well cytotoxic cell plates, with the highest final concentration tested being 150 μ M (200-fold dilution). CO at 37 deg.C₂The cytotoxicity test was performed after 4 days of incubation in the incubator.

qPCR method for detecting virus genome DNA

Step 1: the supernatant under 20% HS test was diluted 2-fold with DPBS, the supernatant under 40% HS test was diluted 4-fold with DPBS, and the supernatant under 50% HS test was diluted 5-fold with DPBS. After mixing, 1 μ L of the mixture was taken for qPCR detection.

Step 2: the supernatant under the experimental conditions of 0% HS, 5% HS and 10% HS was directly taken at 1. mu.L for qPCR detection.

And step 3: preparing a qPCR reaction system according to the following components:

SYBR Premix Ex TaqTM II(2×)	10μL
		HBV-For-202(10μM)	0.8μL
HBV-Rev-315(10μM)	0.8μL
		ROX Reference Dye(50×)	0.4μL
viral supernatant	1μL
		Adding water to	20μL

And 4, step 4: ABI ViiA7 qPCR instrument was set up as follows

Stage 1:

reps: 95 ℃ for 30s, 1 cycle

And (2) stage:

reps: 95 deg.C, 5s and 60 deg.C, 34s, 40 cycles

Addition dissolution profile

Detection of cytotoxic Effect of Compounds

Step 1: promega Celltiter-Glo reagent was equilibrated to room temperature.

Step 2: the cytotoxic assay plate medium was discarded and 50. mu.L of DPBS was added to each well.

And step 3: add 10. mu.L of CellTiter-Glo reagent to each well.

And 4, step 4: shake on a plate shaker for 2 minutes.

And 5: equilibrate for 10 minutes at room temperature in the dark.

Step 6: read on an Envision plate reader (0.1 sec/well).

Analysis of results

A standard curve was prepared using plasmids containing HBV genomes (viral copy number: 2X 10E6, 2X 10E5, 2X 10E4, 2X 10E3), and the viral copy number was calculated from the standard curve. Data were processed with Graphpad Prism5 software and concentration-viral copy number curves were plotted, and EC was calculated by a four-parameter non-linear regression model₅₀. Cytotoxicity%0- (mean assay/DMSO control wells x 100). The% cytotoxicity data were processed with Graphpad Prism5 software and plotted, and CC was calculated by a four parameter non-linear regression model₅₀。

And (4) conclusion: the experimental data show that the human serum has small influence on the antiviral efficacy of the compound, which indicates that the compound can play a good antiviral effect in human body.

Although the invention has been described in detail hereinabove by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that many modifications and improvements can be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Claims

1. A compound which is a compound represented by formula (I) or (Ia) or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of the compound represented by formula (I) or (Ia),

w is CH or N;

X¹is-C (═ O) -, -S (═ O)₂-or- (CR)⁵R⁶)_j-；

Each R⁴、R^4a、R^4bAnd R⁵Independently hydrogen, deuterium, F, Cl, Br, amino, C_1-6Alkyl, NH₂C(＝O)-、C_1-6alkyl-OC (═ O) -, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-4Alkylene radical, C_1-4Alkoxy or C_1-6A haloalkyl group;

or R⁷、R⁸And the nitrogen atom to which they are attachedTogether, the substituents form a heterocyclic group of 3-6 ring atoms;

each R^7bIndependently of one another is hydrogen, deuterium, C_1-6Alkyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-3Alkylene or C_1-6A haloalkyl group;

each R^8bIndependently of one another is hydrogen, deuterium, C_1-6Alkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, hydroxy C_1-6Alkyl radical, C_1-4Alkoxy radical C_1-3Alkylene or C_1-6A haloalkyl group;

m is 0, 1,2,3 or 4;

j is 1,2 or 3.

2. The compound of claim 1, wherein R²Is methyl, ethyl, n-propyl, isopropyl, C_1-4Haloalkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl;

3. The compound of any one of claims 1-2, wherein each R⁴、R^4a、R^4bAnd R⁵Independently hydrogen, deuterium, F, Cl, Br, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, NH₂C(＝O)-、C_1-4alkyl-OC (═ O) -, hydroxy C_1-4Alkyl, methoxy, ethoxy, n-propoxy, isopropoxy, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

4. The compound of claim 1, wherein R^xIs hydrogen, R⁷R⁸NC(＝O)-、R^7aR^8aNC(＝O)-(CR⁵R⁶)-、R⁷R⁸NC(＝O)-C_2-4Alkylene-, R⁷R⁸NC(＝O)-C_2-4Alkenylene-, R¹¹-S(＝O)₂NR¹⁰-C_0-4Alkylene-or R^11a-S(＝O)₂NR¹⁰-C_2-4Alkenylene-wherein R is⁷R⁸NC(＝O)-C_2-4Of alkylene-C_2-4Alkylene-, R⁷R⁸NC(＝O)-C_2-4-C in alkenylene-_2-4Alkenylene-, R¹¹-S(＝O)₂NR¹⁰-C_0-4Of alkylene-C_0-4Alkylene-and R^11a-S(＝O)₂NR¹⁰-C_2-4-C in alkenylene-_2-4Alkenylene-each independently being unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, C_1-4Alkyl, hydroxy C_1-4Alkyl and C_1-4Substituted with a substituent of haloalkyl;

R^yis hydrogen, F, R^7bR^8bNC(＝O)-C_0-4Alkylene-, R^7bR^8bNC(＝O)-C_2-4Alkenylene radical-、R^11a-S(＝O)₂NR¹⁰-C_0-4Alkylene-or R^11a-S(＝O)₂NR¹⁰-C_2-4Alkenylene-wherein R is^7bR^8bNC(＝O)-C_0-4Of alkylene-C_0-4Alkylene-, R^7bR^8bNC(＝O)-C_2-6-C in alkenylene-_2-4Alkenylene-, R^11a-S(＝O)₂NR¹⁰-C_0-4Of alkylene-C_0-4Alkylene-and R^11a-S(＝O)₂NR¹⁰-C_2-4-C in alkenylene-_2-4Alkenylene-each independently being unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, C_1-4Alkyl, hydroxy C_1-4Alkyl and C_1-4Substituted by a substituent of a haloalkyl group.

5. The compound of claim 1, wherein R^xIs hydrogen, R⁷R⁸NC(＝O)-、R^7aR^8aNC(＝O)-(CR⁵R⁶)-、R⁷R⁸NC(＝O)-(CH₂)₂-、R⁷R⁸NC(＝O)-(CH₂)₃-、R⁷R⁸NC(＝O)-CH＝CH-、R⁷R⁸NC(＝O)-CH＝CH-CH₂-、R¹¹-S(＝O)₂NR¹⁰-、R¹¹-S(＝O)₂NR¹⁰-CH₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH ═ CH-or R^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-, wherein said R⁷R⁸NC(＝O)-(CH₂)₂In- (CH)₂)₂-、R⁷R⁸NC(＝O)-(CH₂)₃In- (CH)₂)₃-、R⁷R⁸-CH-, R-of NC (O) -CH ═ CH —, R —⁷R⁸NC(＝O)-CH＝CH-CH₂Of-CH＝CH-CH₂-、R¹¹-S(＝O)₂NR¹⁰-CH₂-CH of (A-O-)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₂In- (CH)₂)₂-、R¹¹-S(＝O)₂NR¹⁰-(CH₂)₃In- (CH)₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH-or R of-CH-^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-CH of (i-CH)₂Each independently unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-3Alkyl and C_1-3Substituted with a substituent of haloalkyl;

R^yis hydrogen, F, R^7bR^8bNC(＝O)-、R^7bR^8bNC(＝O)-CH₂-、R^7bR^8bNC(＝O)-(CH₂)₂-、R^7bR^8bNC(＝O)-(CH₂)₃-、R^7bR^8bNC(＝O)-CH＝CH-、R^7bR^8bNC(＝O)-CH＝CH-CH₂-、R^11a-S(＝O)₂NR¹⁰-、R^11a-S(＝O)₂NR¹⁰-CH₂-、R^11a-S(＝O)₂NR¹⁰-(CH₂)₂-、R^11a-S(＝O)₂NR¹⁰-(CH₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH ═ CH-or R^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-, wherein said R^7bR^8bNC(＝O)-CH₂-CH of (A-O-)₂-、R^7bR^8bNC(＝O)-(CH₂)₂In- (CH)₂)₂-、R^7bR^8bNC(＝O)-(CH₂)₃In- (CH)₂)₃-、R^7bR^8b-CH-, R-of NC (O) -CH ═ CH —, R —^7bR^8bNC(＝O)-CH＝CH-CH₂-CH of (i-CH)₂-、R^11a-S(＝O)₂NR¹⁰-CH₂-CH of (A-O-)₂-、R^11a-S(＝O)₂NR¹⁰-(CH₂)₂In- (CH)₂)₂-、R^11a-S(＝O)₂NR¹⁰-(CH₂)₃In- (CH)₂)₃-、R^11a-S(＝O)₂NR¹⁰-CH-and R of-CH-^11a-S(＝O)₂NR¹⁰-CH＝CH-CH₂-CH of (i-CH)₂Each independently unsubstituted or substituted by 1,2 or 3 substituents selected from deuterium, F, Cl, Br, OH, CN, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl and C_1-4Substituted by a substituent of a haloalkyl group.

6. The compound of claim 1, wherein each R⁷Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

7. The compound of claim 1, wherein each R¹⁰Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, hydroxy C_1-4Alkyl radical, C_1-4Alkoxy radical C_1-2Alkylene or C_1-4A haloalkyl group;

8. A compound comprising the structure of one of:

or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof.

9. A pharmaceutical composition comprising a compound according to any one of claims 1 to 8, together with pharmaceutically acceptable excipients, which further comprises a further anti-HBV agent.

10. The pharmaceutical composition according to claim 9, wherein the other anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator or an interferon.

11. The pharmaceutical composition according to claim 9, wherein the other anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simon interleukin, cladribine, emtricitabine, faplovir, calamine CP, intefine, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, mevoxil, nitazoxanide, peginterferon alpha-2 a, ribavirin, roscovitine-a, xiran, Euforavac, ani, phosziphad, heplisv, interferon alpha-2 b, levamisole or propafegermanium.

12. Use of a compound of any one of claims 1-8 or a pharmaceutical composition of any one of claims 9-11 in the manufacture of a medicament for preventing, treating or ameliorating a viral disease in a patient, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

13. The use according to claim 12, wherein the disease caused by hepatitis b infection is cirrhosis or hepatocellular carcinoma.