CN110950860B - Fused tricyclic compound and application thereof in medicines - Google Patents

Fused tricyclic compound and application thereof in medicines Download PDF

Info

Publication number
CN110950860B
CN110950860B CN201910911197.7A CN201910911197A CN110950860B CN 110950860 B CN110950860 B CN 110950860B CN 201910911197 A CN201910911197 A CN 201910911197A CN 110950860 B CN110950860 B CN 110950860B
Authority
CN
China
Prior art keywords
radical
substituted
ring atoms
compound
heteroaryl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910911197.7A
Other languages
Chinese (zh)
Other versions
CN110950860A (en
Inventor
任青云
黄建洲
熊金锋
刘洋
于方彩
刘为顺
王益锋
S·戈尔德曼
张英俊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangdong HEC Pharmaceutical
Original Assignee
Sunshine Lake Pharma Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sunshine Lake Pharma Co Ltd filed Critical Sunshine Lake Pharma Co Ltd
Publication of CN110950860A publication Critical patent/CN110950860A/en
Application granted granted Critical
Publication of CN110950860B publication Critical patent/CN110950860B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Landscapes

  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)

Abstract

The invention relates to a fused tricyclic compound and application thereof in medicines, in particular to application of the fused tricyclic compound as a medicine for treating and/or preventing hepatitis B. Specifically, the invention relates to a compound shown in a general formula (I) or a stereoisomer, a tautomer, an N-oxide, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, wherein each variable is defined in the specification. The invention also relates to the application of the compound shown in the general formula (I) or the stereoisomer, the tautomer, the nitrogen oxide, the solvate, the metabolite, the pharmaceutically acceptable salt or the prodrug thereof as a medicament, in particular to the application as a medicament for treating and/or preventing hepatitis B.

Description

Fused tricyclic compound and application thereof in medicines
Technical Field
The invention belongs to the field of medicaments, and relates to a fused tricyclic compound and application thereof as a medicament, in particular to application of the fused tricyclic compound as a medicament for treating and/or preventing hepatitis B. The invention also relates to compositions of these fused tricyclic compounds with other antiviral agents, and to their use for the treatment and/or prevention of Hepatitis B Virus (HBV) infection.
Background
Hepatitis b virus belongs to the hepadnaviridae family. It can cause acute and/or persistent progressive chronic disease. Hepatitis b virus also causes many other clinical manifestations in the pathological morphology-in particular chronic inflammation of the liver, cirrhosis and canceration of hepatocytes. Estimated by the world health organization, there are 20 million people worldwide infected with HBV, about 3.5 million people with chronic infection, and about 100 million people per year die of liver failure, cirrhosis, and primary hepatocellular carcinoma (HCC) due to HBV infection.
The current treatment for Chronic Hepatitis B (CHB) is mainly antiviral treatment. Interferon alpha (IFN- α) and pegylated IFN- α and 5 nucleoside (acid) analogs (lamivudine, adefovir dipivoxil, entecavir, telbivudine and tenofovir) were approved by the U.S. Food and Drug Administration (FDA) for clinical treatment. Interferon is an anti-HBV drug approved by FDA for the first time, and it has a virus-removing effect mainly through direct antiviral action and immune response induction, but its application is limited due to its low response rate, various side effects, high price and limitations of therapeutic subjects. The anti-HBV common point of the nucleoside (acid) drugs is that the nucleoside (acid) drugs act on virus DNA polymerase specifically, so that the nucleoside (acid) drugs have strong effect of inhibiting virus replication, and the tolerance of patients to the drugs is better than that of interferon. However, the wide long-term use of nucleotide drugs can induce the mutation of DNA polymerase to form drug resistance, which leads to the continuous emergence of drug-resistant strains, and the treatment can not achieve ideal curative effect.
Therefore, there is still a need for new compounds that can be effectively used as antiviral drugs, especially as drugs for the treatment and/or prevention of hepatitis b in the clinic.
Disclosure of Invention
The invention relates to a novel fused tricyclic compound and application thereof in preparing medicaments for treating and preventing HBV infection. The inventor finds that the novel fused tricyclic compound has the advantages of better pharmacokinetic property, good solubility, small toxicity, good stability of liver microsomes, good inhibitory activity on generation or secretion of HBsAg and replication of HBV DNA and the like, and has good application prospect in the aspect of anti-HBV. In particular, the compounds of the present invention, and the pharmaceutically acceptable compositions thereof, are also effective in inhibiting HBV infection.
In one aspect, the invention relates to a compound of formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (I), or a prodrug thereof, wherein:
Figure BDA0002214794320000011
each X 1 And X 2 Independently of one another is CR 7 Or N;
R 1 is R 1a O-or R a R b N-；
R 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl,Tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x Substituted by 1,2 or 3R x Substituted;
or, R 2 Is C 1-4 Alkoxy radicals, in the meantime, R 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is 1-4 Alkoxy is unsubstituted or substituted by 1,2,3 or 4R w And (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4R x1 Substituted;
each R x And R x1 Independently deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -C 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is 8 -C 1-4 C in alkylene 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, a heterocyclic group consisting of 3 to 10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
R 8 is F, cl, br, CN, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, a heterocyclic group consisting of 3 to 10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently is C 1-6 Alkyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R h Substituted;
each R k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, a heterocyclic group consisting of 3 to 10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, = O, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R h And R w Independently deuterium, F, cl, br, HO-, = O, HOOC-, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-7 Cycloalkyl, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl and C 3-7 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, C 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently is H, deuterium, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl radical, C 6-10 Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl radical, C 6-10 Aryl, heterocyclic group consisting of 3 to 6 ring atoms and 5-The heteroaryl groups consisting of 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 radicals selected from F, cl, br, CN, HO-, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 Substituted by alkylamino.
In another aspect, the present invention relates to a compound that is a compound of formula (II) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (II) or a prodrug thereof, wherein:
Figure BDA0002214794320000031
each X 1 And X 2 Independently is CR 7 Or N;
R 1 is R 1a O-or R a R b N-；
R 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4R x Substituted;
or, R 2 Is C 1-4 Alkoxy radicals, in the meantime, R 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, C is 1-4 Alkoxy is unsubstituted or substituted by 1,2,3 or 4R w And (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4R x1 Substituted;
each R x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -C 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is 8 -C 1-4 C in alkylene 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
R 8 is F, cl, br, CN, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently is C 1-6 Alkyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R h Substituted;
each R k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, a heterocyclic group consisting of 3 to 10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, = O, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R h And R w Independently deuterium, F, cl, br, HO-, = O, HOOC-, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-7 Cycloalkyl, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl and C 3-7 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, C 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently of the other is H, deuterium, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl radical, C 6-10 Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl radical, C 6-10 Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 Substituted by alkylamino.
In some embodiments, R is as described herein 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxazolylOxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x Substituted, said furyl being substituted by 1,2 or 3R x Substituted;
or, R 2 Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4R w Substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x1 Substituted;
wherein each R is a ，R b ，R w ，R x And R x1 Have the meaning as described in the present invention.
In some embodiments, R is as described herein 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x Substituted;
or, R 2 Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4R w Substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x1 Substituted;
wherein each R is a ，R b ，R w ，R x And R x1 Have the meaning as described in the present invention.
In some embodiments, each R is as described herein x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -C 1-3 Alkylene, amino, C 1-6 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein R is as defined above 8 -C 1-3 C in alkylene 1-3 Alkylene, amino, C 1-6 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
wherein each R is a 、R b 、R 8 And R k Have the meaning as described in the present invention.
In some embodiments, each R described herein x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -CH 2 -、R 8 -(CH 2 ) 2 -、R 8 -(CH 2 ) 3 -, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is a radical selected from the group consisting of 8 -CH 2 -CH of (A-O-) 2 -、R 8 -(CH 2 ) 2 In (C) - (CH) 2 ) 2 -、R 8 -(CH 2 ) 3 In (C) - (CH) 2 ) 3 -, amino group,Methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted with 1,2,3 or 4R k Substituted;
wherein each R is a 、R b 、R 8 And R k Have the meaning described in the present invention.
In some embodiments, each R described herein x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -CH 2 -、R 8 -(CH 2 ) 2 -、R 8 -(CH 2 ) 3 -, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is optionally substituted with one or more substituents selected from the group consisting of alkyl, heteroaryl, thienyl, pyridyl, and the like 8 -CH 2 -CH of (A-O-) 2 -、R 8 -(CH 2 ) 2 In (C) - (CH) 2 ) 2 -、R 8 -(CH 2 ) 3 In (C) - (CH) 2 ) 3 -, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
wherein each R is a 、R b 、R 8 And R k Have the meaning as described in the present invention.
In some embodiments, each R is as described herein 8 Is F, cl, br, CN, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-4 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C 6-10 Aryl, heteroaryl of 5 ring atoms or heteroaryl of 6 ring atoms, wherein said amino, C 1-4 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C 6-10 Aryl, heteroaryl of 5 ring atoms and heteroaryl of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently is C 1-4 Alkyl radical, C 3-6 Cycloalkyl or heterocyclyl consisting of 3 to 6 ring atoms, wherein said C is 1-4 Alkyl radical, C 3-6 Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R h Substituted;
wherein each R is 8 、R c 、R f And R h Have the meaning as described in the present invention.
In some embodiments, R is as described herein 8 Is F, cl, br, CN, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C 1-3 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein said amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C.sub.l-propoxy 1-3 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazole, and pharmaceutically acceptable salts thereofIndependently of each other, phenyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl is unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substituted with 1,2,3, or 4R h Substituted;
wherein each R is 8 、R c 、R f And R h Have the meaning as described in the present invention.
In some embodiments, each R described herein k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-4 Alkyl radical, C 1-6 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein said amino, C 1-4 Alkyl radical, C 1-6 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl with 3 to 6 ring atoms, phenyl, heteroaryl with 5 ring atoms and heteroaryl with 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting ofF. Cl, br, CN, OH, = O, amino, C 1-4 Alkyl radical, C 1-4 Haloalkyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Haloalkoxy or C 1-4 Substituted by alkylamino;
each R h And R w Independently is deuterium, F, cl, br, HO-, HOOC-, amino, C 1-4 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl or C 3-6 Cycloalkyl, wherein said amino, C 1-4 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl and C 3-6 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, cl, br, CN, HO- = O, amino, C 1-4 Alkyl radical, C 1-4 Haloalkyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Haloalkoxy or C 1-4 Substituted by alkylamino;
wherein each R is 10 、R 11 And R c Have the meaning as described in the present invention.
In some embodiments, each R described herein k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-3 Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C 1-3 Alkylthio radical, C 1-3 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, and thiadiazolylOxazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said amino, C 1-3 Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C 1-3 Alkylthio radical, C 1-3 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, cl, br, CN, HO- = O, amino, C 1-3 Alkyl radical, C 1-3 Haloalkyl, C 1-3 Alkoxy radical, C 1-3 Alkylthio radical, C 1-3 Haloalkoxy or C 1-3 Substituted by alkylamino;
each R h And R w Independently deuterium, F, cl, br, HO- = O, HOOC-, amino, C 1-3 Alkyl radical, C 1-3 Alkoxy radical, C 1-3 Alkylthio radical, C 1-3 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl or C 3-6 Cycloalkyl, wherein said amino, C 1-3 Alkyl radical, C 1-3 Alkoxy radical, C 1-3 Alkylthio radical, C 1-3 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl and C 3-6 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, amino, C 1-3 Alkyl radical, C 1-3 Haloalkyl, C 1-3 Alkoxy radical, C 1-3 Alkylthio radical, C 1-3 Haloalkoxy or C 1-3 Substituted by alkylamino;
wherein each R is 10 、R 11 And R c Have the meaning as described in the present invention.
In some embodiments, each R described herein 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkylamino radical, C 1-4 Alkoxy radical, C 2-4 Alkynyl, C 2-4 Alkenyl radical, C 3-6 Cycloalkyl or heterocyclic group consisting of 3 to 6 ring atoms, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkylamino radical, C 1-4 Alkoxy radical, C 2-4 Alkynyl, C 2-4 Alkenyl radical, C 3-6 Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkoxy radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkoxy radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, and isothiazolylOxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently being unsubstituted or substituted by 1,2,3 or 4 groups selected from F, cl, br, CN, HO-, amino, C 1-4 Alkyl radical, C 1-4 Haloalkyl, C 1-4 Alkoxy or C 1-4 Substituted by alkylamino;
wherein each R is w Have the meaning as described in the present invention.
In some embodiments, each R described herein 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, C 1-4 Alkylamino radical, C 1-4 Alkoxy radical, C 2-4 Alkynyl, C 2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, C 1-4 Alkylamino radical, C 1-4 Alkoxy radical, C 2-4 Alkynyl, C 2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substituted by 1,2,3, or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkoxy radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinylA group selected from the group consisting of a methyl group, an imidazolidinyl group, a tetrahydrofuryl group, a tetrahydrothienyl group, a tetrahydropyranyl group, a tetrahydrothiopyranyl group, a piperidyl group, a morpholinyl group, a thiomorpholinyl group, a piperazinyl group, a phenyl group, a furyl group, a pyrrolyl group, a pyridyl group, a pyrazolyl group, an imidazolyl group, a triazolyl group, a tetrazolyl group, an oxazolyl group, an isoxazolyl group, an oxadiazolyl group, a 1,3, 5-triazinyl group, a thiazolyl group, a thienyl group, a pyrazinyl group, a pyridazinyl group and a pyrimidinyl group, wherein the methyl group, the ethyl group, the n-propyl group, the isopropyl group, the n-butyl group, the isobutyl group, the C-thienyl group and the pyrimidinyl group are bonded to each other 1-4 Alkoxy radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, amino, C 1-4 Alkyl radical, C 1-4 Haloalkyl, C 1-4 Alkoxy or C 1-4 Substituted by alkylamino;
wherein each R is w Have the meaning as described in the present invention.
In another aspect, the invention also provides a pharmaceutical composition comprising a compound of the invention, optionally further comprising a pharmaceutically acceptable excipient or a combination of said excipients.
In some embodiments, the pharmaceutical composition of the present invention further comprises an additional anti-HBV agent.
In some embodiments, the pharmaceutical composition of the invention, wherein the other anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.
In some embodiments, the pharmaceutical composition of the invention, wherein the other anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, alloferon, simon interleukin, cladribine, emtricitabine, famciclovir, interferon, calamine CP, intefine, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, mevalonate, nitazoxanide, peginterferon alpha-2 a, ribavirin, roscovitine-a, cezopyran, euforavac, azapril, phosphazid, heplisv, interferon alpha-2 b, levamisole, or propafege.
In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient.
In some embodiments, the use of the invention, wherein the viral disease is hepatitis b virus infection or a disease caused by hepatitis b virus infection.
In still other embodiments, the use of the present invention, wherein the disease caused by hepatitis b virus infection is liver cirrhosis or hepatocellular carcinoma.
In another aspect, the invention also provides the use of said compound or said pharmaceutical composition in the manufacture of a medicament for inhibiting the production or secretion of HBsAg, and/or for inhibiting the production of HBV DNA.
In another aspect, the invention relates to the use of the compound or the pharmaceutical composition in the manufacture of a medicament for preventing, treating or alleviating hepatitis b disease in a patient.
Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a compound of the invention.
Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV disorders in a patient, said method comprising administering to the patient a pharmaceutically acceptable effective amount of a pharmaceutical composition comprising a compound of the present invention.
Another aspect of the present invention pertains to the use of a compound of the present invention in the manufacture of a medicament for the prevention, treatment, or treatment of an HBV condition in a patient, and for lessening the severity of the HBV condition in the patient.
Another aspect of the present invention relates to the use of a pharmaceutical composition comprising a compound of the present invention in the manufacture of a medicament for preventing or treating HBV conditions in a patient and reducing the severity thereof.
Another aspect of the present invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or composition of the present invention in an amount effective to inhibit HBV. In other embodiments, the method further comprises contacting the cell with an anti-HBV agent.
Another aspect of the present invention pertains to methods for treating HBV disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.
Another aspect of the present invention pertains to a method for inhibiting HBV infection in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.
Another aspect of the invention relates to methods for the preparation, isolation and purification of compounds encompassed by formula (I).
The foregoing merely summarizes certain aspects of the invention and is not intended to be limiting. These and other aspects will be more fully described below.
Detailed description of the invention
Definitions and general terms
The invention will be described in detail in the literature corresponding to the identified embodiments, and the examples are accompanied by the graphic illustrations of structural formulae and chemical formulae. The present invention is intended to cover all alternatives, modifications and equivalents, which may be included within the scope of the present invention as defined by the appended claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein which can be used in the practice of the present invention. The present invention is in no way limited to the description of methods and materials. There are many documents and similar materials that may be used to distinguish or contradict the present application, including, but in no way limited to, the definition of terms, their usage, the techniques described, or the scope as controlled by the present application.
The following definitions shall apply unless otherwise indicated. For the purposes of the present invention, the chemical elements are described in the periodic table of elements, CAS version and handbook of chemicals, 75, th ed, 1994. In addition, the general principles of Organic Chemistry are described in "Organic Chemistry," Thomas Sorrell, university Science Books, sausalito:1999, and March s Advanced Organic Chemistry, "by Michael B, smith and Jerrery March, john Wiley&Sons, new York, 2007, all of which are hereby incorporated by reference.
The compounds of the invention may be substituted with one or more substituents as described herein, such as compounds of the general formula above, or as specifically exemplified, sub-classes, and classes of compounds encompassed by the invention. In general, the term "substituted" indicates that one or more hydrogen atoms in a given structure are replaced with a particular substituent. Unless otherwise indicated, a substituted group may have one substituent substituted at each substitutable position of the group. When more than one position in a given formula can be substituted with one or more substituents selected from a particular group, the substituents may be substituted at each position, identically or differently. In the various parts of this specification, substituents of the disclosed compounds are disclosed in terms of group type or range. It is specifically intended that the invention includes each and every independent subcombination of the various members of these groups and ranges. For example, the term "C 1-6 Alkyl "means in particular independently disclosed methyl, ethyl, C 3 Alkyl radical, C 4 Alkyl radical, C 5 Alkyl and C 6 An alkyl group.
In addition, unless otherwise explicitly indicated, the description of "each of the methods 8230, independently" and "\8230"; independently "and" \8230, independently "and" \8230 "; independently" are used interchangeably in the present invention and are to be understood broadly, and they may mean that specific items expressed between the same symbols in different groups do not affect each other, or that specific items expressed between the same symbols in the same groups do not affect each other.
The term "alkyl" as used herein includes saturated straight or branched chain monovalent hydrocarbon groups of 1 to 20 carbon atoms, wherein the alkyl groups may independently be optionally substituted with one or more substituents described herein. In some embodiments, the alkyl group contains 1 to 12 carbon atoms, in other embodiments, the alkyl group contains 1 to 8 carbon atoms, in other embodiments, the alkyl group contains 1 to 6 carbon atoms, in other embodiments, the alkyl group contains 1 to 4 carbon atoms, and in other embodiments, the alkyl group contains 1 to 3 carbon atoms. Still further examples of alkyl groups include, but are not limited to, methyl (Me, -CH) 3 ) Ethyl (Et, -CH) 2 CH 3 ) N-propyl (n-Pr, -CH) 2 CH 2 CH 3 ) Isopropyl (i-Pr, -CH (CH) 3 ) 2 ) N-butyl (n-Bu, -CH) 2 CH 2 CH 2 CH 3 ) 2-methylpropyl or isobutyl (i-Bu, -CH) 2 CH(CH 3 ) 2 ) 1-methylpropyl or sec-butyl (s-Bu, -CH (CH) 3 )CH 2 CH 3 ) Tert-butyl (t-Bu, -C (CH) 3 ) 3 ) N-pentyl (-CH) 2 CH 2 CH 2 CH 2 CH 3 ) 2-pentyl (-CH (CH) 3 )CH 2 CH 2 CH 3 ) 3-pentyl (-CH (CH) 2 CH 3 ) 2 ) 2-methyl-2-butyl (-C (CH) 3 ) 2 CH 2 CH 3 ) 3-methyl-2-butyl (-CH (CH) 3 )CH(CH 3 ) 2 ) 3-methyl-1-butyl (-CH) 2 CH 2 CH(CH 3 ) 2 ) 2-methyl-1-butyl (-CH) 2 CH(CH 3 )CH 2 CH 3 ) N-hexyl (-CH) 2 CH 2 CH 2 CH 2 CH 2 CH 3 ) 2-hexyl (-CH (CH) 3 )CH 2 CH 2 CH 2 CH 3 ) 3-hexyl (-CH (CH) 2 CH 3 )(CH 2 CH 2 CH 3 ) 2-methyl-2-pentyl-C(CH 3 ) 2 CH 2 CH 2 CH 3 ) 3-methyl-2-pentyl (-CH (CH) 3 )CH(CH 3 )CH 2 CH 3 ) 4-methyl-2-pentyl (-CH (CH) 3 )CH 2 CH(CH 3 ) 2 ) 3-methyl-3-pentyl (-C (CH) 3 )(CH 2 CH 3 ) 2 ) 2-methyl-3-pentyl (-CH (CH) 2 CH 3 )CH(CH 3 ) 2 ) 2, 3-dimethyl-2-butyl (-C (CH) 3 ) 2 CH(CH 3 ) 2 ) 3, 3-dimethyl-2-butyl (-CH (CH) 3 )C(CH 3 ) 3 ) 3, 3-dimethyl-butyl (-CH) 2 CH 2 C(CH 3 ) 3 ) N-heptyl, n-octyl, and the like. The term "alkyl" and its prefix "alkane" as used herein, both include straight and branched saturated carbon chains. The term "haloaliphatic" as used herein means that an aliphatic group is substituted with one or more of the same or different halogen atoms, wherein the aliphatic group or alkyl group has the meaning described herein, i.e., fluorine, chlorine, bromine or iodine, examples of which include, but are not limited to, trifluoromethyl, trifluoroethyl, and the like.
The term "haloalkyl" denotes an alkyl group substituted with one or more halogen atoms, wherein alkyl has the meaning described herein. In some embodiments, the haloalkyl group contains 1 to 12 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 10 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 8 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 6 carbon atoms; in other embodiments, the haloalkyl group contains 1 to 4 carbon atoms, and in still other embodiments, the haloalkyl group contains 1 to 3 carbon atoms. Examples include, but are not limited to, trifluoromethyl, trifluoroethyl, and the like.
The term "carboxy", whether used alone or in combination with other terms (e.g., "carboxyalkyl"), means-CO 2 H or-COOH.
The term "carbonyl", whether used alone or in combination with other terms (such as "aminocarbonyl" or "acyloxy"), means- (C = O) -.
The terms "alkylamino" and "alkylamino" are used interchangeably and include "N-alkylamino" and "N, N-dialkylamino" in which the amino groups are each independently substituted with one or two C 1-12 Alkyl groups. Wherein in some embodiments, alkylamino is one or two C 1-12 Lower alkylamino radical in which the alkyl group is attached to the nitrogen atom, in some embodiments the alkylamino radical is C 1-6 In some embodiments, alkylamino is C 1-4 Lower alkylamino groups of (a). Suitable alkylamino groups can be monoalkylamino or dialkylamino, examples of which include, but are not limited to, N-methylamino, N-ethylamino, N-dimethylamino, N-diethylamino, N-propylamino, N-dipropylamino, and the like, wherein the alkylamino groups can independently be unsubstituted or substituted with one or more substituents described herein.
The term "alkylene" refers to a saturated divalent hydrocarbon radical resulting from the removal of two hydrogen atoms from a straight or branched chain saturated hydrocarbon radical. Unless otherwise specified, the alkylene group contains 1 to 12 carbon atoms, in other embodiments 1 to 6 carbon atoms, in other embodiments 1 to 4 carbon atoms, and in other embodiments 1 to 3 carbon atoms. In other embodiments, the alkylene group contains 1 to 2 carbon atoms. Examples of this include methylene (-CH) 2 -) ethylene (-CH 2 CH 2 -, propylene (-CH) 2 CH 2 CH 2 -) isopropylidene (-CH (CH) 3 )CH 2 -) butylene (-CH) 2 CH 2 CH 2 CH 2 -) pentylene (-CH) 2 CH 2 CH 2 CH 2 CH 2 -), hexylene (-CH) 2 CH 2 CH 2 CH 2 CH 2 CH 2 -) heptylene (-CH 2 CH 2 CH 2 CH 2 CH 2 CH 2 CH 2 -) octylene (-CH) 2 CH 2 CH 2 CH 2 CH 2 CH 2 CH 2 CH 2 -) and the like, wherein the alkylene groups may independently be unsubstituted or substituted with one or more substituents described herein.
The term "alkenyl" denotes a straight or branched chain monovalent hydrocarbon group of 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein C-C in at least one position is sp 2 Double bonds, wherein the alkenyl group may be independently unsubstituted or substituted with one or more substituents as described herein, include the "cis", "trans" or "Z", "E" isomers, specific examples of which include, but are not limited to, vinyl (-CH = CH) 2 ) Propenyl (-CH = CHCH) 3 ) Allyl (-CH) 2 CH＝CH 2 ) And the like, wherein the alkenyl group can be independently unsubstituted or substituted with one or more substituents described herein.
The term "alkynyl" denotes a straight or branched chain monovalent hydrocarbon radical containing 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein at least one position of the C-C is a sp triple bond, and wherein the alkynyl radical may independently be unsubstituted or substituted with one or more substituents as described herein, specific examples include, but are not limited to, ethynyl (-C.ident.CH), propargyl (-CH) 2 C ≡ CH), propynyl (-C ≡ C-CH) 3 ) 1-alkynylbutyl (-CH) 2 CH 2 C ≡ CH), 2-alkynylbutyl (-CH) 2 C≡CCH 3 ) 3-alkynylbutyl (-C [ identical to ] CCH 2 CH 3 ) And the like, wherein the alkynyl group can be independently unsubstituted or substituted with one or more substituents described herein.
The term "alkoxy" means an alkyl group attached to the rest of the molecule through an oxygen atom, wherein the alkyl group has the meaning as described herein. Unless otherwise specified, the alkoxy group contains 1 to 20 carbon atoms, some examples of which are alkoxy groups containing 1 to 12 carbon atoms, other examples of which are alkoxy groups containing 1 to 8 carbon atoms, other examples of which are alkoxy groups containing 1 to 6 carbon atoms, other examples of which are alkoxy groups containing 1 to 4 carbon atoms, and other examples of which are alkoxy groups containing 1 to 3 carbon atoms.
Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH) 3 ) Ethoxy (EtO, -OCH) 2 CH 3 ) 1-propoxy (n-propoxy, n-PrO, n-propoxy, -OCH 2 CH 2 CH 3 ) 2-propoxy (isopropoxy, i-PrO, i-propoxy, -OCH (CH) 3 ) 2 ) 1-butoxy (n-BuO, n-butoxy, -OCH) 2 CH 2 CH 2 CH 3 ) 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH) 2 CH(CH 3 ) 2 ) 2-butoxy (s-BuO, s-butoxy, -OCH (CH) 3 )CH 2 CH 3 ) 2-methyl-2-propoxy (t-BuO, t-butoxy, -OC (CH) 3 ) 3 ) 1-pentyloxy (n-pentyloxy, -OCH) 2 CH 2 CH 2 CH 2 CH 3 ) 2-pentyloxy (-OCH (CH)) 3 )CH 2 CH 2 CH 3 ) 3-pentyloxy (-OCH (CH) 2 CH 3 ) 2 ) 2-methyl-2-butoxy (-OC (CH)) 3 ) 2 CH 2 CH 3 ) 3-methyl-2-butoxy (-OCH (CH) 3 )CH(CH 3 ) 2 ) 3-methyl-l-butoxy (-OCH) 2 CH 2 CH(CH 3 ) 2 ) 2-methyl-l-butoxy (-OCH) 2 CH(CH 3 )CH 2 CH 3 ) And the like, wherein the alkoxy group may independently be unsubstituted or substituted with one or more substituents described herein.
The term "haloalkoxy" denotes an alkoxy group substituted with one or more halogen atoms, wherein alkoxy has the meaning described herein. In some of these embodiments, the haloalkoxy group contains 1 to 12 carbon atoms; in still other embodiments, the haloalkoxy group contains 1 to 10 carbon atoms; in still other embodiments, the haloalkoxy group contains 1 to 8 carbon atoms; in still other embodiments, the haloalkoxy group contains 1 to 6 carbon atoms; in other embodiments, the haloalkoxy group contains 1 to 4 carbon atoms, and in still other embodiments, the haloalkoxy group contains 1 to 3 carbon atoms. Examples include, but are not limited to, trifluoromethoxy and the like.
The term "cycloalkyl" refers to a monocyclic, bicyclic, or tricyclic ring system containing 3 to 12 ring carbon atoms that is saturated, having one or more points of attachment to the rest of the molecule. In some of these embodiments, cycloalkyl is a ring system containing from 3 to 10 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 3 to 8 ring carbon atoms; in other embodiments, cycloalkyl groups are ring systems containing from 3 to 7 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 5 to 8 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 3 to 6 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing 5 to 6 ring carbon atoms; examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like, and the cycloalkyl groups can be independently unsubstituted or substituted with one or more substituents as described herein.
The terms "heterocyclyl" and "heterocycle" are used interchangeably herein and refer to a saturated or partially unsaturated, non-aromatic, monocyclic, bicyclic, or tricyclic ring system containing from 3 to 12 ring atoms, wherein at least one ring atom is selected from the group consisting of nitrogen, sulfur, and oxygen, and wherein the ring system has one or more attachment points to the remainder of the molecule. The term "heterocyclyl" includes monocyclic, bicyclic or polycyclic fused, spiro or bridged heterocyclic ring systems, as well as polycyclic ring systems in which the heterocyclic ring may be fused to one or more non-aromatic carbocyclic or heterocyclic rings or one or more aromatic rings or combinations thereof, wherein the radical or point of attachment is on the heterocyclic ring. Bicyclic heterocyclic groups include bridged bicyclic heterocyclic groups, fused bicyclic heterocyclic groups, and spiro bicyclic heterocyclic groups. Unless otherwise stated, -CH of a heterocyclic radical 2 The-group may optionally be replaced by-C (= O) -. The sulfur atom of the ring may optionally be oxidized to the S-oxide. The nitrogen atom of the ring may optionally be oxidized to an N-oxygen compound. In some embodiments, heterocyclyl is a ring system of 3-12 ring atoms; in other embodiments, heterocyclyl consists of 3 to 8 ring atomsThe ring system of (a); in other embodiments, heterocyclyl is a ring system of 3-6 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-7 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-8 ring atoms; in other embodiments, heterocyclyl is a ring system of 6-8 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-6 ring atoms; in other embodiments, heterocyclyl is a ring system of 3 ring atoms; in other embodiments, heterocyclyl is a ring system of 4 ring atoms; in other embodiments, heterocyclyl is a ring system of 5 ring atoms; in other embodiments, heterocyclyl is a ring system of 6 ring atoms; in other embodiments, heterocyclyl is a ring system of 7 ring atoms; in other embodiments, heterocyclyl is a ring system of 8 ring atoms.
Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuryl, dihydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thiaxazinyl, piperazinyl, homopiperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxetanyl, azepinyl, thietanyl, oxaazepinyl, thiazepinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1, 3-dioxopentyl, pyrazolinyl, dithianyl, dithiazolyl, dihydrothienyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 1,2,3, 4-tetrahydroisoquinolinyl, 3-azabicyclo [3.1.0] hexyl, 3-azabicyclo [4.1.0] heptyl, azabicyclo [ 2.2.2.2 ] hexyl, 3H-indolyl, and N-quinolizinyl. Examples of heterocyclic groups also include, 1-dioxothiomorpholinyl; examples of the group in which a carbon atom on the ring is substituted with an oxo (= O) group include, but are not limited to, pyrimidinedione group, 1,2, 4-thiadiazol-5 (4H) -one group, 1,2, 4-oxadiazol-5 (4H) -one group, 1H-1,2, 4-triazol-5 (4H) -one group and the like; examples where the carbon atoms on the ring are substituted with = S groups include, but are not limited to, 1,2, 4-oxadiazol-5 (4H) -thioketo, 1,3, 4-oxadiazol-2 (3H) -thioketo, and the like. The heterocyclyl group may be optionally substituted with one or more substituents as described herein.
The term "M-M 1 "consisting of one ring atom" means that the cyclic group consists of M-M 1 And the ring atoms comprise carbon atoms and/or heteroatoms such as O, N, S, P and the like. For example, "heteroaryl of 6 to 10 atoms" means that it includes heteroaryl of 6,7, 8, 9 or 10 atoms.
The term "heteroalkylene" means an alkylene group substituted with 1 or 2 heteroatoms selected from O, S, N or P, the alkylene group having the meaning described herein, an embodiment of "heteroalkylene" is-CH 2 -O-CH 2 -、-CH 2 -NH-CH 2 -、-CH 2 -CH 2 -NH-, etc.
The term "heteroatom" means one or more of O, S, N, P and Si, including any oxidation state form of N, S and P; primary, secondary, tertiary amines and quaternary ammonium salt forms; or a form in which a hydrogen on a nitrogen atom in the heterocycle is substituted, for example, N (like N in 3, 4-dihydro-2H-pyrrolyl), NH (like NH in pyrrolidinyl) or NR (like NR in N-substituted pyrrolidinyl, R representing a substituent as described herein).
The term "halogen" or "halogen atom" refers to F, cl, br or I.
The term "unsaturated" as used herein means that the moiety contains one or more degrees of unsaturation.
The term "aryl" used alone or as a majority of "aralkyl", "aralkoxy", or "aryloxyalkyl" refers to monocyclic, bicyclic, and tricyclic carbon ring systems containing 6 to 14 carbon atoms, or 6 to 12 carbon atoms, or 6 to 10 carbon atoms, wherein at least one ring system is aromatic, wherein each ring system contains 3 to 7 carbon atoms forming a ring and one or more attachment points are attached to the rest of the molecule. The term "aryl" may be used interchangeably with the terms "aromatic ring" or "aromatic ring", e.g., aryl may include phenyl, naphthyl and anthracenyl. The aryl group can be independently unsubstituted or substituted with one or more substituents described herein.
The term "heteroaryl" may be used alone or as a majority of "heteroarylalkyl" or "heteroarylalkoxy" and denotes monocyclic, bicyclic or tricyclic ring systems containing 5 to 16 ring atoms, at least one of which is aromatic and at least one of which contains one or more heteroatoms, wherein each ring system contains a ring of 5 to 7 ring atoms and one or more attachment points to the rest of the molecule. The term "heteroaryl" may be used interchangeably with the terms "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is a heteroaryl consisting of 5 to 14 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 to 12 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 to 10 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 to 8 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 to 7 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 to 6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N.
In other embodiments, heteroaryl includes, but is not limited to, the following monocyclic groups: 2-furyl, 3-furyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, pyridazinyl (e.g. 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (e.g. 5H-tetrazolyl, 2H-tetrazolyl), triazolyl (e.g., 2-triazolyl, 5-triazolyl, 4H-1,2, 4-triazolyl, 1,2, 3-triazolyl), 2-thienyl, 3-thienyl, pyrazolyl (e.g., 2-pyrazolyl and 3-pyrazolyl), isothiazolyl, 1,2, 3-oxadiazolyl, 1,2, 5-oxadiazolyl, 1,2, 4-oxadiazolyl, 1,3, 4-oxadiazolyl, 1,2, 3-thiooxadiazolyl, 1,3, 4-thiooxadiazolyl, 1,2, 5-thiooxadiazolyl, pyrazinyl, 1,3, 5-triazinyl; the following bi-or tricyclic groups are also included, but are in no way limited to these groups: benzimidazolyl, benzofuranyl, benzothienyl, indolyl (e.g., 2-indolyl), purinyl, quinolyl (e.g., 2-quinolyl, 3-quinolyl, 4-quinolyl), isoquinolyl (e.g., 1-isoquinolyl, 3-isoquinolyl, or 4-isoquinolyl), phenoxathiyl, dibenzoimidazolyl, dibenzofuranyl, or dibenzothienyl, and the like. The heteroaryl group is optionally substituted with one or more substituents described herein.
The term "alkylthio" includes C 1-12 A linear or branched alkyl group is attached to a divalent sulfur atom, wherein the alkyl group has the meaning as described herein. In some of these embodiments, the alkylthio group is a lower C 1-6 Alkylthio, in other embodiments, the alkylthio is lower C 1-4 Alkylthio, in other embodiments, the alkylthio is lower C 1-3 Alkylthio groups, and such examples include, but are not limited to, methylthio (CH) 3 S-), ethylthio, and the like.
Unless otherwise indicated, the structural formulae depicted herein include all isomeric forms (e.g., enantiomeric, diastereomeric, and geometric (or conformational) isomers): for example, the R, S configuration containing asymmetric centers, the (Z), (E) isomers of the double bond, and the conformational isomers of (Z), (E). Thus, individual stereochemical isomers of the compounds of the present invention or mixtures of enantiomers, diastereomers, or geometric isomers (or conformers) thereof are within the scope of the present invention.
As used herein, "nitroxide" means that when a compound contains several amine functional groups, 1 or more than 1 nitrogen atom can be oxidized to form an N-oxide. Specific examples of N-oxides are N-oxides of tertiary amines or N-oxides of nitrogen-containing heterocyclic nitrogen atoms. The corresponding amines can be treated with an oxidizing agent, such as hydrogen peroxide or a peracid (e.g., peroxycarboxylic acid), to form the N-oxide (see Advanced Organic Chemistry, wiley Interscience, 4 th edition, jerry March, pages). In particular, the N-oxide may be prepared by the method of l.w. ready (syn.comm.1977, 7, 509-514) in which an amine compound is reacted with m-chloroperoxybenzoic acid (MCPBA), for example, in an inert solvent such as dichloromethane.
The term "prodrug", as used herein, represents a compound that is converted in vivo to a compound of formula (I). Such conversion is effected by hydrolysis of the prodrug in the blood or by enzymatic conversion to the parent structure in the blood or tissue. The prodrug compound of the invention can be ester, and in the prior invention, the ester can be used as the prodrug and comprises phenyl ester and aliphatic (C) 1-24 ) Esters, acyloxymethyl esters, carbonates, carbamates and amino acid esters. For example, a compound of the present invention contains a hydroxy group, i.e., it can be acylated to provide the compound in prodrug form. Other prodrug forms include phosphate esters, such as those obtained by phosphorylation of a hydroxyl group on the parent. For a complete discussion of prodrugs, reference may be made to the following: T.Higuchi and V.Stella, pro-drugs as Novel Delivery Systems, vol.14of the A.C.S.Symphosis Series, edward B.Roche, ed., bioreversible Carriers in Drug designs, american Pharmaceutical Association and Pergamon Press,1987, J.Rautio et al, prodrugs.
Unless otherwise indicated, all tautomeric forms of the compounds of the invention are included within the scope of the invention. Additionally, unless otherwise indicated, the structural formulae for the compounds described herein include isotopically enriched versions of one or more different atoms.
"metabolite" refers to the product of a particular compound or salt thereof obtained by metabolism in vivo. Metabolites of a compound can be identified by techniques well known in the art, and its activity can be characterized by assay methods as described herein. Such products may be obtained by subjecting the administered compound to oxidation, reduction, hydrolysis, amidation, deamidation, esterification, defatting, enzymatic cleavage, and the like. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a compound of the present invention with a mammal for a sufficient period of time.
The definition and convention of stereochemistry in the present invention is generally used with reference to the following documents: S.P. Parker, ed., mcGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, new York; and Eliel, E.and Wilen, S., "stereoschemistry of Organic Compounds", john Wiley & Sons, inc., new York,1994. All stereoisomeric forms of the compounds of the present invention, including, but in no way limited to, diastereomers, enantiomers, atropisomers, and mixtures thereof, such as racemic mixtures, form part of the present invention. Many organic compounds exist in optically active form, i.e., they have the ability to rotate the plane of plane polarized light. In describing optically active compounds, the prefix D, L or R, S is used to indicate the absolute configuration of the chiral center of the molecule. The prefixes d, l or (+), (-) are used to designate the sign of the rotation of plane polarized light of the compound, with (-) or l indicating that the compound is left-handed and the prefix (+) or d indicating that the compound is right-handed. The chemical structures of these stereoisomers are identical, but their stereo structures are different. A particular stereoisomer may be an enantiomer, and a mixture of isomers is generally referred to as a mixture of enantiomers. 50:50 is called a racemic mixture or racemate, which may result in no stereoselectivity or stereospecificity during the chemical reaction. The terms "racemic mixture" and "racemate" refer to a mixture of two enantiomers in equimolar amounts, lacking optical activity.
The term "tautomer" or "tautomeric form" means that isomers of structures of different energies may be interconverted through a low energy barrier. For example, proton tautomers (i.e., tautomers of proton transfer) include interconversion by proton migration, such as keto-enol and imine-enamine isomerizations. Valence (valence) tautomers include tautomers that recombine into bond electrons.
As used herein, "pharmaceutically acceptable salts" refer to organic and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as are: berge et al, description of the scientific acceptable salts in detail in J. Pharmaceutical Sciences, 66. Pharmaceutically acceptable non-toxic acid salts include, but are not limited to, salts of inorganic acids formed by reaction with amino groups such as hydrochlorides, hydrobromides, phosphates, sulfates, perchlorates, and salts of organic acids such as acetates, oxalates, maleates, tartrates, citrates, succinates, malonates, or those obtained by other methods described in the literature above, such as ion exchange. Other pharmaceutically acceptable salts include adipates, malates, 2-hydroxypropionates, alginates, ascorbates, aspartates, benzenesulfonates, benzoates, bisulfates, borates, butyrates, camphorates, camphorsulfonates, cyclopentylpropionates, digluconates, dodecylsulfates, ethanesulfonates, formates, fumarates, glucoheptonates, glycerophosphates, gluconates, hemisulfates, heptanoates, hexanoates, hydroiodiates, 2-hydroxy-ethanesulfonates, lactobionates, lactates, laurylsulfates, malates, malonates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, palmitates, pamoates, pectinates, persulfates, 3-phenylpropionates, picratesSalts, pivalate salts, propionate salts, stearate salts, thiocyanate salts, p-toluenesulfonate salts, undecanoate salts, valerate salts, and the like. If the compounds of the invention are acidic, the desired salts can be prepared by suitable methods, e.g., using inorganic or organic bases, such as ammonia (primary, secondary, tertiary), alkali metal hydroxides, ammonium, N + (R 14 ) 4 Salts and alkaline earth metal hydroxides, and the like. Suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, ammonia, such as primary, secondary and tertiary, N + (R 14 ) 4 Salts, e.g. R 14 Is H, C 1-4 Alkyl radical, C 6-10 Aryl radical, C 6-10 Aryl radical C 1-4 Alkyl, etc., and cyclic amines such as piperidine, morpholine, piperazine, etc., and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Also included are suitable, non-toxic ammonium, quaternary ammonium salts and amine cations resistant to formation of counterions, e.g., halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C 1-8 Sulfonates and aromatic sulfonates.
"solvate" of the present invention refers to an association of one or more solvent molecules with a compound of the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, aminoethanol. The term "hydrate" refers to an association of solvent molecules that is water.
The term "protecting group" or "Pg" refers to a substituent that when reacted with another functional group, is typically used to block or protect a particular functionality. For example, "amino protecting group" refers to a substituent attached to an amino group to block or protect the functionality of the amino group in a compound, and suitable amino protecting groups include acetyl, trifluoroacetyl, t-Butoxycarbonyl (BOC), benzyloxycarbonyl (CBZ) and 9-fluorenylmethylenoxycarbonyl (Fmoc). Similarly, "hydroxyl protecting group" refers to the functionality of a substituent of a hydroxyl group to block or protect the hydroxyl group, and suitable protecting groups include acetyl and silyl groups. "carboxyl protecting group"refers to the functionality of a substituent of a carboxyl group to block or protect the carboxyl group, typical carboxyl protecting groups include-CH 2 CH 2 SO 2 Ph, cyanoethyl, 2- (trimethylsilyl) ethyl, 2- (trimethylsilyl) ethoxymethyl, 2- (p-toluenesulfonyl) ethyl, 2- (p-nitrobenzenesulfonyl) ethyl, 2- (diphenylphosphino) ethyl, nitroethyl, and the like. General descriptions of protecting groups can be found in the literature: greene, protective Groups in Organic Synthesis, john Wiley&Sons,New York,1991；and P.J.Kocienski,Protecting Groups,Thieme,Stuttgart,2005。
Description of the Compounds of the invention
The compound and the pharmaceutically acceptable composition thereof can effectively inhibit HBV infection.
In one aspect, the invention relates to a compound of formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (I), or a prodrug thereof, wherein:
Figure BDA0002214794320000141
each X 1 And X 2 Independently of one another is CR 7 Or N;
R 1 is R 1a O-or R a R b N-；
R 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolylIndependently of one another, the radicals, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are unsubstituted or substituted by 1,2,3 or 4R x Substituted by 1,2 or 3R x Substituted;
or, R 2 Is C 1-4 Alkoxy radical, simultaneously, R 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is 1-4 Alkoxy is unsubstituted or substituted by 1,2,3 or 4R w Substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, and heteroaryl of 6 to 10 ring atoms are each independently unsubstituted or substituted with 1,2,3, or 4R x1 Substituted;
each R x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -C 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is 8 -C 1-4 C in alkylene 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
R 8 is F, cl, br, CN, = O, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently is C 1-6 Alkyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R h Substituted;
each R k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, = O, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R h And R w Independently deuterium, F, cl, br, HO-, = O, HOOC-, amino、C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-7 Cycloalkyl, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl and C 3-7 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, C 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently is H, deuterium, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl radical, C 6-10 Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl radical, C 6-10 Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 AlkylamineSubstituted by a substituent of the group.
In another aspect, the present invention relates to a compound that is a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt, or a prodrug thereof of the compound of formula (II) or the compound of formula (II), wherein:
Figure BDA0002214794320000151
each X 1 And X 2 Independently is CR 7 Or N;
R 1 is R 1a O-or R a R b N-；
R 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x Substituted by 1,2 or 3R x Substituted;
or, R 2 Is C 1-4 Alkoxy radicals, in the meantime, R 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is 1-4 Alkoxy is unsubstituted or substituted by 1,2,3 or 4R w Substituted pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolylThienyl and heteroaryl of 6 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R x1 Substituted;
each R x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -C 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is 8 -C 1-4 C in alkylene 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
R 8 is F, cl, br, CN, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently is C 1-6 Alkyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R h Substituted;
each R k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, = O, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R h And R w Independently deuterium, F, cl, br, HO- = O, HOOC-, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-7 Cycloalkyl, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl and C 3-7 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, C 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently is H, deuterium, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl radical, C 6-10 Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 6-10 Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 Substituted by alkylamino.
In another aspect, the present invention relates to a compound that is a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt, or a prodrug thereof of the compound of formula (II) or the compound of formula (II), wherein:
Figure BDA0002214794320000161
each X 1 And X 2 Independently is CR 7 Or N;
R 1 is R 1a O-or R a R b N-；
R 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4R x Substituted;
or, R 2 Is C 1-4 Alkoxy radical, simultaneously, R 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, C is 1-4 Alkoxy is unsubstituted or substituted by 1,2,3 or 4R w And (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4R x1 Substituted;
each R x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -C 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is 8 -C 1-4 C in alkylene 1-4 Alkylene, amino, C 1-12 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
R 8 is F, cl, br, CN, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently is C 1-6 Alkyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R h Substituted;
each R k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 AlkylamineBase, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C 6-10 Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, = O, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R h And R w Independently deuterium, F, cl, br, HO-, = O, HOOC-, amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-7 Cycloalkyl, wherein said amino, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Alkylamino radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl and C 3-7 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy radical, C 1-6 Alkylthio radical, C 1-6 Haloalkoxy or C 1-6 Substituted by alkylamino;
each R 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, C 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is 1-6 Alkyl radical, C 1-6 Alkylamino radical, C 1-6 Alkoxy radical, C 2-6 Alkynyl, C 2-6 Alkenyl radical, C 3-7 Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently is H, deuterium, C 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl radical, C 6-10 Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is 1-6 Alkyl radical, C 1-6 Alkoxy radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 6-10 Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, amino, C 1-6 Alkyl radical, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 Substituted by alkylamino.
In some embodiments, R is as described herein 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x Substituted by 1,2 or 3R x Substituted;
or, R 2 Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinylPyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4R w Substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x1 Substituted;
wherein each R is a ，R b ，R w ，R x And R x1 Have the meaning described in the present invention.
In some embodiments, R is as described herein 2 Is HO-, R a R b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3R w Substituted;
R 3 is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x Substituted;
or, R 2 Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is 3 Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxazolylOxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4R w Substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R x1 Substituted;
wherein each R is a ，R b ，R w ，R x And R x1 Have the meaning as described in the present invention.
In some embodiments, each R described herein x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -C 1-3 Alkylene, amino, C 1-6 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein R is as defined above 8 -C 1-3 C in alkylene 1-3 Alkylene, amino, C 1-6 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
wherein each R is a 、R b 、R 8 And R k Have the meaning as described in the present invention.
In some embodiments, each R described herein x And R x1 Independently of each otherDeuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -CH 2 -、R 8 -(CH 2 ) 2 -、R 8 -(CH 2 ) 3 -, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is as defined above 8 -CH 2 -CH of (A-O-) 2 -、R 8 -(CH 2 ) 2 In (C) - (CH) 2 ) 2 -、R 8 -(CH 2 ) 3 In- (CH) 2 ) 3 -, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted with 1,2,3 or 4R k Substituted;
wherein each R is a 、R b 、R 8 And R k Have the meaning described in the present invention.
In some embodimentsIn the invention, each R is x And R x1 Independently is deuterium, F, cl, br, HO-, HOOC-, R a R b N-、R 8 -CH 2 -、R 8 -(CH 2 ) 2 -、R 8 -(CH 2 ) 3 -, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is 8 -CH 2 -CH of (A-O-) 2 -、R 8 -(CH 2 ) 2 In- (CH) 2 ) 2 -、R 8 -(CH 2 ) 3 In (C) - (CH) 2 ) 3 -, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4R k Substituted;
wherein each R is a 、R b 、R 8 And R k Have the meaning described in the present invention.
In some embodiments, each R described herein 8 Is F, cl, br, CN, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-4 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C 6-10 Aryl, heteroaryl of 5 ring atoms or heteroaryl of 6 ring atoms, wherein said amino, C 1-4 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, C 6-10 Aryl, heteroaryl of 5 ring atoms and heteroaryl of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently is C 1-4 Alkyl radical, C 3-6 Cycloalkyl or heterocyclyl consisting of 3 to 6 ring atoms, wherein said C is 1-4 Alkyl radical, C 3-6 Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R h Substituted;
wherein each R is 8 、R c 、R f And R h Have the meaning as described in the present invention.
In some embodiments, R is as described herein 8 Is F, cl, br, CN, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C 1-3 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thiaCyclobutyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein said amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C 1-3 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4R f Substituted;
each R 10 And R 11 Independently methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substitutedBy 1,2,3 or 4R h Substituted;
wherein each R is 8 、R c 、R f And R h Have the meaning as described in the present invention.
In some embodiments, each R described herein k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-4 Alkyl radical, C 1-6 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein said amino, C 1-4 Alkyl radical, C 1-6 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, cl, br, CN, OH, = O, amino, C 1-4 Alkyl radical, C 1-4 Haloalkyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Haloalkoxy or C 1-4 Substituted by alkylamino;
each R h And R w Independently is deuterium, F, cl, br, HO-, HOOC-, amino, C 1-4 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl or C 3-6 Cycloalkyl, wherein said amino, C 1-4 Alkyl radical, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl and C 3-6 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, cl, br, CN, HO- = O, amino, C 1-4 Alkyl radical, C 1-4 Haloalkyl, C 1-4 Alkoxy radical, C 1-4 Alkylthio radical, C 1-4 Haloalkoxy or C 1-4 Substituted by alkylamino;
wherein each R is 10 、R 11 And R c Have the meaning as described in the present invention.
In some embodiments, each R described herein k And R f Independently is deuterium, F, cl, br, HO-, HOOC-, R 10 -(C＝O)-N(R c )、R 11 -S(＝O) 2 -N(R c ) -, amino, C 1-3 Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C 1-3 Alkylthio radical, C 1-3 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein said amino group, C 1-3 Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C 1-3 Alkylthio radical, C 1-3 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl, each independently unsubstituted or substituted by 1,2,3, or 4 groups selected from F, cl, br, CN, HO-, = O, amino, C 1-3 Alkyl radical, C 1-3 Haloalkyl, C 1-3 Alkoxy radical, C 1-3 Alkylthio radical, C 1-3 Haloalkoxy or C 1-3 Substituted by alkylamino;
each R h And R w Independently deuterium, F, cl, br, HO- = O, HOOC-, amino, C 1-3 Alkyl radical, C 1-3 Alkoxy radical, C 1-3 Alkylthio radical, C 1-3 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl or C 3-6 Cycloalkyl, wherein said amino, C 1-3 Alkyl radical, C 1-3 Alkoxy radical, C 1-3 Alkylthio radical, C 1-3 Alkylamino radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl and C 3-6 Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, amino, C 1-3 Alkyl radical, C 1-3 Haloalkyl, C 1-3 Alkoxy radical, C 1-3 Alkylthio radical, C 1-3 Haloalkoxy or C 1-3 Substituted by alkylamino;
wherein each R is 10 、R 11 And R c Have the meaning as described in the present invention.
In some embodiments, each R is as described herein 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkylamino radical, C 1-4 Alkoxy radical, C 2-4 Alkynyl, C 2-4 Alkenyl radical, C 3-6 Cycloalkyl or heterocyclic group consisting of 3 to 6 ring atoms, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkylamino radical, C 1-4 Alkoxy radical, C 2-4 Alkynyl, C 2-4 Alkenyl radical, C 3-6 Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkoxy radical,C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkoxy radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, cl, br, CN, HO-, amino, C 1-4 Alkyl radical, C 1-4 Haloalkyl, C 1-4 Alkoxy or C 1-4 Substituted by alkylamino;
wherein each R is w Have the meaning as described in the present invention.
In some embodiments, each R described herein 4 、R 5 、R 6 、R 7 And R 9 Independently hydrogen, deuterium, F, cl, br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, C 1-4 Alkylamino radical, C 1-4 Alkoxy radical, C 2-4 Alkynyl, C 2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinylA group selected from the group consisting of a tetrahydrofuryl group, a tetrahydrothienyl group, a tetrahydropyranyl group, a tetrahydrothiopyranyl group, a piperidyl group, a morpholinyl group, a thiomorpholinyl group and a piperazinyl group, wherein said methyl group, ethyl group, n-propyl group, isopropyl group, n-butyl group, isobutyl group, tert-butyl group, C 1-4 Alkylamino radical, C 1-4 Alkoxy radical, C 2-4 Alkynyl, C 2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substituted by 1,2,3, or 4R w Substituted;
each R 1a 、R a 、R b And R c Each independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkoxy radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C 1-4 Alkoxy radical, C 2-4 Alkenyl radical, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-Triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4 groups selected from F, cl, br, CN, HO-, amino, C 1-4 Alkyl radical, C 1-4 Haloalkyl, C 1-4 Alkoxy or C 1-4 Substituted by alkylamino;
wherein each R is w Have the meaning as described in the present invention.
In some embodiments, the present invention relates to compounds, or stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof, of one of the following, but in no way limited to these compounds:
Figure BDA0002214794320000211
/>
Figure BDA0002214794320000221
/>
Figure BDA0002214794320000231
/>
Figure BDA0002214794320000241
/>
Figure BDA0002214794320000251
unless otherwise specified, stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof of the compounds of formula (I) are included within the scope of the present invention.
In another aspect, the present invention also provides a pharmaceutical composition comprising the compound of the present invention, optionally further comprising a pharmaceutically acceptable adjuvant or a combination of said adjuvants.
In some embodiments, the pharmaceutical composition of the present invention further comprises an additional anti-HBV agent.
In other embodiments, the pharmaceutical composition of the invention, wherein the anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.
In some embodiments, the anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, alloferon, simon interleukin, cladribine, emtricitabine, famciclovir, interferon, calamine CP, intefine, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, mevoxil, nitazoxanide, peginterferon alpha-2 a, ribavirin, roscovitine-a, cizopran, euforavac, anil, fosphazid, heplisav, interferon alpha-2 b, levamisole, or propafege.
In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient.
In some embodiments, the use of the invention, wherein the viral disease is hepatitis b virus infection or a disease caused by hepatitis b virus infection.
In still other embodiments, the use of the present invention, wherein the disease caused by hepatitis b virus infection is liver cirrhosis or hepatocellular carcinoma.
In another aspect, the invention also provides the use of said compound or said pharmaceutical composition in the manufacture of a medicament for inhibiting HBsAg production or secretion, and/or for inhibiting HBV DNA production or replication.
In another aspect, the invention relates to the use of said compound or pharmaceutical composition in the manufacture of a medicament for the prevention, treatment or alleviation of hepatitis b disease in a patient.
Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a compound of the invention.
Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a pharmaceutical composition comprising a compound of the invention.
Another aspect of the invention relates to the use of a compound of the invention in the manufacture of a medicament for the prevention, treatment or treatment of HBV disorders in a patient and for lessening the severity thereof.
Another aspect of the present invention relates to the use of a pharmaceutical composition comprising a compound of the present invention in the manufacture of a medicament for preventing or treating HBV conditions in a patient and reducing the severity thereof.
Another aspect of the invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or composition of the invention in an amount effective to inhibit HBV. In other embodiments, the method further comprises contacting the cell with an additional anti-HBV agent.
Another aspect of the present invention relates to a method of treating HBV disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.
Another aspect of the present invention pertains to a method of inhibiting HBV infection in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.
Another aspect of the invention relates to methods for the preparation, isolation and purification of compounds encompassed by formula (I).
The invention also encompasses the use of the compounds of the invention and pharmaceutically acceptable salts thereof for the manufacture of a pharmaceutical product effective in inhibiting HBV infection, including those described herein. The application of the compound of the invention in the production of the drugs for effectively inhibiting HBV infection. The compounds of the invention are also useful in the manufacture of a medicament for alleviating, preventing, controlling or treating a condition of hepatitis b in a patient. The present invention encompasses pharmaceutical compositions comprising a therapeutically effective amount of a compound represented by formula (I) in combination with at least one pharmaceutically acceptable excipient.
The invention also encompasses a method of effectively inhibiting HBV-infected diseases, or susceptibility to such conditions, which comprises treating a patient with a therapeutically effective amount of a compound represented by formula (I).
Unless otherwise indicated, all stereoisomers, tautomers, nitric oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof, of the compounds of the invention are within the scope of the invention.
In particular, the salts are pharmaceutically acceptable salts. The term "pharmaceutically acceptable" includes materials or compositions which must be compatible chemically or toxicologically, with the other components comprising the formulation, and with the mammal being treated.
The salts of the compounds of the present invention also include intermediates used in the preparation or purification of the compounds of formula (I) or salts of formula (I) or isomers thereof, but are not necessarily pharmaceutically acceptable salts.
The term "pharmaceutically acceptable" refers to a substance that is acceptable from a toxicological standpoint for pharmaceutical use and does not adversely interact with the active ingredient.
If the compounds of the invention are basic, the desired salts may be prepared by any suitable method provided in the literature, for example, using inorganic acids such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric and the like; or using organic acids such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, malic acid, 2-hydroxypropionic acid, citric acid, oxalic acid, glycolic acid, and salicylic acid; pyranonic acids, such as glucuronic and galacturonic acids; alpha-hydroxy acids such as citric acid and tartaric acid; amino acids such as aspartic acid and glutamic acid; aromatic acids such as benzoic acid and cinnamic acid; sulfonic acids such as p-toluenesulfonic acid, benzenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, trifluoromethanesulfonic acid, and the like, or combinations thereof.
If the compound of the invention is acidic, the desired salt can be prepared by a suitable method, and the inorganic base is lithium salt, sodium salt, potassium salt, calcium salt, magnesium salt, aluminum salt, ferric salt, ferrous salt, manganese salt, manganous salt, copper salt, zinc salt, ammonium salt and the like of the compound shown in the formula (I); organic bases, such as salts of compounds of formula (I) with methylamine, dimethylamine, trimethylamine, ethylamine, diethylamine, triethylamine, tromethamine, diethylaminoethanol, isopropylamine, 2-ethylamino ethanol, pyridine, picoline, ethanolamine, diethanolamine, ammonium, dimethylethanolamine, tetramethylammonium, tetraethylammonium, triethanolamine, piperidine, piperazine, morpholine, imidazolium salts, lysine, arginine, L-arginine, histidine, N-methylglucamine, dimethylglucamine, ethylglucamine, dicyclohexylamine, 1, 6-hexanediamine, ethylenediamine, glucamine, sarcosine, serinol, aminopropanediol, 1-amino-2, 3, 4-butanetriol, L-lysine, ornithine, and the like.
Pharmaceutical compositions, formulations, administration of the compounds of the invention and uses of the compounds and pharmaceutical compositions
The pharmaceutical composition comprises a compound with a structure shown in a formula (I) or a compound with a structure shown in an embodiment, or a stereoisomer, a tautomer, an oxynitride, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, and pharmaceutically acceptable auxiliary materials. The compound in the composition can effectively inhibit the hepatitis B virus, and is suitable for treating diseases caused by the virus, particularly acute and chronic persistent HBV virus infection.
For the compounds of the invention, mention may be made of the indicator regions, for example: treatment of acute and chronic viral infections, which may lead to infectious hepatitis, e.g., hepatitis B virus infection. The compounds of the invention are particularly suitable for the treatment of chronic hepatitis B virus infection and acute hepatitis B virus infection.
The invention encompasses pharmaceutical preparations which, in addition to nontoxic, inert, pharmaceutically suitable adjuvants, also contain one or more compounds (I) or compositions according to the invention.
The above pharmaceutical preparation may also contain other active pharmaceutical ingredients than compound (I).
The compounds of the invention exist in free form or, where appropriate, as pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adduct or derivative capable of being administered directly or indirectly to a patient in need thereof, compounds described in other aspects of the invention, metabolites thereof, or residues thereof.
As described herein, the pharmaceutical composition of the present invention comprises any one of the compounds of formula (I) of the present invention, and further comprises pharmaceutically acceptable excipients, which, for example, as used herein, include any solvent, solid excipient, diluent, binder, disintegrant, or other liquid excipient, dispersant, flavoring or suspending agent, surfactant, isotonic agent, thickening agent, emulsifier, preservative, solid binder or lubricant, and the like, suitable for the particular target dosage form. As described in: in Remington, the Science and Practice of Pharmacy,21st edition,2005, ed.D.B.Troy, lippincott Williams and Wilkins, philadelphia, and Encyclopedia of Pharmaceutical technology, eds.J.Swarbrick and J.C.Boylan,1988-1999, marcel Dekker, new York, taken together with The disclosure of The literature, indicates that different adjuvants can be used In The preparation of pharmaceutically acceptable compositions and their well-known methods of preparation. Except insofar as any conventional adjuvant is incompatible with the compounds of the invention, e.g., any adverse biological effect produced or interaction in a deleterious manner with any other component of a pharmaceutically acceptable composition, its use is contemplated by the present invention.
Substances that may serve as pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum albumin; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; a mixture of partial glycerides of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silica; magnesium trisilicate; polyvinylpyrrolidone; polyacrylate esters; a wax; polyethylene-polyoxypropylene-blocking polymers; lanolin; sugars, such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gum powder; malt; gelatin; talc powder; adjuvants such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic salt; ringer's solution; ethanol; phosphoric acid buffer solution; and other non-toxic suitable lubricants such as sodium lauryl sulfate and magnesium stearate; a colorant; a release agent; coating the coating material; a sweetener; a flavoring agent; a fragrance; preservatives and antioxidants.
Pharmaceutical compositions of the compounds of the invention may be administered in any of the following ways: oral administration, inhalation by spray, topical administration, rectal administration, nasal administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrapulmonary, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or by means of a reservoir of external value. Preferred modes of administration are oral, intramuscular, intraperitoneal or intravenous.
Pharmaceutical compositions of the compounds of the present invention may be administered in any of the following ways: oral administration, spray inhalation, topical administration, rectal administration, nasal administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrapulmonary, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or administration via an explanted reservoir. Preferred modes of administration are oral, intramuscular, intraperitoneal or intravenous.
The compounds of the present invention or compositions containing them which are pharmaceutically acceptable may be administered in unit dosage form. The administration dosage form can be liquid dosage form or solid dosage form. The liquid dosage form can be true solution, colloid, microparticle, or suspension. Other dosage forms such as tablet, capsule, dripping pill, aerosol, pill, powder, solution, suspension, emulsion, granule, suppository, lyophilized powder for injection, clathrate, implant, patch, liniment, etc.
Oral tablets and capsules may contain excipients such as binding agents, for example syrup, acacia, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example lactose, sucrose, corn starch, calcium phosphate, sorbitol, glycine; lubricants, such as magnesium stearate, talc, polyethylene glycol, silica; disintegrants, for example potato starch; or acceptable humectants such as sodium lauryl sulfate. The tablets may be coated by methods known in the art of pharmacy.
Oral liquids may be prepared as suspensions, solutions, emulsions, syrups or elixirs in water and oil, or as dry products, supplemented with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, sorbitol, cellulose methyl ether, glucose syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gel, hydrogenated edible fats and oils; emulsifying agents, for example lecithin, sorbitan monooleate, acacia; or non-aqueous vehicles (which may include edible oils), such as almond oil; fats and oils such as glycerin, ethylene glycol or ethanol; preservatives, e.g. methyl or propyl p-hydroxybenzoates, sorbic acid. Flavoring or coloring agents may be added if desired.
Suppositories may contain conventional suppository bases such as cocoa butter or other glycerides.
For parenteral administration, the liquid dosage form is usually prepared from the compound and a sterile excipient. The auxiliary material is preferably water. According to different selected adjuvants and drug concentrations, the compound can be dissolved in adjuvants or made into suspension solution, and can be dissolved in water for injection, filtered, sterilized and filled into sealed bottle or ampoule.
When applied topically to the skin, the compounds of the present invention may be formulated in the form of a suitable ointment, lotion, or cream in which the active ingredient is suspended or dissolved in one or more excipients which may be used in ointment formulations including, but not limited to: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; lotions and creams adjuvants that may be used include, but are not limited to: mineral oil, sorbitan monostearate, tween 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
In general, it has proven advantageous, both in human medicine and in veterinary medicine, to administer the active compounds according to the invention in a total amount of from about 0.01 to 500mg/kg of body weight, preferably from 0.01 to 100mg/kg of body weight, if appropriate in multiple single doses, per 24 hours in order to achieve the desired effect. The amount of active compound contained in a single dose is preferably about 1 to 80mg/kg body weight, more preferably 1 to 50mg/kg body weight, but may be varied from the above-mentioned dose, i.e., depending on the kind and body weight of the subject to be treated, the nature and severity of the disease, the type of preparation and the mode of administration of the drug, and the period or interval of administration.
The pharmaceutical composition provided by the invention also comprises an anti-HBV medicament. Wherein the anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator, an interferon or other novel anti-HBV agent such as an HBV RNA replication inhibitor, an HBsAg secretion inhibitor, an HBV capsid inhibitor, an antisense oligomer, an siRNA, an HBV therapeutic vaccine, an HBV prophylactic vaccine, an HBV antibody therapy (monoclonal or polyclonal), and an agonist for treating or preventing HBV.
anti-HBV drugs include lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, alloferon, simon interleukin, cladribine, emtricitabine, faprivir, interferon, calamine CP, intefine, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, mequitate, nitazoxanide, peginterferon alpha-2 a, ribavirin, roscovitine-A, sizopyran, euforavac, azapril, phosphazid, heplivav, interferon alpha-2 b, levamisole or propagum.
In one aspect, the invention provides a method of treating or preventing hepatitis b in a patient, comprising administering to the patient a therapeutically effective amount of a compound or pharmaceutical composition of the invention. The hepatitis B disease refers to liver diseases caused by hepatitis B virus infection or hepatitis B virus infection, and comprises acute hepatitis, chronic hepatitis, liver cirrhosis and liver cancer. Acute hepatitis b virus infection may be asymptomatic or manifest as acute hepatitis symptoms. Patients with chronic viral infections have active disease and can develop cirrhosis and liver cancer.
The use of the compound or the pharmaceutical composition of the invention comprises inhibiting the production or secretion of HBsAg, and comprises administering to a patient a pharmaceutically acceptable effective dose of the compound or the pharmaceutical composition of the invention.
The use of the compound or pharmaceutical composition of the present invention includes inhibiting HBV DNA production and further includes administering to a patient a pharmaceutically acceptable effective amount of the compound or pharmaceutical composition of the present invention.
In one aspect, the use of a compound or pharmaceutical composition of the invention for inhibiting HBV gene expression comprises administering to a patient a pharmaceutically acceptable effective amount of a compound or pharmaceutical composition of the invention.
Other anti-HBV agents may be administered separately from compositions comprising compounds of the present invention as part of a multiple dosing regimen. Alternatively, those agents may be part of a single dosage form, mixed together with the compounds of the present invention to form a single composition. If administered as part of a multiple dosing regimen, the two active agents can be delivered to each other simultaneously, sequentially or over a period of time, to achieve the desired agent activity.
The amount of compound and composition that can be combined with an adjuvant material to produce a single dosage form (those containing a composition like that described herein) will vary depending on the indication and the particular mode of administration. The compound of the invention shows stronger antiviral effect. The compounds have unexpected antiviral activity on HBV, and are suitable for treating various diseases caused by viruses, in particular acute and chronic diseases caused by persistent HBV infection. Chronic viral diseases caused by HBV can lead to a variety of syndromes of varying severity, and chronic hepatitis b virus infection is known to cause cirrhosis and/or liver cancer.
Examples of indications that can be treated with the compounds of the invention are: treatment of acute and chronic viral infections that can lead to infectious hepatitis, such as hepatitis b virus infection, with treatment of chronic hepatitis b virus infection and treatment of acute hepatitis b virus infection being particularly preferred.
The invention also relates to the use of the compounds and compositions of the invention for the preparation of medicaments for the treatment and prophylaxis of viral diseases, in particular hepatitis b.
General synthetic methods
To illustrate the invention, the following examples are set forth. It is to be understood that the invention is not limited to these embodiments, but is provided as a means of practicing the invention.
In general, the compounds of the present invention may be prepared by the methods described herein, wherein the substituents are as defined in formula (I), unless otherwise indicated. The following synthetic schemes and examples serve to further illustrate the context of the invention.
Those skilled in the art will recognize that: the chemical reactions described herein may be used to suitably prepare a number of other compounds of the invention, and other methods for preparing the compounds of the invention are considered to be within the scope of the invention. For example, the synthesis of those non-exemplified compounds according to the present invention can be successfully accomplished by those skilled in the art by modification, such as appropriate protection of interfering groups, by the use of other known reagents other than those described herein, or by some routine modification of the reaction conditions. In addition, the reactions disclosed herein or known reaction conditions are also recognized as being applicable to the preparation of other compounds of the present invention.
The examples described below, unless otherwise indicated, all temperatures are in degrees Celsius (. Degree. C.). Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, arco Chemical Company and Alfa Chemical Company and were used without further purification unless otherwise indicated. General reagents were purchased from Shantou Wen Long chemical reagent factory, guangdong Guanghua chemical reagent factory, guangzhou chemical reagent factory, tianjin HaoLiyu Chemicals Co., ltd, qingdao Tenglong chemical reagent Co., ltd, and Qingdao Kaseiki chemical plant.
NMR spectral data were measured by Bruker Avance 400 NMR spectrometer or Bruker Avance III HD 600 NMR spectrometer using CDCl3, DMSO-d6, CD3OD or d 6-acetone as solvents (reported in ppm) and TMS (0 ppm) or chloroform (7.26 ppm) as reference standards. When multiple peaks occur, the following abbreviations will be used: s (singlets, singlet), s, s (singlets, singlet), d (doubtet, doublet), t (triplets, triplet), m (multiplet ), br (broadened, broad), dd (doubtet of doubtets, doublet), ddd (doubtet of doubtets, doublet), dt (doubtet of triplets, doublet of triplets), ddt (doubtet of doubtets), td (triplet of doubtets, triplet), br. Coupling constant J, in Hertz (Hz).
Low resolution Mass Spectral (MS) data were measured by an Agilent 6320 series LC-MS spectrometer equipped with a G1312A binary pump and a G1316A TCC (column temperature maintained at 30 ℃), a G1329A autosampler and G1315B DAD detector applied to the analysis, and an ESI source applied to the LC-MS spectrometer.
Low resolution Mass Spectral (MS) data were measured by Agilent 6120 series LC-MS spectrometer equipped with a G1311A quaternary pump and a G1316A TCC (column temperature maintained at 30 ℃), a G1329A auto sampler and a G1315D DAD detector for analysis, and an ESI source for LC-MS spectrometer.
Both spectrometers are equipped with an Agilent Zorbax SB-C18 column, 2.1X 30mm, 5 μm in specification. The injection volume is determined by the sample concentration; the flow rate is 0.6 mL/min; peaks of HPLC were recorded by UV-Vis wavelength at 210 nm and 254 nm. The mobile phases were 0.1% formic acid in acetonitrile (phase a) and 0.1% formic acid in ultrapure water (phase B). Gradient elution conditions are shown in table 1:
table 1: gradient elution conditions
Time (min) A(CH 3 CN,0.1％HCOOH) B(H 2 O,0.1％HCOOH)
0-3 5-100 95-0
3-6 100 0
6-6.1 100-5 0-95
6.1-8 5 95
Compound purification was assessed by Agilent 1100 series High Performance Liquid Chromatography (HPLC) with UV detection at 210 nm and 254nm on a Zorbax SB-C18 column, 2.1X 30mm, 4 μm,10 min, flow rate 0.6 mL/min,5-95% (0.1% formic acid in acetonitrile) in 0.1% formic acid in water, the column temperature was maintained at 40 ℃.
The following acronyms are used throughout the invention:
AcOK Potassium acetate
MeCN,CH 3 CN acetonitrile
MeOH methanol
DCM,CH 2 Cl 2Methylene dichloride
DBU 1, 8-diazabicycloundec-7-ene
D 2 Heavy O water
DMSO dimethyl sulfoxide
DMF N, N-dimethylformamide
DMAP 4-dimethylaminopyridine
DIBAH diisobutylaluminum hydride
DMF-DMA N, N-dimethylformamide dimethyl acetal
CHCl 3 Chloroform, chloroform
dppf 1,1' -bis (diphenylphosphino) ferrocene
CDC1 3 Deuterated chloroform
CCl 4 Carbon tetrachloride
Boc-t-butyloxycarbonyl group
Boc 2 Di-tert-butyl O dicarbonate
Bn benzyl group
PE Petroleum Ether
Pd(dba) 2 Bis (dibenzylideneacetone) palladium
Pd 2 (dba) 3Tris (dibenzylideneacetone) dipalladium
Ph phenyl
PTSA para-toluenesulfonic acid
EtOAc, EA ethyl acetate
EtOH ethanol
HCl hydrochloric acid
K 2 CO 3Potassium carbonate
NaHCO 3 Sodium bicarbonate
NH 4 OAc ammonium acetate
NaOH sodium hydroxide
NaBH 3 CN sodium Cyanoborohydride
NaCl sodium chloride
Na 2 SO 4 Sodium sulfate
n-Bu n-butyl
Et 3 N, TEA Triethylamine
NBS N-bromosuccinimide
H 2 O water
mL of
min for
m-CPBA m-chloroperoxybenzoic acid
h hours
RT, RT Room temperature
Rt Retention time
H 2 Hydrogen gas
HATU 2- (7-azobenzotriazol) -N, N, N ', N' -tetramethyluronium hexafluorophosphate
HCl/EtOAc hydrogen chloride in ethyl acetate
HOAt 1-hydroxy-7-azobenzotriazol
DIPEA N, N-diisopropylethylamine
DCC N, N' -dicyclohexylcarbodiimide
DMA N, N' dimethylacetamide
DME ethylene glycol dimethyl ether
THF tetrahydrofuran
TFA trifluoroacetic acid
Tf trifluoromethanesulfonyl
LiOH.H 2 Lithium hydroxide O monohydrate
IPA isopropyl alcohol
CuCN cuprous cyanide
CH 3 OH methanol
N 2 Nitrogen gas
NH 4 Cl ammonium chloride
NH 4 OAc ammonium acetate
Ac 2 O acetic anhydride
Xantphos 4, 5-bis-diphenylphosphine-9, 9-dimethylxanthene
t 1/2 Half life
t-BuOH tert-butanol
AUC area under the time curve
Vss steady state apparent distribution volume
Clearance of CL, clearance
Bioavailability of F, absolute bioavailalability
Dose of Dose
T max Time to peak
C max Maximum concentration
hr * ng/mL blood concentration time
Synthesis method
The following synthetic schemes set forth the synthetic procedures for preparing the compounds disclosed in the present invention. Wherein each R is 3 、R 4 、R 5 、R 6 、X 1 And X 2 Having the meaning as described in the invention, X is halogen and MS is methylsulfonyl. R 1b Is C 1-6 Alkyl or C 3-6 A cycloalkyl group.
Synthesis scheme 1
Figure BDA0002214794320000321
Formula (II)(a-16)The compounds shown can be prepared by the methods described in scheme 1. First, the compound(a-1)Reacting with ethylene glycol to form a compound(a-2)Of a compound(a-2)And compounds(a-3)In the presence of a palladium catalyst (e.g. Pd (dba) 2 、Pd 2 (dba) 3 Etc.), ligands (e.g., xantphos, etc.), and combinationsCoupling reaction is carried out under the action of proper base (such as sodium tert-butoxide and the like) and in proper solvent (such as THF, toluene and the like) to generate the compound(a-4). Compound (I)(a-4)And NH 4 OAc in reducing agents (e.g. NaBH) 3 CN, etc.) in a suitable solvent (such as methanol, etc.) to produce a compound(a-5). Compound (I)(a-5)With formic acid or ethyl formate in a suitable solvent (e.g., 1,4 dioxane, tetrahydrofuran, etc.) to form the compound(a-6). Then, the compound(a-6)With phosphorus oxychloride in a suitable solvent (e.g., DCM, etc.) to form the compound(a-7). Next, the compound(a-7)And compounds(a-8)Or a compound(a-9)Cyclizing in a suitable solvent (such as isopropanol, ethanol, DMSO, etc.) to give compound(a-10). Compound (I)(a-10)With tetrachlorobenzoquinone, dehydrogenating in proper solvent (DME, etc.) to obtain compound(a-11). Compound (I)(a-11)Removing benzyl protecting group to obtain compound(a- 12). Compound (I)(a-12)Reacting with N-phenyl bis (trifluoromethanesulfonyl) imide under alkaline conditions (such as triethylamine and the like) and a suitable solvent (such as dichloromethane and the like) to generate a compound(a-13). Finally, the compounds(a-13)And compounds(a-14)Under the action of palladium catalyst (such as bis (triphenylphosphine) palladium dichloride, etc.) and in proper solvent (such as 1,4 dioxane, etc.), making coupling reaction to obtain the invented compound(a-16)Or a compound(a-13)And compounds(a-15)Under the action of palladium catalyst (such as tetratriphenylphosphine palladium, etc.), coupling reaction is carried out in proper solvent (such as 1,4 dioxane, etc.) and proper alkali (such as sodium carbonate, potassium phosphate, potassium carbonate, etc.) to generate compound(a-16)。
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Preparation examples
In the following preparation examples, the inventors described in detail the preparation of the compounds of the present invention by taking some of the compounds of the present invention as examples. Intermediate: 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester
Step 1:1- (2- (benzyloxy) -4-bromophenyl) ethanone
Figure BDA0002214794320000331
In a single neck flask was added 4-bromo-2-hydroxyacetophenone (20g, 93mmol), potassium carbonate (25.7g, 186mmol), acetonitrile (100 mL), and benzyl bromide (12.2mL, 103mmol). The reaction mixture was heated to 70 ℃ and stirred for 2h, then cooled to room temperature, filtered to remove solids, and the filtrate was concentrated under reduced pressure to afford the title compound as a white solid (28g, 99%).
Step 2:2- (2- (benzyloxy) -4-bromophenyl) -2-methyl-1, 3-dioxolane
Figure BDA0002214794320000332
To a reaction flask were added 1- (2- (benzyloxy) -4-bromophenyl) ethanone (28.1g, 92mmol), ethylene glycol (10mL, 184mmol), cyclohexane (200 mL), triethyl orthoformate (31mL, 190mmol), and p-toluenesulfonic acid (1.8g, 9.2mmol). The reaction mixture was heated to 40 ℃ and stirred for 24h, then concentrated under reduced pressure. The resulting residue was diluted with 100mL of saturated sodium bicarbonate solution, extracted with ethyl acetate (200 mL. Times.2), and the organic phases were combined. The combined organic phases were washed with 30mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate and concentrated under reduced pressure to give the title compound as a pale yellow oil (32g, 99%).
MS(ESI,pos.ion)m/z:371.1[M+Na] + 。
And step 3:1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butanone
Figure BDA0002214794320000333
Into a single neck flask were charged 2- (2- (benzyloxy) -4-bromophenyl) -2-methyl-1, 3-dioxolane (32.0g, 91.6 mmol), 3-methyl-2-butanone (19.7mL, 184mmol), sodium t-butoxide (17.6 g, 183mmol), tetrahydrofuran (400 mL), tris (dibenzylideneacetone) dipalladium (3.76g, 6.41mmol), and Xantphos (3.83g, 6.42mmol). The reaction mixture was replaced with nitrogen 3 times, heated to 60 ℃, stirred for 4h, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) = 10/1) to give the title compound as a pale yellow solid (23.34g, 72%).
MS(ESI,pos.ion)m/z:355.1[M+H] + 。
And 4, step 4:1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butanamine
Figure BDA0002214794320000334
1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butanone (30g, 84.7 mmol), methanol (150 mL) and ammonium acetate (32.6 g, 423mmol) were added to a single-neck flask, the mixture was stirred at room temperature for 1h under nitrogen, naBH was added at 0 deg.C 3 CN (8 g, 130mmol), held at 0 ℃ and stirred for a further 24h. After completion of the reaction, concentration was carried out under reduced pressure, and the obtained residue was diluted with 100mL of water and 30mL of 10% sodium hydroxide solution in this order, extracted with ethyl acetate (200 mL. Times.3), and the organic phases were combined. The combined organic phases were washed with 50mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound as a colorless oil (30.0 g, 99.7%).
MS(ESI,pos.ion)m/z:356.1[M+H] + 。
And 5: n- (1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butane Yl) carboxamides
Figure BDA0002214794320000341
To a single-necked flask was added 1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butylamine (0.69g, 1.9mmol) and ethyl formate (10 mL). The reaction mixture was stirred under heating at reflux for 12h, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) = 1/1) to give the title compound as a colorless oil (0.3 g, 40%).
MS(ESI,pos.ion)m/z:384.4[M+H] + 。
Step 6:1- (6- (benzyloxy) -3-isopropyl-3, 4-dihydroisoquinolin-7-yl) ethanone
Figure BDA0002214794320000342
In a single-necked flask were added N- (1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butyl) carboxamide (0.30g, 0.78mmol) and dichloromethane (5 mL). The mixture was cooled to 0 ℃ in a cold bath and phosphorus oxychloride (0.36mL, 3.9 mmol) was added. The reaction was stirred at room temperature for 12h, then concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (DCM/MeOH (V/V) = 20/1) to give the title compound as a tan viscous substance (0.20g, 80%).
MS(ESI,pos.ion)m/z:322.3[M+H] + 。
And 7: 10-acetyl-9- (benzyloxy) -6-isopropyl-2-oxo-2, 6,7, 11b-tetrahydro-1H-pyrido [2,1-a]Isoquinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000343
1- (6- (benzyloxy) -3-isopropyl-3, 4-dihydroisoquinolin-7-yl) ethanone (3.1g, 9.6 mmol), 2- (ethoxymethylene) -3-oxo-butyric acid ethyl ester (3.6g, 19.3mmol) and ethanol (30 mL) were added to a single-neck flask, and the reaction mixture was heated to 90 ℃ and stirred for 12h. After completion of the reaction, the reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (PE/EA (V/V) = 1/1) to give the title compound as a brown solid (4.0 g, 90%).
MS(ESI,pos.ion)m/z:462.4[M+H] + 。
And 8: 10-acetyl-9- (benzyloxy) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ]] Isoquinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000344
To a single-necked flask were added ethyl 10-acetyl-9- (benzyloxy) -6-isopropyl-2-oxo-2, 6,7, 11b-tetrahydro-1H-pyrido [2,1-a ] isoquinoline-3-carboxylate (4.50g, 9.75mmol), tetrachlorobenzoquinone (4.53g, 18.4 mmol) and ethylene glycol dimethyl ether (50 mL). The reaction mixture was heated to 80 ℃ and stirred for 2h, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) = 10/1) to give the title compound as a gray solid (3.9g, 87%).
MS(ESI,pos.ion)m/z:460.1[M+H] + 。
And step 9: 10-acetyl-9-hydroxy-6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ]]Isoquine Quinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000351
Ethyl 10-acetyl-9- (benzyloxy) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (3.1 g) and methanol (30 mL) were added to a single-neck flask, the mixture was replaced with hydrogen 3 times and stirred under a hydrogen balloon at room temperature for 8H, then palladium/carbon was removed by filtration through celite, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) = 10/1) to give the title compound as a tan solid (2.7 g, 86%).
MS(ESI,pos.ion)m/z:370.1[M+H] + 。
Step 10: 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro- 2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000352
DCM (10 mL), 10-acetyl-9-hydroxy-6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester (0.50g, 1.4 mmol), and triethylamine (0.38mL, 2.7 mmol) were added to a two-necked flask. The mixture was cooled to 0 ℃, N-phenylbis (trifluoromethanesulfonyl) imide (0.53g, 1.5 mmol) was added in portions, the mixture was stirred at room temperature for 12h, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) = 10/1) to give the title compound as a yellow solid (0.65g, 95%).
Example 1: 10-acetyl-9- (2-isobutylthiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000353
Step 1: 2-isobutyl-4-bromothiazole
Figure BDA0002214794320000354
Isobutyl zinc chloride (10mL, 5mmol, 0.5mol/L) is added into a 25mL double-mouth bottle, pd is slowly added under the protection of nitrogen 2 (dba) 3 A solution of (50 mg), dppf (60 mg) and 2, 4-dibromothiazole (486mg, 2.00mmol) in THF (10 mL) was stirred at room temperature overnight after the addition. The reaction was quenched by the addition of 5mL of an aqueous solution of saturated ammonium chloride, followed by extraction with EA (20 mL. Times.3), and the organic phases were combined and concentrated, and the resulting residue was purified by silica gel column chromatography (PE) to give the title compound as a colorless oil (260mg, 1.18mmol, 59%).
MS(ESI,pos.ion)m/z：220.0[M+H] + 。
Step 2: 2-isobutyl-4- (tri-n-butylstannyl) thiazole
Figure BDA0002214794320000361
4-bromo-2-isobutylthiazole (200mg, 0.91mmol) was dissolved in THF (5 mL), the solution was purged with nitrogen three times, then cooled to-78 deg.C and stirred for 30min, n-butyllithium (0.47mL, 1.2mmol, 2.5mol/L) was added and stirred for 30min, then tri-n-butyltin chloride (0.30mL, 1.09mmol) was added and stirred for 1h. The solvent was concentrated, 10mL of petroleum ether was added, filtered, the filter cake was washed with petroleum ether (30 mL), and concentrated to give the title compound as a colorless oil (0.39g, 0.91mmol, 100%).
MS(ESI,pos.ion)m/z：432.2[M+H] + 。
And step 3: 10-acetyl-9- (2-isobutylthiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyri-dine Pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000362
Ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (100mg, 0.20mmol) was dissolved in 1, 4-dioxane (10 mL), and 2-isobutyl-4- (tri-n-butylstannyl) thiazole (103mg, 0.24mmol) and bis-triphenylphosphine palladium dichloride (34mg, 0.048mmol) were added, followed by warming to 100 ℃ and stirring overnight. The temperature was lowered to room temperature, then the solvent was concentrated, and the obtained residue was purified by thin layer chromatography to give the title compound as a white solid (23mg, 0.050mmol, 25%).
MS(ESI,pos.ion)m/z：465.2[M+H] + ；
1 H NMR(400MHz,CDCl 3 )δ(ppm)15.672(b,1H),8.537(s,1H),7.919(s,1H),7.644(s,1H),7.419(s,1H),7.250(s,1H),4.053–3.958(m,1H),3.503–3.398(m,1H),3.331–3.240(m,1H),2.950(d,J＝6.8Hz,2H),2.350(s,3H),2.213–2.121(m,1H),1.835–1.713(m,1H),1.057(d,J＝6.8Hz,6H),0.998(d,J＝2.8,3H),0.874(d,J＝6.4,3H)。
Example 2: 10-acetyl-6-isopropyl-9- (2- (isopropylamino) thiazol-4-yl) -2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000371
Step 1: 4-bromo-N-isopropylthiazol-2-amine
Figure BDA0002214794320000372
2, 4-dibromothiazole (2g, 8.23mmol), DMF (15 mL), potassium carbonate (3.45g, 24.70mmol) and isopropylamine (0.486g, 8.22mmol) were added to a reaction flask, which was then heated to 70 ℃ for 24h. Water (50 mL) and ethyl acetate (50 mL) were added to dilute, the solution was separated, the organic phase was washed with saturated brine (50 mL × 1), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) = 1/4) to give the title compound as a brown solid (0.40g, 1.82mmol, 22.1%). MS (ESI, pos. Ion) m/z:221.0[ M ] +H] + 。
Step 2: (4-Bromothiazol-2-yl) (isopropyl) carbamic acid tert-butyl ester
Figure BDA0002214794320000373
4-bromo-N-isopropylthiazol-2-amine (1.32g, 6.0mmol) was dissolved in dichloromethane (20 mL), triethylamine (1.68mL, 12.0mmol) and 4-dimethylaminopyridine (0.74g, 5.98mmol) were added, then di-tert-butyl dicarbonate (1.5mL, 6.5mmol) was added dropwise under ice bath, and after completion of dropwise addition, the mixture was moved to room temperature to react for 12 hours. The TLC detection reaction was completed, concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) = 10/1) to give the title compound as a yellow oily liquid (1.75g, 5.45mmol, 91.0%).
MS(ESI,pos.ion)m/z：265.0[M+H] + 。
And step 3: isopropyl (4- (tri-n-butylstannyl) thiazol-2-yl) carbamic acid tert-butyl ester
Figure BDA0002214794320000374
Tert-butyl (4-bromothiazol-2-yl) (isopropyl) carbamate (1.5g, 4.7 mmol) was dissolved in tetrahydrofuran (15 mL), cooled to-78 deg.C, n-butyllithium (3.5mL, 5.6 mmol) was added dropwise, and the reaction was allowed to proceed for 1h after the addition was complete. Tributyltin chloride (1.8mL, 6.2mmol) was added dropwise, and after completion of the addition, the reaction mixture was allowed to shift to room temperature for 12 hours. The reaction was monitored by TLC to completion, the solvent was dried by evaporation, diluted with petroleum ether (50 mL), filtered to remove insoluble solids, and the filtrate was dried by evaporation to give the title compound as a brown oily liquid (2.5g, 4.7mmol, 100%) which was used directly in the next step.
And 4, step 4: 10-acetyl-9- (2- ((tert-butoxycarbonyl) (isopropyl) amino) thiazol-4-yl) -6-isopropyl- 2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000381
To a reaction flask was added ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (0.2g, 0.4 mmol), tert-butyl isopropyl (4- (tri-n-butylstannyl) thiazol-2-yl) carbamate (0.4g, 0.8mmol), bis (triphenylphosphine) palladium dichloride (0.05g, 0.07mmol), and 1, 4-dioxane (20 mL), and heated to 100 ℃ under nitrogen for 12H. The reaction was run to completion by TLC, the solvent was dried by spinning off, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) = 8/1) to give the title compound as a dark brown solid (0.23g, 0.41mmol, 100%) which was used directly in the next reaction.
MS(ESI,pos.ion)m/z：566.2[M+H] + 。
And 5: 10-acetyl-6-isopropyl-9- (2- (isopropylamino) thiazol-4-yl) -2-oxo-6, 7-dihydro- 2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000382
A1, 4-dioxane solution of hydrogen chloride (20mL, 80mmol, 4.0mol/L) was added to the reaction flask, and cooled to 0 ℃. 10-acetyl-9- (2- ((tert-butoxycarbonyl) (isopropyl) amino) thiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid (0.23g, 0.41mmol) was dissolved in 5mL of an ethyl acetate solution, which was then added dropwise to a reaction flask, and after completion of the dropwise addition, the reaction mixture was warmed to room temperature and stirred for reaction for 12H. After the reaction is finished, a potassium carbonate solution is dripped in ice bath to adjust the pH value to be neutral, then 50mL of ethyl acetate is used for extraction, 100mL of water is added into the organic layer, and the pH value is adjusted to be more than 9 by potassium carbonate. The layers were separated, the aqueous layer was adjusted to neutral pH with 1M hydrochloric acid, extracted with ethyl acetate (100 mL. Times.3), and the organic layers were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound as a yellow solid (0.03g, 0.06mmol, 20%).
MS(ESI,pos.ion)m/z：466.2[M+H] + ；
1 H NMR(600MHz,CD 3 OD)δ(ppm)8.79(s,1H),8.36(s,1H),7.65(s,1H),7.51(s,1H),7.37(s,1H),4.41(s,1H),3.91–3.80(m,1H),3.47(dd,J＝42.8,15.6Hz,2H),2.66(s,3H),1.78–1.67(m,1H),1.42–1.20(m,7H),0.99(d,J＝6.6Hz,3H),0.84(d,J＝6.6Hz,3H)。
Example 3: 10-acetyl-9- (2-N, N-dimethylaminothiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000383
Step 1: 4-bromo-N, N-dimethylthiazol-2-amine
Figure BDA0002214794320000391
2, 4-dibromothiazole (2.6g, 11mmol) and N-methylmethanamine hydrochloride (1.7g, 21mmol) were charged in a 100mL single-neck flask, and DBU (4.8mL, 32mmol) was added thereto while the temperature was lowered to 0 ℃ and the mixture was stirred overnight at room temperature. The reaction system was diluted with water (100 mL), followed by extraction with EA (50 mL × 4), the organic phases were combined, washed with saturated brine (30 mL × 3), the combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure, and the resulting residue was purified by thin layer chromatography (PE/EA (V/V) = 10/1) to give the title compound as a white solid (1.62g, 7.82mmol, 73%).
MS(ESI,pos.ion)m/z：207.0[M+H] + 。
Step 2: n, N-dimethyl-4- (tri-N-butylstannyl) thiazole
Figure BDA0002214794320000392
4-bromo-N, N-dimethylthiazol-2-amine (1.22g, 5.89mmol) was dissolved in diethyl ether (8 mL), cooled to-78 deg.C, and stirred for 20min. N-butyllithium (4.8mL, 7.7mmol,1.6 mol/L) was added and stirred for 30min. Tri-n-butyltin chloride (1.95mL, 7.07mmol) was added, stirred for 30min, then warmed to room temperature and stirred overnight. KF (0.685 g, 11.8mmol) was added, stirred for 10min, then filtered, and petroleum ether (50 mL) was added to wash the cake, and the filtrate was concentrated under reduced pressure to give the title compound as a pale yellow oil (2.46g, 5.90mmol, 100%).
MS(ESI,pos.ion)m/z：419.1[M+H] +
And 3, step 3: 10-acetyl-9- (2-N, N-dimethylaminothiazol-4-yl) -6-isopropyl-2-oxo-6, 7-bis hydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000393
Ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (0.20g, 0.40mmol), N-dimethyl-4- (tri-N-butylstannyl) thiazole (500mg, 1.198mmol), anhydrous 1, 4-dioxane (15 mL), and bis-triphenylphosphine palladium dichloride (84mg, 0.119mmol) were added to a 50mL one-neck flask, then blanketed with nitrogen, warmed to 100 ℃ and stirred overnight. After completion of the reaction, the temperature was lowered to room temperature, the solvent was concentrated, and the obtained residue was separated by silica gel column chromatography (DCM/MeOH (V/V) = 10/1) and then subjected to thin layer chromatography (DCM/MeOH (V/V) = 15/1) to obtain a crude product, which was isolated by preparative chromatography to give the title compound as a yellow solid (10mg, 0.022mmol, 5.6%).
MS(ESI,pos.ion)m/z：452.2[M+H] + ；
1 H NMR(400MHz,CDCl 3 )δ(ppm)15.77(b,1H),8.500(s,1H),7.826(s,1H),7.343(s,1H),7.210(s,1H),7.194(s,1H),3.980–3.914(m,1H),3.446–3.384(m,1H),3.287–3.238(m,1H),3.205(s,6H),2.431(s,3H),2.079–1.994(m,1H),0.992(d,J＝4.4Hz,3H),0.867(d,J＝4.0Hz,3H)。
Example 4: 10-acetyl-9- (2-chlorothiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000401
Step 1: 2-chloro-4- (tri-n-butylstannyl) thiazole
Figure BDA0002214794320000402
4-bromo-2-chlorothiazole (300mg, 1.51mmol) was dissolved in THF (5 mL), the temperature was then reduced to-78 deg.C, n-butyllithium (1.9mL, 3.0mmol,1.6 mol/L) was added, then stirring was carried out for 30min, tri-n-butyltin chloride (0.459mL, 1.66mmol) was added, stirring was carried out for 1h, and then the mixture was transferred to 0 deg.C and stirred overnight. Water (10 mL) was added for dilution, followed by extraction with EA (20 mL. Times.3), the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound as a yellow oil (0.6176g, 1.512mmol, 100.0%).
MS(ESI,pos.ion)m/z：410.0[M+H] + 。
Step 2: 10-acetyl-9- (2-chlorothiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000403
Ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (120mg, 0.2393mmol), 2-chloro-4- (tri-n-butylstannyl) thiazole (508mg, 1.243mmol), anhydrous 1, 4-dioxane (10 mL), bis triphenylphosphine palladium dichloride (41mg, 0.059mmol) were added to a 50mL one-neck flask, then stirred at 110 ℃ for 2 days under nitrogen blanket. The temperature was lowered to room temperature, concentrated under reduced pressure, and the resulting residue was isolated by column chromatography (DCM/MeOH (V/V) = 10/1) to give the title compound as a pale yellow solid (19mg, 0.043mmol, 18%).
MS(ESI,pos.ion)m/z：443.0[M+H] + ；
1 H NMR(400MHz,CDCl 3 )δ(ppm)15.694(b,1H),8.532(s,1H),7.860(s,1H),7.652(s,1H),7.405(s,1H),7.243(s,1H),4.088–3.907(m,1H),3.541–3.380(m,1H),3.351–3.218(m,1H),2.452(s,3H),2.065–1.964(m,1H),0.981–0.862(m,6H)。
Example 5: 10-acetyl 6-isopropyl-9- (2- (2-methoxyethyl) thiazol-4-yl) -2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000404
Step 1:2- (4-Bromothiazol-2-yl) ethanol
Figure BDA0002214794320000411
/>
2, 4-dibromothiazole (5.1g, 21mmol) and diethyl ether (125 mL) are added into a 250mL double-mouth bottle, and the mixture is stirred for 30min after being cooled to-78 ℃ under the protection of nitrogen. Then, n-butyllithium (8.4mL, 21mmol, 2.5mol/L) was added by syringe, followed by stirring for another 20min, propylene oxide (7.0mL, 21mmol, 3mol/L) was slowly added by syringe, followed by stirring for 10min, a solution of boron trifluoride diethyl ether (2.6mL, 21mmol) in diethyl ether (15 mL) was added, and further stirred for 20min. The reaction was quenched with saturated ammonium chloride solution (15 mL), after addition was complete, stirred for 10min, then warmed to room temperature, extracted with EA (100 mL × 3), the organic phases combined, the combined organic phases dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the resulting residue was chromatographed over silica gel (PE/EA (V/V) = 1/1) to give the title compound as a brown oil (1.25g, 6.01mmol, 29%).
MS(ESI,pos.ion)m/z：208.0[M+H] + 。
Step 2: 4-bromo-2- (2-methoxyethyl) thiazole
Figure BDA0002214794320000412
NaH (2.07g, 51.75mmol) was added to a 100mL two-necked flask, cooled to-10 deg.C, THF (30 mL) was added, and stirred for 10min. Then a solution of 2- (4-bromothiazol-2-yl) ethanol (5.38g, 25.87mmol) in THF (30 mL) was added dropwise, stirred for 1h, and CH was added slowly 3 I (3.22mL, 51.7 mmol) and then stirred at-10 ℃ overnight. After completion of the reaction, the reaction mixture was slowly quenched with 15mL of water, then extracted with EA (35 mL × 3), the organic phases were combined, concentrated under reduced pressure, and the resulting residue was separated by silica gel column chromatography (PE/EA (V/V) = 10/1) to give the title compound as a pale yellow oil (3.23g, 14.5mmol, 56.2%).
MS(ESI,pos.ion)m/z：222.0[M+H] + 。
And step 3:2- (2-methoxyethyl) -4- (tri-n-butylstannyl) thiazole
Figure BDA0002214794320000413
4-bromo-2- (2-methoxyethyl) thiazole (500mg, 2.25mmol) was dissolved in diethyl ether (5 mL), then cooled to-78 deg.C and stirred for 30min. N-butyllithium (1.2mL, 3.0mmol,2.5 mol/L) was added and stirred for 1 hour, and tri-n-butyltin chloride (0.75mL, 2.7 mmol) was added and stirred for 1 hour, followed by stirring at room temperature overnight. 1g of KF was added, stirred for 10min, diluted with 10mL of petroleum ether, filtered, the cake was washed with 50mL of petroleum ether, and the filtrate was concentrated to give the title compound as a yellow oil (0.9730g, 2.251mmol, 100.0%) which was directly charged into the next reaction.
MS(ESI,pos.ion)m/z：434.1[M+H] + 。
And 4, step 4: 10-acetyl 6-isopropyl-9- (2- (2-methoxyethyl) thiazol-4-yl) -2-oxo-6, 7-di hydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000421
Ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (200mg, 0.40mmol), 2- (2-methoxyethyl) -4- (tri-n-butylstannyl) thiazole (517mg, 1.20mmol), anhydrous 1, 4-dioxane (10 mL), and bis-triphenylphosphine palladium dichloride (69mg, 0.10mmol) were charged to a 50mL single vial, then nitrogen blanketed, warmed to 100 ℃ and stirred overnight. The solvent was concentrated, and the resulting residue was isolated by silica gel column chromatography (DCM/MeOH (V/V) = 15/1) to give a crude product, which was further isolated by preparative chromatography to give the title compound as a white solid (30mg, 0.064mmol, 16.12%).
MS(ESI,pos.ion)m/z：467.2[M+H] + ；
1 H NMR(400MHz,CDCl 3 )δ(ppm)15.777(b,1H),8.524(s,1H),7.839(s,1H),7.636(s,1H),8.438(s,1H),8.241(s,1H),3.993–3.955(m,1H),3.813(t,J＝4.4Hz,4.0Hz,2H),3.477–3.449(m,1H),3.436(s,3H),3.338–3.297(m,3H),2.338(s,3H),1.822–1.751(m,1H),0.986(d,J＝4.4Hz,3H),0.866(d,J＝4.8Hz,3H)。
Example 6: 10-acetyl-6-isopropyl-9- (5- (morpholinomethyl) thiazol-2-yl) -2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000422
Step 1:4- ((2-bromothiazol-5-yl) methyl) morpholine
Figure BDA0002214794320000423
2-bromo-5- (bromomethyl) thiazole (2g, 7.78mmol), DMF (10 mL), anhydrous potassium carbonate (1.63g, 11.67mmol) and morpholine (0.68g, 7.78mmol) were added sequentially to a reaction flask, followed by reaction at 70 ℃ for 30h. The reaction was completed by TLC, 100mL of water was added, followed by extraction with 100mL of ethyl acetate, and the organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) = 5/1) to give the title compound as a pale yellow oily liquid (1.17g, 4.45mmol, 57.1%).
MS(ESI,pos.ion)m/z：263.0[M+H] + 。
Step 2:4- ((2- (tri-n-butylstannyl) thiazol-5-yl) methyl) morpholine
Figure BDA0002214794320000424
4- ((2-bromothiazol-5-yl) methyl) morpholine (1.17g, 4.45mmol) was added to the reaction flask, dissolved in THF (10 mL), cooled to-78 ℃ under nitrogen, and then a solution of n-butyllithium in n-hexane (3.3mL, 5.3mmol,1.6 mol/L) was slowly added dropwise, and after completion of the addition, the reaction was stirred for 1h. Then tri-n-butyltin chloride (1.88g, 5.78mmol) was slowly added dropwise and after completion of the addition, the reaction was transferred to room temperature for 12 hours. After completion of the reaction, concentration was carried out under reduced pressure, and 30mL of petroleum ether was added to precipitate solid impurities, which were filtered and the filtrate was spin-dried to obtain the title compound as a yellow oily liquid (2.10g, 4.44mmol, 99.8%) which was used in the next reaction.
And step 3: 10-acetyl-6-isopropyl-9- (5- (morpholinomethyl) thiazol-2-yl) -2-oxo-6, 7-dihydro- 2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000431
To a reaction flask was added ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (0.3g, 0.6 mmol), 4- ((2- (tri-n-butylstannyl) thiazol-5-yl) methyl) morpholine (0.6 g, 1mmol), bis (triphenylphosphine) palladium dichloride (0.1g, 0.1mmol) and 1, 4-dioxane (20 mL), and heated to 100 ℃ under nitrogen for 12H. Concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) = 5/1) to give the title compound as a pale yellow solid (0.078g, 0.15mmol, 20%).
MS(ESI,pos.ion)m/z：508.3[M+H] + ；
1 H NMR(400MHz,CDCl 3 )δ(ppm)15.72(s,1H),8.54(d,J＝19.0Hz,1H),7.80(s,1H),7.72(s,1H),7.64(s,1H),7.23(s,1H),4.06(dd,J＝9.7,4.5Hz,1H),3.80(s,2H),3.77–3.71(m,4H),3.49(dd,J＝16.3,5.0Hz,1H),3.31(d,J＝16.3Hz,1H),2.56(s,4H),2.43(s,3H),1.78–1.71(m,1H),0.99(d,J＝6.6Hz,3H),0.86(d,J＝6.7Hz,3H)。
Example 7: 10-acetyl-6-isopropyl-9- (1- (oxetan-3-yl) -1H-pyrazol-4-yl) -2-oxo-6-, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000432
Step 1: 10-acetyl-6-isopropyl-9- (1- (oxetan-3-yl) -1H-pyrazol-4-yl) -2-oxo- 6-, 7-dihydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000441
10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2, 1-a) was added to the reaction flask]Isoquinoline-3-carboxylic acid ethyl ester (200mg, 0.54mmol), 1- (oxetan-3-yl) -4- (4, 5-tetramethyl-1, 3, 2-dioxaborolan) -1H-pyrazole (0.27g, 1.1mmol), pd (PPh) 3 ) 4 (65mg,0.056mmol)、K 2 CO 3 (0.23g, 1.6 mmol) and 1, 4-dioxane (10 mL) were reacted under nitrogen at 110 ℃ for 12h. LCMS detects that the raw materials are completely reacted, the reaction liquid is filtered, the filtrate is concentrated, and the next reaction is directly carried out.
MS(ESI,pos.ion)m/z：476.2[M+1] + 。
And step 3: 10-acetyl-6-isopropyl-9- (1- (oxetan-3-yl) -1H-pyrazol-4-yl) -2-oxo- 6-, 7-dihydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000442
The crude 10-acetyl-6-isopropyl-9- (1- (oxetan-3-yl) -1H-pyrazol-4-yl) -2-oxo-6-, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester synthesized in the previous step was dissolved in 10mL of methanol, and LiOH (0.11g, 2.6 mmol) was added, and the mixture was stirred at room temperature for 4H. The reaction solution was adjusted to pH =6-7 by adding 1M HCl, followed by extraction with DCM (30 mL × 2), the organic phases were combined, concentrated under reduced pressure, the resulting residue was subjected to silica gel column chromatography (DCM/MeOH (V/V) = 15/1) to give a crude product, which was slurried with 10mL methanol, filtered and dried to give the title compound as a white solid product (60mg, 0.13mmol, 26%).
MS(ESI,pos.ion)m/z：448.2[M+1] + ；
1H NMR(400MHz,CDCl 3 )δ(ppm)15.78(s,1H),8.54(s,1H),7.86(s,1H),7.78(s,1H),7.74(s,1H),7.38(s,1H),7.22(s,1H),5.58–5.44(m,1H),5.10(d,J＝6.7Hz,4H),4.09–3.89(m,1H),3.49–3.21(m,2H),2.41(s,3H),1.82–1.74(m,1H),0.98(d,J＝6.5Hz,3H),0.86(d,J＝6.6Hz,3H)。
Example 8: 10-acetyl-6-isopropyl-2-oxo-9- (thiazol-2-yl) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000443
Starting from 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester and 2- (tri-n-butylstannanyl) thiazole, the synthesis of step 3 referenced example 1 gave the title compound as a white solid.
MS(ESI,pos.ion)m/z：409.1[M+H] + ；
1 H NMR(400MHz,CDCl 3 )δ8.53(s,1H),7.95(d,J＝2.6Hz,1H),7.82(s,1H),7.66(s,1H),7.52(d,J＝2.5Hz,1H),7.23(s,1H),4.01(s,1H),3.83–3.56(m,1H),3.48(s,1H),3.32(s,1H),2.40(s,3H),0.98(d,J＝6.2Hz,3H),0.85(d,J＝6.2Hz,3H).
Example 9: 10-acetyl-9- (1- (difluoromethyl) -1H-pyrazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000451
Starting from ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate and 1-difluoromethyl-4- (4, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) -1H-pyrazole, the title compound was obtained as a white solid by the synthesis of reference example 7.
1 H NMR(400MHz,CDCl 3 )δ(ppm)15.80(s,1H),8.54(s,1H),8.02–7.62(m,3H),7.75(s,1H),7.39(s,1H),7.23(s,1H),4.01(s,1H),3.83–3.56(m,1H),3.48(s,1H),3.32(s,1H),2.40(s,3H),0.98(d,J＝6.2Hz,3H),0.85(d,J＝6.2Hz,3H)。
Example 10: 10-acetyl-6-isopropyl-9- (2-isopropylthiazol-4-yl) -2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000452
Starting from 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester and 2-isopropyl-4- (tributylstannyl) thiazole, the synthesis of step 3 of reference example 1 gave the title compound as a white solid.
MS(ESI,pos.ion)m/z：451.4[M+H] + ；
1 H NMR(400MHz,CDCl 3 )δ15.778(b,1H),8.517(s,1H),7.824(s,1H),7.628(s,1H),7.430(s,1H),7.239(s,1H),3.979–3.956(m,1H),3.473–3.438(m,1H),3.392–3.346(m,1H),3.334–3.283(m,1H),2.358(s,3H),1.817–1.767(m,1H),1.463(d,J＝4.8Hz,6H),0.989(d,J＝4.8Hz,3H),0.867(d,J＝4.4Hz,3H)。
Biological activity assay
HBV cell line
HepG2.2.15 cells (SELLS, PNAS,1987 and SELLS, JV, 1988) have the entire HBV genome integrated into their chromosomes and stably express viral RNA and viral proteins. HepG2.2.15 cells secrete mature hepatitis B virus particles and HBsAg into the culture medium. Virion DNA and HBsAg secreted by hepg2.2.15 cells can be quantified by qPCR and ELISA methods and the effect of compounds on viral replication and HBsAg secretion is thereby detected.
Test 1: inhibition of HBV viral replication by Compounds of the invention
The experimental method comprises the following steps:
HepG2.2.15 cells 8,000 cells per well were seeded into 96-well cell culture plates in duplicate and cultured for 3 days until the cells grew to full well. Cells were treated with 4-fold serial dilutions of compounds for 10 days, dosed every other day with a final concentration of 0.5% DMSO in all wells and DMSO was used as no drug control. Supernatants were harvested on day 11 for quantitative detection of HBV DNA.
The qPCR method is used for detecting virus genome DNA, and HBV primers are as follows:
HBV-For-202，CAGGCGGGGTTTTTCTTGTTGA(SEQ ID NO:1)；
HBV-Rev-315，GTGATTGGAGGTTGGGGACTGC(SEQ ID NO:2)。
using SYBR Premix Ex Taq II-Takara DRR081S kit, 1. Mu.L of cell culture supernatant was used as a template, a standard curve was made with a plasmid containing HBV genome, and the virus copy number was calculated from the standard curve. Concentration-viral copy number was processed with Graphpad Prism 5 software and IC for compound inhibition of viral replication was calculated by a four-parameter non-linear regression model 50 。
And (4) conclusion: the inhibition experiment of the compound on HBV virus replication shows that the compound has good inhibition activity on HBV DNA replication, wherein the IC of the compound on the HBV DNA replication inhibition activity 50 IC of HBVDNA replication inhibition Activity of most compounds at less than 0.1. Mu.M 50 Less than 0.05. Mu.M.
The inhibitory activity of some compounds of the present invention on HBV DNA replication is shown in Table 2.
Table 2: replication inhibitory Activity of partial Compounds of the present invention on HBV DNA
Examples DNA IC 50 (nM)
Example 1 4.9
Example 2 10.61
Example 3 5.24
Example 4 8.76
Example 6 11.3
And (3) testing 2: inhibition of HBsAg secretion by Compounds of the invention
The experimental method comprises the following steps:
HepG2.2.15 cells 8,000 cells per well were seeded into 96-well cell culture plates in duplicate and cultured for 3 days until the cells grew to full well. Cells were treated with 4-fold serial dilutions of compounds for 10 days, dosed every other day with a final concentration of 0.5% DMSO in all wells and DMSO was used as no drug control. Supernatants were harvested on day 11 for HBsAg quantification.
The level of HBsAg secreted from cells after compound treatment was measured by ELISA using a hepatitis B surface antigen diagnostic kit (Shanghai Kowa bioengineering, inc. S10910113). 25 μ L of test supernatant (diluted to 75 μ L in PBS) was added to each well of the ELISA plate, and a positive control and a negative control of the kit were set. After blocking the ELISA plates with mounting paper, incubation was carried out at 37 ℃ for 60 minutes. The ELISA plate was removed, the mounting was removed and 50. Mu.L of enzyme conjugate was added to each well. The plate was shaken on a shaker for 10 seconds, sealed with mounting paper, and incubated at 37 ℃ for 30 minutes. The ELISA plate was removed, the mounting paper was torn off, and the washing was repeated 5 times: discarding liquid in the holes each time, adding washing liquid to fill all the holes, standing for 60 seconds, spin-drying, and beating the liquid residue on absorbent paper. Immediately after washing, a freshly prepared mixture of developer a and developer B was added to all wells: 100 μ L per well. The plate was shaken on a shaker for 10 seconds, and then incubated at 37 ℃ for 30 minutes after sealing the ELISA plate with a sealing paper. Add 50. Mu.L stop solution to all wells. Read at a wavelength of 450nm on an Envision plate reader. The concentration-HBsAgOD 450 value data was processed by Graphpad Prism 5 software and calculated by a four-parameter nonlinear regression modelIC of compound for HBsAg secretion inhibition 50 。
And (4) conclusion: the compound of the invention has an inhibition experiment on HBsAg secretion. The compound has good inhibitory activity to HBsAg secretion, wherein the IC of the compound has inhibitory activity to HBsAg secretion 50 IC of inhibitory Activity of most Compounds on HBsAg secretion less than 0.1. Mu.M 50 Less than 0.05. Mu.M.
The inhibitory activity of the partial compounds of the present invention against HBsAg secretion is the result shown in Table 3.
Table 3: inhibitory Activity of partial Compounds of the present invention against HBsAg secretion
Examples HBsAg IC 50 (nM)
Example 1 7.85
Example 3 9.54
And (3) testing: pharmacokinetic experiments of the compounds of the invention in beagle dogs, mice and rats
(1) Beagle PK test experiment
PK assay experiment of the compound of the present invention in beagle dogs (body weight 10-12kg, male, age 10-12 months, 3 per group orally, 3 per group intravenously)
The experimental method comprises the following steps:
beagle dogs were given 2.5mg/kg or 5mg/kg by oral gavage or 1mg/kg or 2mg/kg by intravenous injection of the test compounds.
At time points (0.083, 0.25,0.5, b, c, d),1.2, 4,6,8 and 24 hours) venous blood collection, collected in EDTA-K 2 In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.
And (4) conclusion: experiments show that the compound has better pharmacokinetic property in beagle dogs and has good application prospect in the aspect of HBV resistance.
(2) Mouse PK test experiment
PK measurement experiment of the compound of the present invention in ICR mice (body weight 20-25g, male, age 45-60 days, 3 mice per group orally, 3 mice per group intravenously)
The experimental method comprises the following steps:
ICR mice were orally gavaged with 10mg/kg or injected via the tail vein with 2mg/kg or 10mg/kg of the test compound. Blood was collected at time points (0.083, 0.25,0.5,1,2,4,6,8 and 24 hours) from orbital veins after administration and collected with EDTA-K 2 In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.
And (4) conclusion: experiments show that the compound has better pharmacokinetic property in an ICR mouse body and has good application prospect in the aspect of anti-HBV virus.
(3) SD rat PK test experiment
PK assay experiment of the compound of the present invention in SD rats (body weight 200-250g, male, age 2-3 months, 3 per group orally, 3 per group intravenously)
The experimental method comprises the following steps:
SD rats were dosed either 2.5mg/kg or 5mg/kg per oral gavage or 1mg/kg per intravenous injection of the test compound. Blood was collected intravenously at time points (0.083, 0.25,0.5,1,2, 5, 7 and 24 hours) after administration and collected by adding EDTA-K 2 In the anticoagulation tube. After the plasma sample is extracted by liquid-liquid extraction, the plasma sample is monitored by multiple reactive ions on a triple quadrupole tandem mass spectrometerQuantitative analysis was performed in a measurement (MRM) mode. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.
And (4) conclusion: experiments show that the compound has better pharmacokinetic property in SD rats and has good application prospect in the aspect of HBV resistance.
And (4) testing: stability testing of Compounds of the invention in liver microsomes of different species
The experimental method comprises the following steps:
30. Mu.L of a mixed solution of the blank solution and the liver microsomes was added to a 96-well plate, and 15. Mu.L of a buffer containing the compound to be detected was added to each well, and two samples were prepared in parallel. After 10min of preincubation at 37 ℃ 15. Mu.L of NADPH solution (8 mM) were added at 0min, 15min, 20min and 60min time points, with a final concentration of 1. Mu.M of test compound, a concentration of 0.1mg/mL of liver microsomes and a final concentration of 2mM of NADPH. Incubate for 0, 15, 30, 60min, respectively, and add 150 μ L acetonitrile (containing internal standard) to the mixed system after incubation. The acetonitrile diluted sample was centrifuged at 4000rpm for 5min and 150. Mu.L of the supernatant was taken to LC-MS/MS for analysis.
And (4) conclusion: experiments show that the compound has better stability in liver microsomes of different species.

Claims (9)

1. A compound which is a compound of formula (I) or a stereoisomer, tautomer, pharmaceutically acceptable salt of a compound of formula (I) wherein:
Figure FDA0003988009790000011
each X 1 And X 2 Independently is CR 7 ；
R 1 Is R 1a O-；
R 2 Is methyl, ethyl, n-propyl or isopropyl;
R 3 is thiazolyl; wherein said thiazolyl is unsubstituted or substituted by 1 or 2R x Substituted;
each R x Independently is deuterium, F, cl, br, R a R b N-, methyl, ethyl, N-propyl, isopropyl or 2-methylpropyl, wherein the methyl, ethyl, N-propyl, isopropyl and 2-methylpropyl are each independently unsubstituted or substituted by 1R k Substituted;
R k deuterium, F, cl, br, methoxy, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl;
each R 4 、R 5 、R 7 And R 9 Independently hydrogen or deuterium;
R 6 is isopropyl;
R 1a is H or deuterium;
each R a And R b Each independently H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, or isobutyl.
2. The compound of claim 1, comprising a compound of one of:
Figure FDA0003988009790000012
/>
Figure FDA0003988009790000021
Figure FDA0003988009790000022
or a stereoisomer, tautomer, pharmaceutically acceptable salt thereof.
3. A pharmaceutical composition comprising a compound of any one of claims 1-2; optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant or a combination of said adjuvants.
4. The pharmaceutical composition according to claim 3, further comprising other anti-HBV drugs.
5. The pharmaceutical composition according to claim 4, wherein the other anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator, or an interferon.
6. The pharmaceutical composition according to claim 5, wherein the other anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, simon interleukin, clevudine, emtricitabine, interferon, calamine CP, intefene, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, mevoxil, nitazoxanide, peginterferon alpha-2 a, ribavirin, roscovitine-A, cerzopyran, euforavac, april, phosphazid, heplisav, interferon alpha-2 b, levamisole or propafege.
7. Use of a compound of any one of claims 1-2 or a pharmaceutical composition of any one of claims 3-6 in the manufacture of a medicament for preventing, treating or ameliorating a viral disease in a subject, wherein the viral disease is hepatitis b virus infection or a disease caused by hepatitis b virus infection.
8. The use according to claim 7, wherein the disease caused by hepatitis B virus infection is liver cirrhosis or hepatocellular carcinoma.
9. Use of a compound according to any one of claims 1 to 2 or a pharmaceutical composition according to any one of claims 3 to 6 in the manufacture of a medicament for inhibiting the production or secretion of HBsAg, and/or for inhibiting the production of HBV DNA.
CN201910911197.7A 2018-09-26 2019-09-25 Fused tricyclic compound and application thereof in medicines Active CN110950860B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201811121133 2018-09-26
CN2018111211339 2018-09-26

Publications (2)

Publication Number Publication Date
CN110950860A CN110950860A (en) 2020-04-03
CN110950860B true CN110950860B (en) 2023-03-31

Family

ID=69976501

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910911197.7A Active CN110950860B (en) 2018-09-26 2019-09-25 Fused tricyclic compound and application thereof in medicines

Country Status (1)

Country Link
CN (1) CN110950860B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018165520A1 (en) 2017-03-10 2018-09-13 Vps-3, Inc. Metalloenzyme inhibitor compounds
CN110066278B (en) * 2017-06-01 2021-06-08 广东东阳光药业有限公司 Fused tricyclic compound and application thereof in medicines
EP3856740A4 (en) 2018-09-30 2021-12-15 Sunshine Lake Pharma Co., Ltd. Fused tetracyclic compounds and uses thereof in medicine
US20230183263A1 (en) * 2020-05-15 2023-06-15 Fujian Akeylink Biotechnology Co., Ltd. Combination for treating hepatitis b

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016071215A1 (en) * 2014-11-03 2016-05-12 F. Hoffmann-La Roche Ag Novel 6,7-dihydrobenzo[a]quinolizin-2-one derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2016128335A1 (en) * 2015-02-11 2016-08-18 F. Hoffmann-La Roche Ag Novel 2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid derivatives for the treatment and prophylaxis of hepatitis b virus infection
CN105899508A (en) * 2014-01-30 2016-08-24 豪夫迈·罗氏有限公司 Novel dihydroquinolizinones for the treatment and prophylaxis of hepatitis B virus infection
WO2017017043A1 (en) * 2015-07-28 2017-02-02 F. Hoffmann-La Roche Ag Novel 6,7-dihydropyrido[2,1-a]phthalazin-2-ones for the treatment and prophylaxis of hepatitis b virus infection
CN106810548A (en) * 2017-01-13 2017-06-09 上海爱科百发生物医药技术有限公司 A kind of dihydroisoquinoliness compound
CN107759585A (en) * 2016-07-29 2018-03-06 银杏树药业(苏州)有限公司 A kind of isoquinoline compound and its Pharmaceutical composition and the application as antiviral drugs
WO2018154466A1 (en) * 2017-02-21 2018-08-30 Glaxosmithkline Intellectual Property Development Limited Dihydroquinolizinones as antivirals
CN108976223A (en) * 2017-06-01 2018-12-11 广东东阳光药业有限公司 Fused tricyclic class compound and its application in drug
WO2019100735A1 (en) * 2017-11-22 2019-05-31 Sunshine Lake Pharma Co., Ltd. Fused tricyclic compounds and uses thereof in medicine
CN110066278A (en) * 2017-06-01 2019-07-30 广东东阳光药业有限公司 Fused tricyclic class compound and its application in drug

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105899508A (en) * 2014-01-30 2016-08-24 豪夫迈·罗氏有限公司 Novel dihydroquinolizinones for the treatment and prophylaxis of hepatitis B virus infection
WO2016071215A1 (en) * 2014-11-03 2016-05-12 F. Hoffmann-La Roche Ag Novel 6,7-dihydrobenzo[a]quinolizin-2-one derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2016128335A1 (en) * 2015-02-11 2016-08-18 F. Hoffmann-La Roche Ag Novel 2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2017017043A1 (en) * 2015-07-28 2017-02-02 F. Hoffmann-La Roche Ag Novel 6,7-dihydropyrido[2,1-a]phthalazin-2-ones for the treatment and prophylaxis of hepatitis b virus infection
CN107759585A (en) * 2016-07-29 2018-03-06 银杏树药业(苏州)有限公司 A kind of isoquinoline compound and its Pharmaceutical composition and the application as antiviral drugs
CN106810548A (en) * 2017-01-13 2017-06-09 上海爱科百发生物医药技术有限公司 A kind of dihydroisoquinoliness compound
WO2018130152A1 (en) * 2017-01-13 2018-07-19 苏州爱科百发生物医药技术有限公司 Dihydroisoquinoline compound
WO2018154466A1 (en) * 2017-02-21 2018-08-30 Glaxosmithkline Intellectual Property Development Limited Dihydroquinolizinones as antivirals
CN108976223A (en) * 2017-06-01 2018-12-11 广东东阳光药业有限公司 Fused tricyclic class compound and its application in drug
CN110066278A (en) * 2017-06-01 2019-07-30 广东东阳光药业有限公司 Fused tricyclic class compound and its application in drug
WO2019100735A1 (en) * 2017-11-22 2019-05-31 Sunshine Lake Pharma Co., Ltd. Fused tricyclic compounds and uses thereof in medicine

Also Published As

Publication number Publication date
CN110950860A (en) 2020-04-03

Similar Documents

Publication Publication Date Title
CN110066278B (en) Fused tricyclic compound and application thereof in medicines
CN110950860B (en) Fused tricyclic compound and application thereof in medicines
AU2018351400B2 (en) Dihydropyrimidine compounds and uses thereof in medicine
CN108976223B (en) Fused tricyclic compound and application thereof in medicines
CN110862390B (en) Fused tricyclic compounds and application thereof in medicines
AU2018290511B2 (en) Dihydropyrimidine compounds and uses thereof in medicine
CN111116577A (en) Fused tetracyclic compounds and application thereof in medicines
CN110964023B (en) Fused tetracyclic compounds and application thereof in medicines
CN111848627B (en) Dihydropyrimidine compound and application thereof in medicine
CN111825676B (en) Dihydropyrimidine compounds and application thereof in medicines
CN107793409B (en) Dihydropyrimidine compound and application thereof in medicine
CN111217811B (en) Fused tricyclic compounds and application thereof in medicines
CN111116588B (en) Fused tetracyclic compound and application thereof in medicines
CN110903284B (en) Fused tricyclic compounds and application thereof in medicines
CN114685514A (en) Novel amide pyrrole compound and application thereof in medicines
CN113493441A (en) Novel spiro compound and application thereof in medicines
CN114805362A (en) Novel amide pyrrole compound and application thereof in medicines
CN113831359A (en) Dihydropyrimidine compound and application thereof in medicine
CN113135937A (en) Fused tetracyclic compounds and application thereof in medicines
CN113444102A (en) Fused tetracyclic compounds and application thereof in medicines
CN117143109A (en) Fused tetracyclic compound and application thereof in medicines
CN114075206A (en) Novel fused ring compound and application thereof in medicines

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address
CP03 Change of name, title or address

Address after: 523808 No.1, Gongye North Road, Songshanhu Park, Dongguan City, Guangdong Province

Patentee after: Guangdong Dongyangguang Pharmaceutical Co.,Ltd.

Address before: 523808 No. 1 Industrial North Road, Songshan Industrial Park, Songshan, Guangdong, Dongguan, Hubei

Patentee before: SUNSHINE LAKE PHARMA Co.,Ltd.