CN111116588B

CN111116588B - Fused tetracyclic compound and application thereof in medicines

Info

Publication number: CN111116588B
Application number: CN201911035212.2A
Authority: CN
Inventors: 黄建洲; 任青云; 刘洋; 张英俊; 李中乐
Original assignee: Guangdong HEC Pharmaceutical
Current assignee: Guangdong HEC Pharmaceutical
Priority date: 2018-10-30
Filing date: 2019-10-29
Publication date: 2024-01-16
Anticipated expiration: 2039-10-29
Also published as: CN111116588A

Abstract

The invention relates to a fused tetracyclic compound and application thereof in medicines, in particular to application of the fused tetracyclic compound as a medicine for treating and/or preventing hepatitis B. Specifically, the invention relates to a compound shown in a general formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, wherein each variable is defined in the specification. The invention also relates to the use of a compound of general formula (I) or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof as a medicament, in particular as a medicament for the treatment and/or prophylaxis of hepatitis B.

Description

Fused tetracyclic compound and application thereof in medicines

Technical Field

The invention belongs to the field of medicines, and relates to a fused tetracyclic compound and application thereof as a medicine, in particular to application thereof as a medicine for treating and/or preventing hepatitis B. The invention also relates to compositions of these fused tetracyclic compounds with other antiviral agents, and their use in the treatment and/or prevention of Hepatitis B Virus (HBV) infection.

Background

Hepatitis b virus belongs to the family of hepatiridae. It may cause acute and/or persistent progressive chronic diseases. Hepatitis b virus can also cause many other clinical manifestations in pathological forms-especially chronic inflammation of the liver, cirrhosis and canceration of hepatocytes. It is estimated by the world health organization that 20 million people worldwide are infected with HBV, about 3.5 million chronically infected people, and about 100 tens of thousands of people die annually from liver failure, cirrhosis and primary hepatocellular carcinoma (hepatocellular carcinoma, HCC) caused by HBV infection.

Current treatment for chronic hepatitis b (Chronic hepatitis B, CHB) is primarily antiviral. Interferon alpha (IFN-alpha) and pegylated IFN-alpha and 5 nucleoside (acid) analogs (lamivudine, adefovir dipivoxil, entecavir, telbivudine, and tenofovir) are approved by the united states Food and Drug Administration (FDA) for clinical treatment. Interferon is an anti-HBV drug approved by FDA at the earliest, and is mainly used for achieving the effect of removing viruses by direct antiviral action and inducing immune response of organisms, but has many side effects due to low response rate, high price, limitation of treatment subjects and the like, and has many limitations in application. The anti-HBV common point of the nucleoside (nucleotide) drugs is that the nucleoside (nucleotide) drugs specifically act on viral DNA polymerase, have strong effect of inhibiting viral replication, and have better tolerance to drugs than interferon. However, the wide and long-term use of the nucleoside (acid) drugs can induce DNA polymerase mutation to form drug resistance, which leads to the continuous appearance of drug-resistant strains, so that the treatment can not achieve ideal curative effect.

Thus, there remains a need in the clinic for new compounds that can be effectively used as antiviral agents, particularly as agents for the treatment and/or prophylaxis of hepatitis b.

Disclosure of Invention

The invention relates to a novel fused tetracyclic compound and application thereof in preparing medicaments for treating and preventing HBV infection. The inventor discovers that the novel fused tetracyclic compound has the advantages of good pharmacokinetic property, good solubility, low toxicity, good liver microsome stability, good inhibitory activity on generation or secretion of HBsAg and replication of HBV DNA, and the like, and has good application prospect in anti-HBV aspect. In particular, the compounds of the present invention, and pharmaceutically acceptable compositions thereof, are also effective in inhibiting HBV infection.

In one aspect, the present invention relates to a compound of formula (I) or a stereoisomer, tautomer, nitroxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of a compound of formula (I),

wherein R is ¹ Is R ^1a O-or R ^a R ^b N-；

X is N or CH;

ring a is a heteroaryl group of 5 ring atoms, a heteroaryl group of 6 ring atoms, a heterocyclic group of 5 ring atoms, or a heterocyclic group of 6 ring atoms;

R ² Is hydrogen, deuterium, HO-, F, cl, br, R ⁸ -(C＝O)-、R ^8a O-(C＝O)-、C _1-6 Alkoxy, C _2-6 Alkenyl, C _2-6 Alkynyl, C _3-7 Cycloalkyl, heterocyclyl consisting of 3-10 ring atoms, C _6-10 Aryl or heteroaryl consisting of 5-10 ring atoms, wherein said C _1-6 Alkoxy, C _2-6 Alkenyl, C _2-6 Alkynyl, C _3-7 Cycloalkyl, heterocyclyl consisting of 3-10 ring atoms, C _6-10 Aryl and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w1 Substituted;

R ³ is hydrogen, deuterium, R ¹⁰ -C _1-4 Alkylene, R ¹⁰ -C _1-4 alkylene-S (=o) ₂ -、C _1-6 Alkyl, C _1-6 Alkylamino, C _1-6 Alkoxy, C _2-6 Alkynyl, C _2-6 Alkenyl, C _3-7 Cycloalkyl, phenyl or heterocyclyl of 3 to 6 ring atoms, wherein R is ¹⁰ -C _1-4 C in alkylene group _1-4 Alkylene, R ¹⁰ -C _1-4 alkylene-S (=o) ₂ C in _1-4 Alkylene, C _1-6 Alkyl, C _1-6 Alkylamino, C _1-6 Alkoxy, C _2-6 Alkynyl, C _2-6 Alkenyl, C _3-7 Cycloalkyl, phenyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w2 Substituted;

R ^8a is hydrogen, deuterium, C _1-6 Alkyl or C _3-6 Cycloalkyl, wherein said C _1-6 Alkyl and C _3-6 Cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

R ⁸ is hydrogen, deuterium, HO-, R ^a R ^b N-、C _1-6 Alkyl, C _3-6 Cycloalkyl, heterocyclyl of 3-6 ring atoms, C _6-10 Aryl or heteroaryl consisting of 5 to 10 ring atoms, wherein said C _1-6 Alkyl, C _3-6 Cycloalkyl, heterocyclyl of 3-6 ring atoms, C _6-10 Aryl and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

R ¹⁰ is hydrogen, deuterium, HO-, R ^a R ^b N-、R ¹¹ -S(＝O) ₂ -、C _1-6 Alkyl, C _1-6 Alkoxy, C _3-6 Cycloalkyl, heterocyclyl of 3-6 ring atoms, C _6-10 Aryl or heteroaryl consisting of 5 to 10 ring atoms, wherein said C _1-6 Alkyl, C _1-6 Alkoxy, C _3-6 Cycloalkyl, heterocyclyl of 3-6 ring atoms, C _6-10 Aryl and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

each R is ^3a 、R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁹ And R is ¹¹ Independently hydrogen, deuterium, F, cl, br, C _1-6 Alkyl, C _1-6 Alkylamino, C _1-6 Alkoxy, C _2-6 Alkynyl, C _2-6 Alkenyl, C _3-7 Cycloalkyl, phenyl or heterocyclic groups of 3-10 ring atoms, wherein said C _1-6 Alkyl, C _1-6 Alkylamino, C _1-6 Alkoxy, C _2-6 Alkynyl, C _2-6 Alkenyl, C _3-7 Cycloalkyl, phenyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w4 Substituted;

each R is ^1a 、R ^a And R is ^b Independently hydrogen, deuterium, C _1-6 Alkyl, C _1-6 Alkoxy, C _2-6 Alkenyl, C _2-6 Alkynyl, C _3-6 Cycloalkyl, C _6-10 Aryl, heterocyclyl consisting of 3 to 6 ring atoms or heteroaryl consisting of 5 to 10 ring atoms, wherein said C _1-6 Alkyl, C _1-6 Alkoxy, C _2-6 Alkenyl, C _2-6 Alkynyl, C _3-6 Cycloalkyl, C _6-10 Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w5 Substituted;

each R is ^w1 、R ^w2 、R ^w3 、R ^w4 And R is ^w5 Independently deuterium, F, cl, br, HO-, HOOC-, =o, amino, C _1-6 Alkyl, C _1-6 Alkoxy, C _1-6 Alkylthio, C _1-6 Alkylamino, C _2-6 Alkenyl, C _2-6 Alkynyl or C _3-7 Cycloalkyl, wherein the amino group, C _1-6 Alkyl, C _1-6 Alkoxy, C _1-6 Alkylthio, C _1-6 Alkylamino, C _2-6 Alkenyl, C _2-6 Alkynyl or C _3-7 Cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, cl, br, CN, HO-, =o, amino, C _1-6 Alkyl, C _1-6 Haloalkyl, C _1-6 Alkoxy, C _1-6 Alkylthio, C _1-6 Haloalkoxy or C _1-6 Substituted by alkylamino;

n is 0, 1, 2, 3 or 4.

In some embodiments, the compounds of the present invention have a compound of formula (II)

Wherein-is a single bond or a double bond;

when- - -is a double bond, each X ₁ And X ₂ independently-C (R) ^3a )＝、＝C(R ^3a ) -n=or=n-;

when- - -is a single bond, each X ₁ And X ₂ independently-C (R) ^3a ) ₂ -or-O-;

wherein each R ¹ 、R ² 、R ³ 、R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁹ 、R ^3a And X has the meaning described in the present invention.

In some embodiments, R as described in the present invention ² Is hydrogen, deuterium, HO-, F, cl, br, R ⁸ -(C＝O)-、R ^8a O-(C＝O)-、C _1-4 Alkoxy, C _2-4 Alkenyl, C _2-4 Alkynyl, C _3-6 Cycloalkyl, heterocyclyl of 3 to 6 ring atoms, phenyl, heteroaryl of 5 ring atoms or heteroaryl of 6 ring atoms, wherein said C _1-4 Alkoxy, C _2-4 Alkenyl, C _2-4 Alkynyl, C _3-6 Cycloalkyl, heterocyclyl of 3 to 6 ring atoms, phenyl, heteroaryl of 5 ring atoms and heteroaryl of 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w1 Substituted;

R ³ is hydrogen, deuterium, R ¹⁰ -C _1-3 Alkylene, R ¹⁰ -C _1-3 alkylene-S (=o) ₂ -、C _1-4 Alkyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, C _3-6 Cycloalkyl, phenyl or heterocyclyl of 3 to 6 ring atoms, wherein R is ¹⁰ -C _1-3 C in alkylene group _1-3 Alkylene, R ¹⁰ -C _1-3 alkylene-S (=o) ₂ C in _1-3 Alkylene, C _1-4 Alkyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, C _3-6 NaphtheneThe radicals, phenyl radicals and heterocyclic radicals composed of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4R ^w2 Substituted;

wherein each R ¹⁰ 、R ⁸ 、R ^8a 、R ^w1 And R is ^w2 Having the meaning described in the present invention.

In some embodiments, R as described in the present invention ² Is hydrogen, deuterium, HO-, F, cl, br, R ⁸ -(C＝O)-、R ^8a O- (c=o) -, methoxy, ethoxy, 1-propoxy, 2-propoxy, C _2-4 Alkenyl, ethynyl, propargyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methoxy, ethoxy, 1-propoxy, 2-propoxy, C _2-4 Alkenyl, ethynyl, propargyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently of the other are unsubstituted or substituted with 1, 2, 3 or 4R ^w1 Substituted;

R ³ is hydrogen, deuterium, R ¹⁰ -CH ₂ -、R ¹⁰ -(CH ₂ ) ₂ -、R ¹⁰ -(CH ₂ ) ₃ -、R ¹⁰ -CH ₂ -S(＝O) ₂ -、R ¹⁰ -(CH ₂ ) ₂ -S(＝O) ₂ -、R ¹⁰ -(CH ₂ ) ₃ -S(＝O) ₂ -, methyl, ethyl, n-propyl, isopropyl, C _1-3 Alkylamino, methoxy, ethoxy, 1-propoxy, 2-propoxy, ethynyl, propynyl, propargyl, C _2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein R is ¹⁰ -CH ₂ -CH in ₂ -、R ¹⁰ -(CH ₂ ) ₂ - (CH) in- ₂ ) ₂ -、R ¹⁰ -(CH ₂ ) ₃ - (CH) in- ₂ ) ₃ -、R ¹⁰ -CH ₂ -S(＝O) ₂ -CH in ₂ -、R ¹⁰ -(CH ₂ ) ₂ -S(＝O) ₂ - (CH) in- ₂ ) ₂ -、R ¹⁰ -(CH ₂ ) ₃ -S(＝O) ₂ - (CH) in- ₂ ) ₃ -, methyl, ethyl, n-propyl, isopropyl, C _1-3 Alkylamino, methoxy, ethoxy, 1-propoxy, 2-propoxy, ethynyl, propynyl, propargyl, C _2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl each independently are unsubstituted or substituted with 1, 2, 3 or 4R ^w2 Substituted;

In some embodiments, R as described in the present invention ^8a Is hydrogen, deuterium, C _1-4 Alkyl or C _3-6 Cycloalkyl, wherein said C _1-4 Alkyl and C _3-6 Cycloalkyl groups eachUnsubstituted or substituted independently by 1, 2, 3 or 4R ^w3 Substituted;

R ⁸ is hydrogen, deuterium, HO-, R ^a R ^b N-、C _1-4 Alkyl, C _3-6 Cycloalkyl, heterocyclyl of 3 to 6 ring atoms, phenyl or heteroaryl of 5 to 6 ring atoms, wherein said C _1-4 Alkyl, C _3-6 Cycloalkyl, heterocyclyl of 3 to 6 ring atoms, phenyl and heteroaryl of 5 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

R ¹⁰ is hydrogen, deuterium, HO-, R ^a R ^b N-、R ¹¹ -S(＝O) ₂ -、C _1-4 Alkyl, C _1-4 Alkoxy, C _3-6 Cycloalkyl, heterocyclyl of 3 to 6 ring atoms, phenyl, heteroaryl of 5 ring atoms or heteroaryl of 6 ring atoms, wherein said C _1-4 Alkyl, C _1-4 Alkoxy, C _3-6 Cycloalkyl, heterocyclyl of 3 to 6 ring atoms, phenyl, heteroaryl of 5 ring atoms and heteroaryl of 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

each R is ^3a 、R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁹ And R is ¹¹ Independently hydrogen, deuterium, F, cl, br, C _1-4 Alkyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, C _3-6 Cycloalkyl, phenyl or heterocyclic groups of 3-6 ring atoms, wherein said C _1-4 Alkyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, C _3-6 Cycloalkyl, phenyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w4 Substituted;

wherein each R ^a 、R ^b 、R ^w3 And R is ^w4 Having the meaning described in the present invention.

In some embodiments, R as described in the present invention ^8a Is hydrogen, deuterium,Methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

R ⁸ is hydrogen, deuterium, HO-, R ^a R ^b N-, methyl, ethyl, N-propyl, isopropyl, N-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

R ¹⁰ is hydrogen, deuterium, HO-, R ^a R ^b N-、R ¹¹ -S(＝O) ₂ -, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy2-butoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

each R is ^3a 、R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁹ And R is ¹¹ Independently hydrogen, deuterium, F, cl, br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl groupIsobutyl, sec-butyl, tert-butyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl each independently are unsubstituted or substituted with 1, 2, 3 or 4R ^w4 Substituted;

In some embodiments, each R as described herein ^1a 、R ^a And R is ^b Independently hydrogen, deuterium, C _1-4 Alkyl, C _1-4 Alkoxy, C _2-4 Alkenyl, C _2-4 Alkynyl, C _3-6 Cycloalkyl, phenyl, heterocyclyl of 3-6 ring atoms, heteroaryl of 5 ring atoms or heteroaryl of 6 ring atoms, wherein said C _1-4 Alkyl, C _1-4 Alkoxy, C _2-4 Alkenyl, C _2-4 Alkynyl, C _3-6 Cycloalkyl, phenyl, heterocyclyl of 3 to 6 ring atoms, heteroaryl of 5 ring atoms and heteroaryl of 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w5 Substituted;

each R is ^w1 、R ^w2 、R ^w3 、R ^w4 And R is ^w5 Independently deuterium, F, cl, br, HO-, HOOC-, =o, amino, C _1-4 Alkyl, C _1-4 Alkoxy, C _1-4 Alkylthio, C _1-4 Alkylamino, C _2-4 Alkenyl, C _2-4 Alkynyl or C _3-6 Cycloalkyl, wherein the amino group, C _1-4 Alkyl, C _1-4 Alkoxy, C _1-4 Alkylthio, C _1-4 Alkylamino, C _2-4 Alkenyl, C _2-4 Alkynyl and C _3-6 Cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, cl, br, CN, HO-, =o, amino, C _1-4 Alkyl group、C _1-4 Haloalkyl, C _1-4 Alkoxy, C _1-4 Alkylthio, C _1-4 Haloalkoxy or C _1-4 The substituent of alkylamino is substituted.

In some embodiments, each R as described herein ^1a 、R ^a And R is ^b Independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, ethenyl, propenyl, allyl, ethynyl, propargyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, ethenyl, propenyl, allyl, ethynyl, propargyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w5 Substituted.

Each R is ^w1 、R ^w2 、R ^w3 、R ^w4 And R is ^w5 Independently deuterium, F, cl, br, HO-, HOOC-, =o, amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, C _1-3 Alkylthio, C _1-3 Alkylamino, ethenyl, propenyl, allyl, ethynyl, propargyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, C _1-3 Alkylthio, C _1-3 Alkylamino, ethenyl, propenyl, allyl, ethynyl, propargyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted by 1, 2, 3 or 4 members selected from F, cl, br, CN, HO-, =o, amino, C _1-3 Alkyl, C _1-3 Haloalkyl, C _1-3 Alkoxy, C _1-3 Alkylthio, C _1-3 Haloalkoxy or C _1-3 The substituent of alkylamino is substituted.

In another aspect, the invention also provides a pharmaceutical composition comprising the compound of the invention, optionally, the pharmaceutical composition further comprising a pharmaceutically acceptable adjuvant or a combination of said adjuvants.

In some embodiments, the pharmaceutical compositions of the present invention further comprise other anti-HBV agents.

In some embodiments, the pharmaceutical composition of the invention, wherein the additional anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator or an interferon.

In some embodiments, the pharmaceutical composition of the invention, wherein the additional anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, cil Mo Baijie, cladvudine, emtricitabine, famciclovir, interferon, baganine CP, idofen, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, milfutidine, nitazoxanide, polyethylene glycol interferon alpha-2 a, ribavirin, luo Raosu-a, cizopyran, euforavac, an Puli, phosphazid, heplisav, interferon alpha-2 b, levamisole or propargine.

In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the manufacture of a medicament for preventing, treating or alleviating a viral disease in a patient.

In some embodiments, the use of the invention, wherein the viral disease is a hepatitis b virus infection or a disease caused by a hepatitis b virus infection.

In other embodiments, the use of the invention, wherein the disease caused by hepatitis b virus infection is cirrhosis or hepatocellular carcinoma.

In another aspect, the invention also provides the use of said compound or said pharmaceutical composition for the manufacture of a medicament for inhibiting the production or secretion of HBsAg and/or for inhibiting the production of HBV DNA.

In another aspect, the invention relates to the use of said compound or pharmaceutical composition for the manufacture of a medicament for preventing, treating or alleviating a hepatitis b disease in a patient.

Another aspect of the invention relates to a method of preventing, treating or alleviating HBV conditions in a patient, said method comprising administering to the patient a pharmaceutically acceptable effective dose of a compound of the invention.

Another aspect of the invention relates to a method of preventing, treating or alleviating HBV conditions in a patient comprising administering to the patient a pharmaceutically acceptable effective dose of a pharmaceutical composition comprising a compound of the invention.

Another aspect of the invention relates to the use of a compound of the invention for the preparation of a medicament for the prevention, treatment or therapy of HBV disorders in a patient and for the reduction of the severity thereof.

Another aspect of the invention relates to the use of a pharmaceutical composition comprising a compound of the invention for the preparation of a medicament for preventing or treating HBV disorders in a patient and reducing the severity thereof.

In another aspect, the invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or composition of the invention in an amount effective to inhibit HBV. In other embodiments, the method further comprises contacting the cell with an additional anti-HBV agent.

Another aspect of the invention relates to a method of treating HBV disease in a patient comprising administering to the patient a therapeutically effective amount of a compound of the invention or a composition thereof. In other embodiments, the method further comprises administration of other HBV treatments.

In another aspect, the present invention relates to a method of inhibiting HBV infection in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administration of other HBV treatments.

Another aspect of the invention relates to methods for the preparation, isolation and purification of the compounds comprised by formula (I).

The foregoing merely outlines certain aspects of the invention and is not limited in this regard. These and other aspects are described more fully below.

Detailed description of the invention

Definitions and general terms

The invention will be described in detail with reference to certain specific details, examples of which are provided with illustrations of structural and chemical formulas. The invention is intended to cover all alternatives, modifications and equivalents, which may be included within the scope of the invention as defined by the appended claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein that can be used in the practice of the present invention. The invention is in no way limited to the description of methods and materials. There are numerous documents and similar substances which differ or contradict the present application, including but in no way limited to the definition of terms, the use of terms, the described techniques, or the scope of control as per the present application.

The invention will apply to the following definitions unless otherwise indicated. For the purposes of the present invention, the chemical elements are described in terms of the periodic table of the elements, CAS version and handbook of chemicals, 75, ^th ed, 1994. In addition, the general principles of organic chemistry are found in "Organic Chemistry," Thomas Sorrell, university Science Books, sausalato 1999,and"March's Advanced Organic Chemistry," by Michael B.Smith and Jerry March, john Wiley&Sons, new York:2007, and thus all references are incorporated herein by reference.

As described herein, compounds of the invention are substituted with one or more substituents, such as those of the general formula above, or as in the specific examples, subclasses, and classes of compounds encompassed by the invention. In general, the term "substituted" means that one or more hydrogen atoms in a given structure are replaced with a specific substituent. Unless otherwise indicated, a substituted group may have a substituent substituted at each substitutable position of the group. When more than one position in a given formula can be substituted with one or more substituents selected from a particular group, then the substituents may be the same or different at each position. In the various parts of the present specification, substituents of the presently disclosed compounds are disclosed in terms of the type or scope of groups. It is specifically noted that the present invention includes each individual subcombination of the individual members of these group classes and ranges. For example, the term "C _1-6 Alkyl "means in particular methyl, ethyl, C independently disclosed ₃ Alkyl, C ₄ Alkyl, C ₅ Alkyl and C ₆ An alkyl group.

In addition, unless explicitly indicated otherwise, the descriptions used in this disclosure of the manner in which each … is independently "and" … is independently "and" … is independently "are to be construed broadly as meaning that particular items expressed between the same symbols in different groups do not affect each other, or that particular items expressed between the same symbols in the same groups do not affect each other.

The term "alkyl" as used herein includes saturated straight or branched chain monovalent hydrocarbon radicals of 1 to 20 carbon atoms, wherein the alkyl radicals may independently be optionally substituted by one or more substituents as described herein. Some embodiments are where the alkyl group contains 1 to 12 carbon atoms, some other embodiments are where the alkyl group contains 1 to 8 carbon atoms, some other embodiments are where the alkyl group contains 1 to 6 carbon atoms, and some other embodiments are where the alkyl group contains 1 to 4 carbonsAn atom, other embodiments are alkyl groups containing 1-3 carbon atoms. Further examples of alkyl groups include, but are not limited to, methyl (Me, -CH) ₃ ) Ethyl (Et, -CH) ₂ CH ₃ ) N-propyl (n-Pr, -CH) ₂ CH ₂ CH ₃ ) Isopropyl (i-Pr, -CH (CH) ₃ ) ₂ ) N-butyl (n-Bu, -CH) ₂ CH ₂ CH ₂ CH ₃ ) 2-methylpropyl or isobutyl (i-Bu, -CH) ₂ CH(CH ₃ ) ₂ ) 1-methylpropyl or sec-butyl (s-Bu, -CH (CH) ₃ )CH ₂ CH ₃ ) Tert-butyl (t-Bu, -C (CH) ₃ ) ₃ ) N-pentyl (-CH) ₂ CH ₂ CH ₂ CH ₂ CH ₃ ) 2-pentyl (-CH (CH) ₃ )CH ₂ CH ₂ CH ₃ ) 3-pentyl (-CH (CH) ₂ CH ₃ ) ₂ ) 2-methyl-2-butyl (-C (CH) ₃ ) ₂ CH ₂ CH ₃ ) 3-methyl-2-butyl (-CH (CH) ₃ )CH(CH ₃ ) ₂ ) 3-methyl-1-butyl (-CH) ₂ CH ₂ CH(CH ₃ ) ₂ ) 2-methyl-1-butyl (-CH) ₂ CH(CH ₃ )CH ₂ CH ₃ ) N-hexyl (-CH) ₂ CH ₂ CH ₂ CH ₂ CH ₂ CH ₃ ) 2-hexyl (-CH (CH) ₃ )CH ₂ CH ₂ CH ₂ CH ₃ ) 3-hexyl (-CH (CH) ₂ CH ₃ )(CH ₂ CH ₂ CH ₃ ) 2-methyl-2-pentyl (-C (CH) ₃ ) ₂ CH ₂ CH ₂ CH ₃ ) 3-methyl-2-pentyl (-CH (CH) ₃ )CH(CH ₃ )CH ₂ CH ₃ ) 4-methyl-2-pentyl (-CH (CH) ₃ )CH ₂ CH(CH ₃ ) ₂ ) 3-methyl-3-pentyl (-C (CH) ₃ )(CH ₂ CH ₃ ) ₂ ) 2-methyl-3-pentyl (-CH (CH) ₂ CH ₃ )CH(CH ₃ ) ₂ ) 2, 3-dimethyl-2-butyl (-C (CH) ₃ ) ₂ CH(CH ₃ ) ₂ ) 3, 3-dimethyl-2-butyl (-CH (CH) ₃ )C(CH ₃ ) ₃ ) 3, 3-dimethyl-butyl (-C)H ₂ CH ₂ C(CH ₃ ) ₃ ) N-heptyl, n-octyl, and the like. The term "alkyl" and its prefix "alkane" are used herein to encompass both straight and branched saturated carbon chains. The term "halogenated aliphatic" as used herein means that an aliphatic group is substituted with one or more halogen atoms, the same or different, wherein the aliphatic group or alkyl group has the meaning as described herein, and the halogen atoms, i.e., fluorine, chlorine, bromine or iodine, such examples include, but are not limited to, trifluoromethyl, trifluoroethyl, and the like.

The term "haloalkyl" means an alkyl group substituted with one or more halogen atoms, wherein alkyl has the meaning described herein. Some of these embodiments are those wherein the haloalkyl group contains from 1 to 12 carbon atoms; still other embodiments are haloalkyl groups containing 1 to 10 carbon atoms; still other embodiments are haloalkyl groups containing 1 to 8 carbon atoms; still other embodiments are haloalkyl groups containing 1 to 6 carbon atoms; still other embodiments are haloalkyl groups containing 1 to 4 carbon atoms, and still other embodiments are haloalkyl groups containing 1 to 3 carbon atoms. Examples include, but are not limited to, trifluoromethyl, trifluoroethyl, and the like.

The term "carboxy", whether used alone or in combination with other terms (e.g., "carboxyalkyl"), means-CO ₂ H or-COOH.

The term "carbonyl", whether used alone or in combination with other terms (e.g., "aminocarbonyl" or "acyloxy"), means- (C=O) -.

The terms "alkylamino" and "alkylamino" are used interchangeably and include "N-alkylamino" and "N, N-dialkylamino" in which the amino groups are each independently substituted with one or two C' s _1-12 Alkyl groups are substituted. In some embodiments, the alkylamino groups are one or two C _1-12 Lower alkylamino groups in which the alkyl group is attached to a nitrogen atom, in some embodiments, the alkylamino group is C _1-6 Lower alkylamino groups of (a), in some embodiments alkylamino is C _1-4 Lower alkylamino groups of (a). Suitable alkyl groupsThe amino group may be a mono-or di-alkylamino group, examples of which include, but are not limited to, N-methylamino, N-ethylamino, N-dimethylamino, N-diethylamino, N-propylamino, N-dipropylamino, etc., wherein the alkylamino group may be independently unsubstituted or substituted with one or more of the substituents described herein.

The term "alkylene" means a saturated divalent hydrocarbon group obtained by removing two hydrogen atoms from a straight or branched saturated hydrocarbon group. Unless otherwise specified, alkylene groups contain 1 to 12 carbon atoms, with other embodiments alkylene groups containing 1 to 6 carbon atoms, with other embodiments alkylene groups containing 1 to 4 carbon atoms, and with other embodiments alkylene groups containing 1 to 3 carbon atoms. Still other embodiments are those wherein the alkylene group contains 1 to 2 carbon atoms. Examples of this include methylene (-CH) ₂ (-), ethylene (-CH) ₂ CH ₂ (-), propylene (-CH) ₂ CH ₂ CH ₂ (-), isopropylidene (-CH (CH) ₃ )CH ₂ -) and butylene (-CH) ₂ CH ₂ CH ₂ CH ₂ -) pentylene (-CH) ₂ CH ₂ CH ₂ CH ₂ CH ₂ (-), hexylene (-CH) ₂ CH ₂ CH ₂ CH ₂ CH ₂ CH ₂ (-), heptylene (-CH) ₂ CH ₂ CH ₂ CH ₂ CH ₂ CH ₂ CH ₂ (-), octylene (-CH) ₂ CH ₂ CH ₂ CH ₂ CH ₂ CH ₂ CH ₂ CH ₂ (-) and the like, wherein the alkylene groups may independently be unsubstituted or substituted with one or more substituents described herein.

The term "alkenyl" means a straight or branched monovalent hydrocarbon radical containing 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein at least one position of C-C is sp ² Double bonds, where the alkenyl groups may independently be unsubstituted or substituted with one or more substituents described herein, including the "cis", "trans" or "Z", "E" isomers Specific examples thereof include, but are not limited to, vinyl (-ch=ch) ₂ ) Propenyl (-ch=chch) ₃ ) Allyl (-CH) ₂ CH＝CH ₂ ) Etc., wherein the alkenyl groups may independently be unsubstituted or substituted with one or more substituents described herein.

The term "alkynyl" means a straight or branched chain monovalent hydrocarbon radical containing 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein C-C in at least one position is an sp triple bond, wherein the alkynyl group may be independently unsubstituted or substituted with one or more substituents described herein, specific examples include, but are not limited to, ethynyl (-C≡CH), propargyl (-CH) ₂ C.ident.CH), propynyl (-C.ident.C-CH ₃ ) 1-propargyl (-CH) ₂ CH ₂ C.ident.CH), 2-alkynylbutyl (-CH) ₂ C≡CCH ₃ ) 3-propargyl (-C.ident.CCH) ₂ CH ₃ ) Etc., wherein the alkynyl groups may independently be unsubstituted or substituted with one or more substituents described herein.

The term "alkoxy" means that the alkyl group is attached to the remainder of the molecule through an oxygen atom, wherein the alkyl group has the meaning as described herein. Unless otherwise specified, the alkoxy groups contain from 1 to 20 carbon atoms, some embodiments are alkoxy groups containing from 1 to 12 carbon atoms, other embodiments are alkoxy groups containing from 1 to 8 carbon atoms, other embodiments are alkoxy groups containing from 1 to 6 carbon atoms, other embodiments are alkoxy groups containing from 1 to 4 carbon atoms, and other embodiments are alkoxy groups containing from 1 to 3 carbon atoms.

Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH) ₃ ) Ethoxy (EtO, -OCH) ₂ CH ₃ ) 1-propoxy (n-PrO, n-propoxy, -OCH) ₂ CH ₂ CH ₃ ) 2-propoxy (i-PrO, i-propoxy, -OCH (CH) ₃ ) ₂ ) 1-butoxy (n-BuO, n-butoxy, -OCH) ₂ CH ₂ CH ₂ CH ₃ ) 2-methyl-l-propoxy (i-BuO, i-butoxy),-OCH ₂ CH(CH ₃ ) ₂ ) 2-butoxy (s-BuO, s-butoxy, -OCH (CH) ₃ )CH ₂ CH ₃ ) 2-methyl-2-propoxy (t-BuO, t-butoxy, -OC (CH) ₃ ) ₃ ) 1-pentoxy (n-pentoxy, -OCH) ₂ CH ₂ CH ₂ CH ₂ CH ₃ ) 2-pentoxy (-OCH (CH) ₃ )CH ₂ CH ₂ CH ₃ ) 3-pentoxy (-OCH (CH) ₂ CH ₃ ) ₂ ) 2-methyl-2-butoxy (-OC (CH) ₃ ) ₂ CH ₂ CH ₃ ) 3-methyl-2-butoxy (-OCH (CH) ₃ )CH(CH ₃ ) ₂ ) 3-methyl-l-butoxy (-OCH) ₂ CH ₂ CH(CH ₃ ) ₂ ) 2-methyl-l-butoxy (-OCH) ₂ CH(CH ₃ )CH ₂ CH ₃ ) And the like, wherein the alkoxy groups may independently be unsubstituted or substituted with one or more substituents described herein.

The term "haloalkoxy" means that the alkoxy group is substituted with one or more halogen atoms, wherein alkoxy has the meaning described herein. Some of these embodiments are those wherein the haloalkoxy group contains from 1 to 12 carbon atoms; still other embodiments are haloalkoxy groups having from 1 to 10 carbon atoms; still other embodiments are haloalkoxy groups having from 1 to 8 carbon atoms; still other embodiments are haloalkoxy groups having from 1 to 6 carbon atoms; still other embodiments are haloalkoxy groups having 1 to 4 carbon atoms, and still other embodiments are haloalkoxy groups having 1 to 3 carbon atoms. Examples include, but are not limited to, trifluoromethoxy and the like.

The terms "carbocycle", "carbocyclyl" and "carbocyclic" are used interchangeably herein to refer to a non-aromatic carbocyclic ring system that is saturated or contains one or more units of unsaturation, and contains 3 to 14 carbon ring atoms. In some embodiments, the number of carbon atoms is 3 to 12; in other embodiments, the number of carbon atoms is 3 to 10; in other embodiments, the number of carbon atoms is 3 to 8; in other embodiments, the number of carbon atoms is 3 to 6; in other embodiments, the number of carbon atoms is 5 to 6; in other embodiments, the number of carbon atoms is from 5 to 8. In other embodiments, the number of carbon atoms is from 6 to 8. The term "carbocyclyl" includes monocyclic, bicyclic or polycyclic fused, spiro or bridged carbocyclic ring systems, as well as polycyclic ring systems in which the carbocycle may be fused to one or more non-aromatic carbocycles or heterocycles or one or more aromatic rings or combinations thereof, wherein the attached radicals or points are on the carbocycle. Bicyclic carbocyclyl includes bridged bicyclic carbocyclyl, fused bicyclic carbocyclyl, and spiro bicyclic carbocyclyl, the "fused" bicyclic ring system comprising two rings sharing 2 contiguous ring atoms. The bridge Lian Shuanghuan group includes two rings sharing 3 or 4 adjacent ring atoms. The spiro ring system shares 1 ring atom. Suitable carbocyclic groups include, but are not limited to, cycloalkyl, cycloalkenyl, and cycloalkynyl. Examples of carbocyclic groups further include, but are in no way limited to, cyclopropyl, cyclobutyl, cyclopentyl, 1-cyclopentyl-1-alkenyl, 1-cyclopentyl-2-alkenyl, 1-cyclopentyl-3-alkenyl, cyclohexyl, 1-cyclohexyl-1-alkenyl, 1-cyclohexyl-2-alkenyl, 1-cyclohexyl-3-alkenyl, cyclohexanedienyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cycloundecyl, cyclododecyl, and the like. Bridged carbocyclyl groups include, but are not limited to, bicyclo [2.2.2] octyl, bicyclo [2.2.1] heptyl, bicyclo [3.3.1] nonyl, bicyclo [3.2.3] nonyl, and the like.

The term "cycloalkyl" refers to a monocyclic, bicyclic or tricyclic ring system containing 3 to 12 ring carbon atoms that is saturated and has one or more points of attachment to the remainder of the molecule. Some of these embodiments, cycloalkyl groups are ring systems containing 3 to 10 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing 3 to 8 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing 3 to 7 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing 5 to 8 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing 3 to 6 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing 5 to 6 ring carbon atoms; examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like, and the cycloalkyl groups may independently be unsubstituted or substituted with one or more substituents described herein.

The terms "heterocyclyl" and "heterocycle" are used interchangeably herein to refer to a saturated or partially unsaturated, non-aromatic, monocyclic, bicyclic or tricyclic ring system containing 3 to 12 ring atoms, at least one of which is selected from the group consisting of nitrogen, sulfur and oxygen atoms, and which has one or more points of attachment to the remainder of the molecule. The term "heterocyclyl" includes monocyclic, bicyclic or polycyclic fused, spiro or bridged heterocyclic ring systems, as well as polycyclic ring systems in which the heterocyclic ring may be fused to one or more non-aromatic carbocyclic or heterocyclic rings or one or more aromatic rings or combinations thereof, wherein the attached radicals or points are on the heterocyclic ring. Bicyclic heterocyclyl groups include bridged bicyclic heterocyclyl groups, fused bicyclic heterocyclyl groups, and spiro bicyclic heterocyclyl groups. Unless otherwise indicated, -CH on heterocyclyl ₂ The group may optionally be replaced by-C (=o) -. The sulfur atom of the ring may optionally be oxidized to an S-oxide. The nitrogen atom of the ring may optionally be oxidized to an N-oxide. In some embodiments, the heterocyclyl is a ring system consisting of 3 to 12 ring atoms; in other embodiments, the heterocyclyl is a ring system of 3 to 8 ring atoms; in other embodiments, the heterocyclyl is a ring system of 3 to 6 ring atoms; in other embodiments, the heterocyclyl is a ring system of 5 to 7 ring atoms; in other embodiments, the heterocyclyl is a ring system of 5 to 8 ring atoms; in other embodiments, the heterocyclyl is a ring system of 6 to 8 ring atoms; in other embodiments, the heterocyclyl is a ring system of 5 to 6 ring atoms; in other embodiments, the heterocyclyl is a ring system of 3 ring atoms; in other embodiments, the heterocyclyl is a ring system of 4 ring atoms; in other embodiments, the heterocyclyl is a ring system of 5 ring atoms; in other embodiments, the heterocyclyl is a ring system of 6 ring atoms; in other embodiments, the heterocyclyl is a ring system of 7 ring atoms; in other embodiments, the heterocyclyl is a ring system of 8 ring atoms.

Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thiazalkyl, piperazinyl, homopiperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxetanyl, azepanyl, oxepinyl, thietanyl, azepinyl, thiazepinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1, 3-dioxanyl, pyrazolinyl, dithianyl, dihydrothienyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 1,2,3, 4-tetrahydroisoquinolinyl, 3-azabicyclo [3.1.0] hexyl, 3-azabicyclo [4.1.0] heptyl, aza [ 2.2H-pyranyl, 2H-quinolyl, and urea. Examples of heterocyclic groups also include 1, 1-dioxothiomorpholinyl; examples in which the ring carbon atom is substituted with an oxo (=o) group include, but are not limited to, pyrimidinedione, 1,2, 4-thiadiazole-5 (4H) -one, 1,2, 4-oxadiazole-5 (4H) -one, 1H-1,2, 4-triazole-5 (4H) -one, and the like; examples where the ring carbon atom is substituted with an = S group include, but are not limited to, 1,2, 4-oxadiazole-5 (4H) -thione, 1,3, 4-oxadiazole-2 (3H) -thione, and the like. The heterocyclyl group may be optionally substituted with one or more substituents described herein.

The term "M-M ₁ "consisting of ring atoms" means that the cyclic group consists of M-M ₁ And the ring atoms comprise carbon atoms and/or O, N, S, P and other hetero atoms. For example, "heteroaryl consisting of 6-10 ring atoms" represents heteroaryl comprising 6, 7, 8, 9 or 10 ring atoms.

The terms "heterocyclylalkylene" and "heterocyclylalkyl" are used interchangeably herein to mean that the alkyl group is substituted with 1, 2, 3 or 4 heterocyclyl groups, where the heterocyclyl, alkyl and alkylene groups have the meanings described herein. Examples include, but are not limited to, pyrrole-2-methyl, morpholine-4-methyl, and the like.

The term "heteroalkylene" means an alkylene group substituted with 1 or 2 heteroatoms selected from O, S, N or P, said alkylene group having the meaning described herein, examples of "heteroalkylene" having the meaning described herein, -CH ₂ -O-CH ₂ -、-CH ₂ -NH-CH ₂ -、-CH ₂ -CH ₂ -NH-, etc.

The term "heterocyclylalkoxy" means that the alkoxy group is substituted with 1, 2, 3 or 4 heterocyclic groups, wherein the heterocyclic groups and alkoxy groups have the meanings described herein. Examples include, but are not limited to, pyrrole-2-methoxy, piperidine-2-ethoxy.

The term "heterocyclylalkylamino" refers to heterocyclyl-substituted alkylamino wherein the nitrogen atom is attached to the remainder of the molecule; wherein the heterocyclyl and alkylamino groups have the meaning as described herein, such examples include, but are not limited to, piperazine-2-ethylamino, morpholine-4-ethylamino, and the like.

The term "heteroatom" means one or more of O, S, N, P and Si, including N, S and P in any oxidation state form; primary, secondary, tertiary amines and quaternary ammonium salts; or a form in which the hydrogen on the nitrogen atom of the heterocycle is substituted, for example, N (like N in 3, 4-dihydro-2H-pyrrolyl), NH (like NH in pyrrolidinyl) or NR (like NR in N-substituted pyrrolidinyl), R representing a substituent as described in the present invention.

The term "halogen" or "halogen atom" refers to F, cl, br or I.

The term "unsaturated" as used herein means that the moiety contains one or more unsaturations.

The term "aryl" may be used alone or as part of an "aralkyl", "aralkoxy" or "aryloxyalkyl" group, to denote monocyclic, bicyclic, and tricyclic carbocyclic ring systems containing from 6 to 14 carbon atoms, or from 6 to 12 carbon atoms, or from 6 to 10 carbon atoms, wherein at least one ring system is aromatic, wherein each ring system contains a ring of from 3 to 7 carbon atoms, and wherein one or more attachment points are attached to the remainder of the molecule. The term "aryl" may be used interchangeably with the term "aromatic ring" or "aromatic ring", e.g., aryl may include phenyl, naphthyl and anthracenyl. The aryl groups may independently be unsubstituted or substituted with one or more substituents described herein.

The term "heteroaryl" may be used alone or as a majority of "heteroarylalkyl" or "heteroarylalkoxy" to denote a monocyclic, bicyclic or tricyclic ring system containing 5 to 16 ring atoms, at least one of which is aromatic and at least one of which contains one or more heteroatoms, wherein each of which contains a ring of 5 to 7 ring atoms and one or more attachment points are attached to the remainder of the molecule. The term "heteroaryl" may be used interchangeably with the term "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is a heteroaryl consisting of 5-14 ring atoms comprising 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl group consisting of 5-12 ring atoms comprising 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl group consisting of 5 to 10 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl group consisting of 5 to 8 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl group consisting of 5-7 ring atoms comprising 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl group consisting of 5-6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, the heteroaryl is a heteroaryl group consisting of 5 ring atoms comprising 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, the heteroaryl is a heteroaryl group consisting of 6 ring atoms comprising 1,2,3, or 4 heteroatoms independently selected from O, S, and N.

Still other embodiments are heteroaryl groups including, but not limited to, the following monocyclic groups: 2-furyl, 3-furyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, pyridazinyl (e.g., 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (e.g., 5H-tetrazolyl, 2H-tetrazolyl), triazolyl (e.g., 2-triazolyl, 5-triazolyl, 4H-1,2, 4-triazolyl, 1,2, 3-triazolyl), 2-thienyl, 3-thienyl, pyrazolyl (e.g., 2-pyrazolyl and 3-pyrazolyl), isothiazolyl, 1,2, 3-oxadiazolyl, 1,2, 3-triazolyl, 1, 3-oxadiazolyl, 1,2, 4-triazolyl, 1, 3-oxadiazolyl, 1, 3-triazolyl, 1, 4-oxadiazolyl, 1, 3-thiodiazolyl, 1, 4-triazolyl; also included are the following bi-or tricyclic groups, but in no way limited to these groups: benzimidazolyl, benzofuranyl, benzothienyl, indolyl (e.g., 2-indolyl), purinyl, quinolinyl (e.g., 2-quinolinyl, 3-quinolinyl, 4-quinolinyl), isoquinolinyl (e.g., 1-isoquinolinyl, 3-isoquinolinyl, or 4-isoquinolinyl), phenoxathianyl, dibenzoimidazolyl, dibenzofuranyl, or dibenzothienyl, and the like. The heteroaryl group is optionally substituted with one or more substituents described herein.

The terms "heteroarylalkyl" and "heteroarylalkylene" are used interchangeably herein to denote an alkyl group substituted with one or more of the same or different heteroaryl groups, where alkylene, alkyl and heteroaryl groups have the meanings as described herein, examples of which include, but are not limited to, pyridine-2-ethyl, thiazole-2-methyl, imidazole-2-ethyl, pyrimidine-2-propyl, and the like.

The term "sulfonyl", whether used alone or in combination with other terms like "alkylsulfonyl", refers to the divalent radical-SO, respectively ₂ -. The term "alkylsulfonyl" refers to an alkyl-substituted sulfonyl group forming an alkylsulfonyl group (e.g.: -SO) ₂ CH ₃ )。

The term "alkylthio" includes C _1-12 The linear or branched alkyl groups are attached to divalent sulfur atoms, wherein the alkyl groups have the meaning as described herein. Some of these examples are alkylthioBased on lower C _1-6 Alkylthio, other embodiments are where alkylthio is lower C _1-4 Alkylthio, other embodiments are where alkylthio is lower C _1-3 Alkylthio groups, examples of which include, but are not limited to, methylthio (CH ₃ S-), ethylthio group, and the like.

The terms "aralkyl", "arylalkyl" and "arylalkylene" are used interchangeably herein to refer to aryl-substituted alkyl groups in which the alkylene, aryl and alkyl groups have the meanings as set forth herein. Some of these are where the arylalkyl group refers to a "lower arylalkyl" group, i.e., the aryl group is attached to C _1-6 Is present. In other embodiments, an arylalkyl group refers to an aryl group attached to C _1-3 Is present. Specific examples thereof include benzyl, diphenylmethyl, phenethyl and the like. And the aralkyl groups may independently be unsubstituted or substituted with one or more substituents described herein.

Unless otherwise indicated, the structural formulae described herein include all isomeric forms (e.g., enantiomers, diastereomers, and geometric isomers (or conformations), such as R, S configuration containing an asymmetric center, the (Z), (E) isomers of double bonds, and the conformational isomers of (Z), (E).

As used herein, "nitroxide" refers to the oxidation of 1 or more than 1 nitrogen atom to form an N-oxide when the compound contains several amine functionalities. Specific examples of N-oxides are N-oxides of tertiary amines or N-oxides of nitrogen atoms of nitrogen-containing heterocycles. The corresponding amine may be treated with an oxidizing agent (e.g., hydrogen peroxide) or a peracid (e.g., peroxycarboxylic acid) to form an N-oxide (see Advanced Organic Chemistry, wiley Interscience, 4 th edition, jerry March, pages). In particular, the N-oxides can be prepared by the method L.W.Deady (Syn.Comm.1977, 7, 509-514) in which an amine compound is reacted with m-chloroperoxybenzoic acid (MCPBA), for example in an inert solvent, for example methylene chloride.

The term "prodrug" as used herein means a compound that is converted in vivo to a compound of formula (I) or formula (II). Such conversion is effected by hydrolysis of the prodrug in the blood or enzymatic conversion to the parent structure in the blood or tissue. The prodrug of the invention can be ester, and in the prior invention, the ester can be phenyl ester, aliphatic (C _1-24 ) Esters, acyloxymethyl esters, carbonates, carbamates and amino acid esters. For example, one compound of the invention may contain a hydroxyl group, i.e., it may be acylated to provide the compound in a prodrug form. Other prodrug forms include phosphates, such as those obtained by phosphorylation of a hydroxyl group on the parent. For a complete discussion of prodrugs, reference may be made to the following documents: higuchi and V.stilla, pro-drugs as Novel Delivery Systems, vol.14of the A.C.S. symposium Series, edward B.Roche, ed., bioreversible Carriers in Drug Design, american Pharmaceutical Association and Pergamon Press,1987,J.Rautio et al,Prodrugs:Design and Clinical Applications,Nature Review Drug Discovery,2008,7,255-270,and S.J.Hecker et al,Prodrugs of Phosphates and Phosphonates,Journal of Medicinal Chemistry,2008,51, 2328-2345.

All tautomeric forms of the compounds of the invention are included within the scope of the invention unless otherwise indicated. In addition, unless otherwise indicated, the structural formulae of the compounds described herein include enriched isotopes of one or more different atoms.

"metabolite" refers to a product obtained by metabolizing a specific compound or salt thereof in vivo. The metabolites of a compound may be identified by techniques well known in the art and their activity may be characterized by employing the assay methods as described herein. Such products may be obtained by oxidation, reduction, hydrolysis, amidization, deamination, esterification, degreasing, enzymatic cleavage, etc. of the administered compound. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a compound of the present invention with a mammal for a period of time sufficient.

The definition and use of stereochemistry in the present invention is generally referred to in the following documents: S.P. Parker, ed., mcGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, new York; and Eliel, e.and Wilen, s., "Stereochemistry of Organic Compounds", john Wiley & Sons, inc., new York,1994. The compounds of the invention may contain asymmetric or chiral centers and thus exist as different stereoisomers. All stereoisomeric forms of the compounds of the invention, including, but in no way limited to, diastereomers, enantiomers, atropisomers, and mixtures thereof, such as racemic mixtures, form part of the present invention. Many organic compounds exist in optically active form, i.e. they have the ability to rotate the plane of plane polarized light. In describing optically active compounds, the prefix D, L or R, S is used to denote the absolute configuration of the chiral center of the molecule. The prefix d, l or (+), (-) is used to name the sign of the compound plane polarization rotation, where (-) or l means that the compound is left-handed and the prefix (+) or d means that the compound is right-handed. The chemical structures of these stereoisomers are identical, but their stereoisomers are different. The particular stereoisomer may be an enantiomer, and the mixture of isomers is commonly referred to as an enantiomeric mixture. 50: mixtures of enantiomers of 50 are referred to as racemic mixtures or racemates, which may result in no stereoselectivity or stereospecificity during chemical reactions. The terms "racemic mixture" and "racemate" refer to a mixture of two enantiomers in equimolar amounts, lacking optical activity.

The term "tautomer" or "tautomeric form" refers to isomers of structures of different energies that can be interconverted by a low energy barrier. For example, proton tautomers (i.e., proton-transferred tautomers) include tautomers by proton transfer, such as keto-enol and imine-enamine isomerisation. Valency (valence) tautomers include tautomers that reorganize into bond electrons.

As used herein, a "pharmaceutically acceptable salt" isRefers to organic and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as in the literature: S.M. Berge et al describe pharmaceutically acceptable salts in detail in J.pharmaceutical Sciences,66:1-19,1977. Pharmaceutically acceptable non-toxic acid forming salts include, but are not limited to, inorganic acid salts formed by reaction with amino groups such as hydrochloride, hydrobromide, phosphate, sulfate, perchlorate, and organic acid salts such as acetate, oxalate, maleate, tartrate, citrate, succinate, malonate, or by other methods described in the literature such as ion exchange. Other pharmaceutically acceptable salts include adipic acid salts, malic acid salts, 2-hydroxypropionic acid salts, alginates, ascorbates, aspartic acid salts, benzenesulfonates, benzoic acid salts, bisulfate salts, boric acid salts, butyric acid salts, camphoric acid salts, camphorsulfonic acid salts, cyclopentylpropionates, digluconate salts, dodecylsulfate salts, ethanesulfonate salts, formate salts, fumaric acid salts, glucoheptonate salts, glycerophosphate, gluconate salts, hemisulfate salts, heptanoate salts, caproate salts, hydroiodic acid salts, 2-hydroxy-ethanesulfonate salts, lactobionic acid salts, lactate salts, laurate salts, lauryl sulfate salts, malate salts, malonate salts, methanesulfonate salts, 2-naphthalenesulfonate salts, nicotinate salts, nitrate salts, oleate salts, palmitate salts, pamoate salts, pectate salts, persulfate salts, 3-phenylpropionate salts, picrate salts, pivalate salts, propionate salts, stearates, thiocyanate salts, p-toluenesulfonate salts, undecanoate salts, valerate salts, and the like. If the compounds of the invention are acidic, the desired salts can be prepared by suitable methods, for example, using inorganic or organic bases, such as ammonia (primary, secondary, tertiary), alkali metal hydroxides, ammonium, N ⁺ (R ¹⁴ ) ₄ Salts and alkaline earth metal hydroxides, and the like. Suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, ammonia, such as primary, secondary and tertiary, N ⁺ (R ¹⁴ ) ₄ Salts of (A), e.g. R ¹⁴ Is H, C _1-4 Alkyl, C _6-10 Aryl, C _6-10 Aryl C _1-4 Alkyl, etc., and cyclic amines such as piperidine, morpholine, piperazine, etc., and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Also included are suitable, nontoxic ammonium, quaternary ammonium salts and amine cations resistant to counter ion formation, e.g. halides, hydroxides, carboxylates, sulphates, phosphates, nitrates, C _1-8 Sulfonate and aromatic sulfonate.

"solvate" according to the present invention refers to an association of one or more solvent molecules with a compound according to the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethylsulfoxide, ethyl acetate, acetic acid, aminoethanol. The term "hydrate" refers to an association of solvent molecules that are water.

The term "protecting group" or "Pg" refers to a substituent that is commonly used to block or protect a particular functionality when reacted with another functional group. For example, an "amino protecting group" refers to a substituent attached to an amino group to block or protect the functionality of an amino group in a compound, suitable amino protecting groups include acetyl, trifluoroacetyl, t-Butoxycarbonyl (BOC), benzyloxycarbonyl (CBZ) and 9-fluorenylmethoxycarbonyl (Fmoc). Similarly, "hydroxy protecting group" refers to the functionality that a substituent of a hydroxy group serves to block or protect the hydroxy group, and suitable protecting groups include acetyl and silyl. "carboxyl protecting group" refers to the functionality of a substituent of a carboxyl group to block or protect the carboxyl group, and typically the carboxyl protecting group includes-CH ₂ CH ₂ SO ₂ Ph, cyanoethyl, 2- (trimethylsilyl) ethyl, 2- (trimethylsilyl) ethoxymethyl, 2- (p-toluenesulfonyl) ethyl, 2- (p-nitrobenzenesulfonyl) ethyl, 2- (diphenylphosphino) ethyl, nitroethyl, and the like. General description of protecting groups can be found in the literature: t W.Greene, protective Groups in Organic Synthesis, john Wiley&Sons,New York,1991；and P.J.Kocienski,Protecting Groups,Thieme,Stuttgart,2005。

Description of the Compounds of the invention

The compounds and pharmaceutically acceptable compositions thereof of the present invention are effective in inhibiting HBV infection.

wherein R is ¹ Is R ^1a O-or R ^a R ^b N-；

X is N or CH;

n is 0, 1, 2, 3 or 4.

Wherein-is a single bond or a double bond;

when- -is a double bond, each X ₁ And X ₂ independently-C (R) ^3a )＝、＝C(R ^3a ) -n=or=n-;

R ³ is hydrogen, deuterium, R ¹⁰ -C _1-3 Alkylene, R ¹⁰ -C _1-3 alkylene-S (=o) ₂ -、C _1-4 Alkyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, C _3-6 Cycloalkyl, phenyl or heterocyclyl of 3 to 6 ring atoms, wherein R is ¹⁰ -C _1-3 C in alkylene group _1-3 Alkylene, R ¹⁰ -C _1-3 alkylene-S (=o) ₂ C in _1-3 Alkylene, C _1-4 Alkyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, C _3-6 Cycloalkyl, phenyl and heterocyclic groups of 3-6 ring atomsEach independently is unsubstituted or substituted with 1, 2, 3 or 4R ^w2 Substituted;

In some embodiments, R as described in the present invention ^8a Is hydrogen, deuterium, C _1-4 Alkyl or C _3-6 Cycloalkyl, wherein said C _1-4 Alkyl and C _3-6 Cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

In some embodiments, R as described in the present invention ^8a Is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl and n-butylA group, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

R ¹⁰ is hydrogen, deuterium, HO-, R ^a R ^b N-、R ¹¹ -S(＝O) ₂ -, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, cyclopropyl, cyclobutyl, cyclopentA group, a cyclohexyl group, an azetidinyl group, an oxetanyl group, a thietanyl group, an oxetanyl group, a pyrrolidinyl group, a pyrazolidinyl group, an imidazolidinyl group, a tetrahydrofuranyl group, a tetrahydrothienyl group, a tetrahydropyranyl group, a tetrahydrothiopyranyl group, a piperidinyl group, a morpholinyl group, a thiomorpholinyl group, a piperazinyl group, a phenyl group, a furyl group, a pyrrolyl group, a pyridinyl group, a pyrazolyl group, an imidazolyl group, a triazolyl group, a tetrazolyl group, an oxazolyl group, an isoxazolyl group, an oxadiazolyl group, a 1,3, 5-triazinyl group, a thiazolyl group, a thienyl group, a pyrazinyl group, a pyridazinyl group or a pyrimidinyl group, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

each R is ^3a 、R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁹ And R is ¹¹ Independently hydrogen, deuterium, F, cl, br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C _1-4 Alkylamino, C _1-4 Alkoxy, C _2-4 Alkynyl, C _2-4 Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl each independently are unsubstituted or substituted with 1, 2, 3 or 4R ^w4 Substituted;

each R is ^w1 、R ^w2 、R ^w3 、R ^w4 And R is ^w5 Independently deuterium, F, cl, br, HO-, HOOC-, =o, amino, C _1-4 Alkyl, C _1-4 Alkoxy, C _1-4 Alkylthio, C _1-4 Alkylamino, C _2-4 Alkenyl, C _2-4 Alkynyl or C _3-6 Cycloalkyl, wherein the amino group, C _1-4 Alkyl, C _1-4 Alkoxy, C _1-4 Alkylthio, C _1-4 Alkylamino, C _2-4 Alkenyl, C _2-4 Alkynyl and C _3-6 Cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, cl, br, CN, HO-, =o, amino, C _1-4 Alkyl, C _1-4 Haloalkyl, C _1-4 Alkoxy, C _1-4 Alkylthio, C _1-4 Haloalkoxy or C _1-4 The substituent of alkylamino is substituted.

Each R is ^w1 、R ^w2 、R ^w3 、R ^w4 And R is ^w5 Independently deuterium, F, cl, br, HO-, HOOC-, =o, amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, C _1-3 Alkylthio, C _1-3 Alkylamino, ethenyl and propenylAllyl, ethynyl, propargyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, C _1-3 Alkylthio, C _1-3 Alkylamino, ethenyl, propenyl, allyl, ethynyl, propargyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted by 1, 2, 3 or 4 members selected from F, cl, br, CN, HO-, =o, amino, C _1-3 Alkyl, C _1-3 Haloalkyl, C _1-3 Alkoxy, C _1-3 Alkylthio, C _1-3 Haloalkoxy or C _1-3 The substituent of alkylamino is substituted.

In some embodiments, the invention relates to compounds of one of the following, or stereoisomers, tautomers, nitroxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof, but in no way limited to these compounds:

/>

Unless otherwise indicated, stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof of the compounds of formula (I) are included within the scope of the invention.

In another aspect, the invention also provides a pharmaceutical composition comprising the compound of the invention, optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant or a combination of the adjuvants.

In other embodiments, the pharmaceutical composition of the invention, wherein the anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator or an interferon.

In some embodiments, the anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, cil Mo Baijie, cladribine, emtricitabine, famciclovir, interferon, baganine CP, idofen, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, milfutidine, nitazoxanide, polyethylene glycol interferon alpha-2 a, ribavirin, luo Raosu-a, cizopyran, euforavac, an Puli, phosphazid, heplisav, interferon alpha-2 b, levamisole or propadiene.

In some embodiments, the use of the invention, wherein the viral disease is hepatitis b virus infection or a disease caused by hepatitis b virus infection.

In another aspect, the invention also provides the use of said compound or said pharmaceutical composition for the manufacture of a medicament for inhibiting HBsAg production or secretion and/or for inhibiting HBV DNA production or replication.

Another aspect of the invention relates to a method of preventing, treating or alleviating HBV conditions in a patient comprising administering to the patient a pharmaceutically acceptable effective dose of a compound of the invention.

Another aspect of the invention relates to a method of preventing, treating or alleviating HBV disorders in a patient comprising administering to the patient a pharmaceutically acceptable effective dose of a pharmaceutical composition comprising a compound of the invention.

Another aspect of the invention relates to the use of a compound of the invention for the manufacture of a medicament for preventing, treating or treating HBV disorders in a patient, and lessening the severity thereof.

Another aspect of the invention relates to a method of inhibiting HBV infection in a patient, the method comprising administering to the patient a therapeutically effective amount of a compound of the invention or a composition thereof. In other embodiments, the method further comprises administration of other HBV treatments.

The invention also encompasses the use of the compounds of the invention, and pharmaceutically acceptable salts thereof, for the manufacture of a pharmaceutical product effective in inhibiting HBV infection, including those described herein: the application of the compound in the preparation of drugs for effectively inhibiting HBV infection. The compounds of the invention are also useful in the manufacture of a medicament for alleviating, preventing, controlling or treating a hepatitis B disorder in a patient. The present invention comprises a pharmaceutical composition comprising a therapeutically effective amount of a compound represented by formula (I) in combination with at least one pharmaceutically acceptable excipient.

The invention also includes a method of treating a patient with a therapeutically effective amount of a compound represented by formula (I) effective to inhibit HBV infection, or a disease susceptible to such a condition.

Unless otherwise indicated, all stereoisomers, tautomers, nitroxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof of the compounds of the invention are within the scope of the invention.

In particular, salts are pharmaceutically acceptable salts. The term "pharmaceutically acceptable" includes substances or compositions that must be suitable for chemical or toxicological treatment, in relation to the other components that make up the formulation and the mammal being treated.

Salts of the compounds of the present invention also include intermediates for preparing or purifying compounds of formula (I) or salts of formula (I) or isomers thereof, but are not necessarily pharmaceutically acceptable salts.

The term "pharmaceutically acceptable" refers to substances that are acceptable from a toxicological standpoint for pharmaceutical use and do not adversely interact with the active ingredient.

If the compounds of the present invention are basic, the desired salts may be prepared by any suitable method provided in the literature, for example, using mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like; or organic acids such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, malic acid, 2-hydroxypropionic acid, citric acid, oxalic acid, glycolic acid and salicylic acid; pyranose acids, such as glucuronic acid and galacturonic acid; alpha-hydroxy acids such as citric acid and tartaric acid; amino acids such as aspartic acid and glutamic acid; aromatic acids such as benzoic acid and cinnamic acid; sulfonic acids such as p-toluene sulfonic acid, benzene sulfonic acid, methane sulfonic acid, ethane sulfonic acid, trifluoromethane sulfonic acid, and the like, or combinations thereof.

If the compounds of the present invention are acidic, the desired salts may be prepared by a suitable method, and inorganic bases such as lithium, sodium, potassium, calcium, magnesium, aluminum, iron, ferrous, manganese, manganous, copper, zinc, and ammonium salts of the compounds of formula (I); organic base, such as a salt of a compound represented by formula (I) with methylamine, dimethylamine, trimethylamine, ethylamine, diethylamine, triethylamine, tromethamine, diethylaminoethanol, isopropylamine, 2-ethylaminoethanol, pyridine, picoline, ethanolamine, diethanolamine, ammonium, dimethylethanolamine, tetramethylammonium, tetraethylammonium, triethanolamine, piperidine, piperazine, morpholine, imidazolium salt, lysine, arginine, L-arginine, histidine, N-methylglucamine, dimethylglucamine, ethylglucamine, dicyclohexylamine, 1, 6-hexamethylenediamine, ethylenediamine, glucamine, sarcosine, serinol, aminopropanediol, 1-amino-2, 3, 4-butanetriol, L-lysine, ornithine, and the like.

Pharmaceutical compositions, formulations, administration and use of the compounds and pharmaceutical compositions of the invention

The pharmaceutical composition comprises a structural compound shown in a formula (I) or a formula (II) or a compound shown in an embodiment, or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, pharmaceutically acceptable salts or prodrugs thereof, and pharmaceutically acceptable auxiliary materials. Chronic viral diseases caused by HBV can lead to severe pathological changes, chronic hepatitis b virus infection can lead to cirrhosis and/or hepatocellular carcinoma in many cases, and the compounds in the composition can effectively inhibit hepatitis b virus, and are suitable for treating diseases caused by virus, especially acute and chronic persistent HBV virus infection.

The compounds of the invention are particularly suitable for the treatment of chronic hepatitis B infection and acute and chronic hepatitis B virus infection.

The invention includes pharmaceutical formulations containing one or more compounds (I) or compositions of the invention in addition to non-toxic, inert pharmaceutically suitable excipients.

The above pharmaceutical preparations may also contain other active pharmaceutical ingredients than the compound (I) or the formula (II).

The compounds of the invention exist in free form or as suitable, pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adducts or derivatives that can be administered directly or indirectly according to the needs of the patient, the compounds described in other aspects of the present invention, metabolites thereof, or residues thereof.

As described herein, the pharmaceutical compositions of the present invention comprise any of the compounds of formula (I) or (II) of the present invention, further comprising pharmaceutically acceptable excipients, such as, for example, any solvent, solid excipient, diluent, binder, disintegrant, or other liquid excipient, dispersing agent, flavoring agent or suspending agent, surfactant, isotonizing agent, thickener, emulsifier, preservative, solid binder or lubricant, and the like, as used herein, as appropriate for the particular target dosage form. As described in the following documents: in Remington, the Science and Practice of Pharmacy,21st edition,2005,ed.D.B.Troy,Lippincott Williams&Wilkins,Philadelphia,and Encyclopedia of Pharmaceutical Technology,eds.J.Swarbrick and J.C.Boylan,1988-1999,Marcel Dekker,New York, in combination with the teachings of the literature herein, shows that different excipients can be used In the preparation of pharmaceutically acceptable compositions and their well-known methods of preparation. In addition to the extent to which any conventional adjuvant is incompatible with the compounds of the present invention, such as any adverse biological effects produced or interactions with any other component of the pharmaceutically acceptable composition in a deleterious manner, their use is also contemplated by the present invention.

Substances that may be pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum proteins; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; a partial glyceride mixture of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silicon; magnesium trisilicate; polyvinylpyrrolidone; polyacrylate; a wax; polyethylene-polyoxypropylene-block polymers; lanolin; sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; a gum powder; malt; gelatin; talc powder; adjuvants such as cocoa butter and suppository waxes; oils such as peanut oil, cotton seed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycol compounds such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic salt; ringer's solution; ethanol; phosphate buffer solution; and other non-toxic suitable lubricants such as sodium lauryl sulfate and magnesium stearate; a colorant; a release agent; coating the clothing material; a sweetener; a flavoring agent; a perfume; preservatives and antioxidants.

The pharmaceutical composition of the compounds of the invention may be administered in any of the following ways: oral administration, spray inhalation, topical administration, rectal administration, nasal administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrapulmonary, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or administration by means of an explanted reservoir. The preferred mode is oral administration, intramuscular injection, intraperitoneal administration or intravenous injection.

The compounds of the present invention or compositions containing pharmaceutically acceptable agents may be administered in unit dosage form. The administration dosage form may be liquid dosage form or solid dosage form. The liquid dosage form can be true solution, colloid, microparticle, or suspension. Other dosage forms such as tablet, capsule, dripping pill, aerosol, pill, powder, solution, suspension, emulsion, granule, suppository, lyophilized powder for injection, clathrate, implant, patch, liniment, etc.

Oral tablets and capsules may contain excipients such as binding agents, for example syrup, acacia, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example lactose, sucrose, corn starch, calcium phosphate, sorbitol, glycine; lubricants, for example magnesium stearate, talc, polyethylene glycol, silica; disintegrants, such as potato starch; or acceptable wetting agents such as sodium lauryl sulfate. The tablets may be coated by methods known in the pharmaceutical arts.

Oral liquids may be formulated as aqueous and oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, sorbitol, cellulose methyl ether, glucose syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gelatin, hydrogenated edible fats and oils; emulsifying agents, such as lecithin, sorbitan monooleate, acacia; or non-aqueous adjuvants (possibly containing edible oils), such as almond oil; oils such as glycerol, ethylene glycol or ethanol; preservatives, such as methyl or propyl parahydroxybenzoate, sorbic acid. Flavoring or coloring agents may be added as desired.

Suppositories may contain conventional suppository bases such as cocoa butter or other glycerides.

For parenteral administration, liquid dosage forms are generally prepared from the compound and a sterile adjuvant. The auxiliary material is water. According to the different concentrations of selected auxiliary materials and medicines, the compound can be dissolved in the auxiliary materials or prepared into suspension solution, and when the injection solution is prepared, the compound is dissolved in water, filtered and sterilized and then filled into a sealed bottle or ampoule.

When applied topically to the skin, the compounds of the invention may be formulated in the form of suitable ointments, lotions or creams, in which the active ingredient is suspended or dissolved in one or more auxiliary substances. Among the adjuvants that can be used in the ointment formulation are, but not limited to: mineral oil, liquid vaseline, white vaseline, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; adjuvants that may be used in lotions and creams include, but are not limited to: mineral oil, sorbitan monostearate, tween 60, cetyl esters wax, hexadecene aryl alcohol, 2-octyldodecanol, benzyl alcohol and water.

In general, it has proven advantageous to administer the active compounds according to the invention in a total amount of about 0.01 to 500mg/kg body weight, preferably 0.01 to 100mg/kg body weight, per 24 hours, in a single dose, if appropriate in multiple doses, both in human medicine and in veterinary medicine, in order to achieve the desired effect. The amount of active compound contained in a single dose is preferably about 1-80mg/kg body weight, more preferably 1-50mg/kg body weight, but may not follow the above-mentioned dosages, i.e., depending on the kind and body weight of the subject, the nature and severity of the disease, the type of formulation and the mode of administration of the drug, and the period or time interval of administration.

The pharmaceutical composition provided by the invention also comprises an anti-HBV drug. Wherein the anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator, an interferon or other novel anti-HBV agent such as an HBV RNA replication inhibitor, an HBsAg secretion inhibitor, an HBV capsid inhibitor, an antisense oligomer, an siRNA, an HBV therapeutic vaccine, an HBV prophylactic vaccine, an HBV antibody therapy (monoclonal or polyclonal) and an agonist for treating or preventing HBV.

The anti-HBV drugs include lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, cil Mo Baijie, cladvudine, emtricitabine, faprasuavir, interferon, baganine CP, clomiphene, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, miltefoster, nitazoxanide, polyethylene glycol interferon alpha-2 a, ribavirin, luo Raosu-A, cizopyran, euforavac, an Puli near, phosphazid, heplisav, interferon alpha-2 b, levamisole or propigermanium, etc.

In one aspect, the use of a compound or pharmaceutical composition of the invention in the manufacture of a medicament for preventing, treating or alleviating a hepatitis b disease in a patient. Hepatitis B refers to liver diseases caused by hepatitis B virus infection or hepatitis B infection, including acute hepatitis, chronic hepatitis, liver cirrhosis and liver cancer. Acute hepatitis b virus infection may be asymptomatic or may be manifested as symptoms of acute hepatitis. Patients with chronic viral infections suffer from active disease and can develop cirrhosis and liver cancer.

The compounds or pharmaceutical compositions of the invention may be used for inhibiting HBsAg production or secretion comprising administering to a patient a pharmaceutically acceptable effective amount.

The compounds or pharmaceutical compositions of the present invention may be used for inhibiting HBV DNA production comprising administering to a patient a pharmaceutically acceptable effective amount of the compound or pharmaceutical composition.

In one aspect, the compounds or pharmaceutical compositions of the invention may be used for inhibiting HBV gene expression comprising administering to a patient a pharmaceutically acceptable effective amount of the compound or pharmaceutical composition.

Other anti-HBV agents may be administered separately from compositions comprising the compounds of the invention as part of a multiple dosing regimen. Alternatively, those drugs may be part of a single dosage form, mixed together with the compounds of the invention to form a single composition. If administered as part of a multiple dosing regimen, two active agents may be delivered to each other simultaneously, sequentially or over a period of time, to achieve the target agent activity.

The amount of the compounds and compositions (those comprising a composition as described herein) that can be combined with the adjuvant materials to produce a single dosage form will vary depending upon the particular mode of administration and the particular mode of administration. Normally, the amount of the composition of the present invention will not exceed the amount of the composition comprising normal administration as the sole active agent.

The compounds of the present invention exhibit potent antiviral effects. The compounds have unexpected antiviral activity against HBV and are therefore suitable for the treatment of various diseases caused by viruses, in particular diseases caused by acute and chronic persistent HBV infection. Chronic viral diseases caused by HBV can lead to a variety of syndromes of varying severity, and it is well known that chronic hepatitis b virus infection can lead to cirrhosis and/or liver cancer.

Examples of indications treatable with the compounds of the invention are: treatment may result in acute and chronic viral infections of infectious hepatitis, such as hepatitis b virus infection, with treatment of chronic hepatitis b virus infection and treatment of acute hepatitis b virus infection being particularly preferred.

The invention also relates to the use of the compounds and compositions of the invention for the preparation of a medicament for the treatment and prophylaxis of viral diseases, in particular hepatitis B.

General synthetic method

For the purpose of illustrating the invention, examples are set forth below. It is to be understood that the invention is not limited to these examples but provides a method of practicing the invention.

In general, the compounds of the invention may be prepared by the methods described herein, wherein the substituents are as defined in formula (I), unless otherwise indicated. The following synthetic schemes and examples are provided to further illustrate the teachings of the present invention.

Those skilled in the art will recognize that: the chemical reactions described herein may be used to suitably prepare many other compounds of the present invention, and other methods for preparing the compounds of the present invention are considered to be within the scope of the present invention. For example, the synthesis of those non-exemplified compounds according to the invention can be successfully accomplished by modification methods, such as appropriate protection of interfering groups, by use of other known reagents in addition to those described herein, or by some conventional modification of the reaction conditions, by those skilled in the art. In addition, the reactions disclosed herein or known reaction conditions are also well-known to be applicable to the preparation of other compounds of the present invention.

The examples described below are given unless otherwise indicated that all temperatures are set to degrees celsius (c). Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, arco Chemical Company and Alfa Chemical Company and were used without further purification unless otherwise indicated. The general reagents were purchased from Shandong Chemicals, guangdong Chemicals, guangzhou Chemicals, tianjin Chemie, inc., qingdao Tenglong chemical Co., ltd., and Qingdao ocean chemical works.

The nuclear magnetic resonance spectral data were determined by Bruker Avance 400 nuclear magnetic resonance spectrometer or Bruker Avance III HD nuclear magnetic resonance spectrometer, CDCl ₃ 、DMSO-d ₆ 、CD ₃ OD or d ₆ Acetone as solvent (reported in ppm) with TMS (0 ppm) or chloroform (7.26 ppm) as referenceStandard-meeting. When multiple peaks occur, the following abbreviations will be used: s (single, singlet), s (single, singlet, doublet), d (doublet ), t (triplet), m (multiplet ), br (broadened, broad), dd (doublet of doublets, doublet), ddd (doublet of doublet of doublets, doublet), dt (doublet of triplets, doublet), ddt (doublet of doublet of triplets, doublet), td (triplet of doublets, doublet), br.s (broadened singlet, broad doublet). Coupling constant J, in units of hertz (Hz).

Low resolution Mass Spectrometry (MS) data were determined by a spectrometer of the Agilent6320 series LC-MS equipped with a G1312A binary pump and a G1316A TCC (column temperature kept at 30 ℃), a G1329A autosampler and a G1315B DAD detector were applied for analysis, and an ESI source was applied to the LC-MS spectrometer.

Low resolution Mass Spectrometry (MS) data were determined by a spectrometer of Agilent 6120 series LC-MS equipped with a G1311A quaternary pump and a G1316A TCC (column temperature maintained at 30 ℃), a G1329A autosampler and a G1315D DAD detector were applied for analysis, and an ESI source was applied to the LC-MS spectrometer.

Both spectrometers were equipped with a Agilent Zorbax SB-C18 column, 2.1X130 mm,5 μm format. The injection volume is determined by the sample concentration; the flow rate is 0.6mL/min; the peak of the HPLC was read by recording the UV-Vis wavelengths at 210nm and 254 nm. The mobile phase was a 0.1% acetonitrile formate solution (phase a) and a 0.1% ultrapure formate solution (phase B). Gradient elution conditions are shown in table 1: table 1: gradient elution conditions

Time (min)	A(CH ₃ CN,0.1％HCOOH)	B(H ₂ O,0.1％HCOOH)
			0-3	5-100	95-0
3-6	100	0
			6-6.1	100-5	0-95
6.1-8	5	95

Compound purification was assessed by Agilent 1100 series High Performance Liquid Chromatography (HPLC) with UV detection at 210nm and 254nm on a Zorbax SB-C18 column, 2.1X130 mm,4 μm,10 min, flow rate of 0.6mL/min,5-95% (0.1% aqueous formic acid in acetonitrile) and column temperature maintained at 40 ℃.

The following abbreviations are used throughout the present invention:

/>

synthesis method

The following synthesis schemes list the synthetic procedures for preparing the compounds disclosed in the present invention. Wherein each R ² 、R ³ 、R ⁴ 、R ⁵ 、R ⁶ 、X ₁ 、X ₂ And-having an inclusion according to the inventionMeaning, X ₃ Is halogen. R in the synthetic scheme ^1a Is C _1-6 Alkyl or C _3-7 Cycloalkyl groups.

Synthesis scheme 1

A kind of electronic device with high-pressure air-conditioning system(a-11)The compounds shown can be prepared by the methods described in synthetic scheme 1. First, the compound(a-1)And a compound(a-2)Over palladium catalysts (e.g. Pd (dba) ₂ 、Pd ₂ (dba) ₃ Etc.), a ligand (e.g., xantphos, etc.), and a suitable base (e.g., sodium t-butoxide, etc.), and in a suitable solvent (e.g., THF,1, 4-dioxane, etc.), to form a compound(a-3). Compounds of formula (I)(a-3)With NH ₄ OAc in reducing agents (e.g. NaBH ₃ CN, etc.) in a suitable solvent (such as methanol, etc.), and performing reductive amination reaction to obtain a compound(a-4). Compounds of formula (I)(a-4)With formic acid or ethyl formate to produce a compound(a-5). Then, the compound(a-5)With phosphorus oxychloride in a suitable solvent (such as DCM, acetonitrile, etc.), to form a compound(a-6). Next, the compound(a-6)And a compound(a-7)Or a compound(a-8)In a suitable solvent (such as isopropanol, ethanol, DMSO, etc.), to form a compound (a-9). Compounds of formula (I)(a-9)With tetrachlorobenzoquinone in a suitable solvent (such as DME, etc.), to produce the compound(a-10). Finally, the compound(a-10)Hydrolysis to give the compound(a-11)。

Synthesis scheme 2

When R is ^1a In the case of tert-butyl, a compound of formula(a-13)The compounds can be prepared by(a-12)With tetrachlorobenzoquinone in a suitable solvent (such as DME).

Detailed Description

The following examples are illustrative of the invention and are not intended to limit the scope of the invention.

Preparation example

In the following preparation examples, the inventors have described in detail the preparation of the compounds of the present invention, taking some of the compounds of the present invention as examples.

Example 1: 5-isopropyl-12-methoxy-1- (3-methoxypropyl) -9-oxo-1,4,5,9-tetrahydropyrido [2，1-a]Pyrrolo [3,2-f]Isoquinoline-8-carboxylic acid

Step 1: 4-bromo-7-methoxyindoline

To the reaction flask were added the compound 4-bromo-7-methoxyindole (5.0 g,22 mmol) and acetic acid (25 mL), while sodium cyanoborohydride (2.8 g,45 mmol) was added in ice, and after the addition was completed, the mixture was allowed to warm to room temperature and stirred for 8h. After completion of TLC detection, the solvent was distilled off under reduced pressure, saturated sodium bicarbonate was added to ph=8, ea was extracted (50 ml×2), the organic phases were combined, washed with saturated sodium chloride (50 mL), dried over anhydrous sodium sulfate, and the solvent was directly spin-dried for the next reaction.

MS(ESI,pos.ion)m/z：228.0[M+H] ⁺ 。

Step 2: 4-bromo-7-methoxy-1- (3-methoxypropyl) indoline

Into a reaction flask were charged 4-bromo-7-methoxyindoline (5 g,21.921 mmol), 1-bromo-3-methoxypropane (4.7 g,31 mmol), acetonitrile (50 mL) and K ₂ CO ₃ (6.0 g,43 mmol) and after the addition, heating toAfter stirring at 70 ℃ for 12h and complete detection by tlc, the reaction was filtered and the filtrate was concentrated, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) =10/1) to give the title compound as a yellow oily product (4.2 g,14mmol, 64%).

MS(ESI,pos.ion)m/z：300.0[M+H] ⁺ 。

Step 3:1- (7-methoxy-1- (3-methoxypropyl) indol-4-yl) -3-methylbutan-2-one

Into a reaction flask were charged 4-bromo-7-methoxy-1- (3-methoxypropyl) indoline (4.2 g,14 mmol), methyl isopropyl ketone (6.0 g,70 mmol), 1, 4-dioxane (40 mL), xantphos (0.81 g,1.4 mmol), pd ₂ (dba) ₃ (0.64 g,0.70 mmol) and t-Buona (2.7 g,28 mmol), and the reaction mixture was replaced with nitrogen three times and reacted at 100℃for 8 hours. After completion of TLC detection, the reaction was filtered, and the filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) =2/1) to give the title compound as a pale yellow oil (1.5 g,14mmol, 35%).

MS(ESI,pos.ion)m/z：306.2[M+H] ⁺ 。

Step 4:1- (7-methoxy-1- (3-methoxypropyl) indol-4-yl) -3-methylbutan-2-amine

1- (7-methoxy-1- (3-methoxypropyl) indol-4-yl) -3-methylbutan-2-one (1.4 g,4.6 mmol), methanol (15 mL) and ammonium acetate (3.5 g,46 mmol) were added to the reaction flask and stirred at room temperature for 1h. Sodium cyanoborohydride (0.58 g,9.2 mmol) was added in portions, cooled to 0 ℃, and after the addition was completed, the mixture was stirred at room temperature for 24 hours. After completion of the reaction, methanol was distilled off under reduced pressure, quenched with saturated sodium bicarbonate (50 mL), extracted with ethyl acetate (50 mL. Times.2), and the organic phases were combined, washed with saturated sodium chloride solution (50 mL), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give the title compound as a yellow oil (1.2 g,3.9mmol, 85%).

MS(ESI,pos.ion)m/z：307.3[M+H] ⁺ ；

Step 5: n- (1- (7-methoxy-1- (3-methoxypropyl) indol-4-yl) -3-methylbutan-2-yl) methyl Amides and their use

1- (7-methoxy-1- (3-methoxypropyl) indol-4-yl) -3-methylbutan-2-amine (1.2 g,3.9 mmol) and ethyl formate (15 mL) were added to the reaction flask, and the mixture was refluxed at a temperature of 12h. After completion of the reaction, the reaction mixture was concentrated, and the obtained residue was purified by silica gel column chromatography (PE/EA (V/V) =2/1) to give the title compound as a yellow oily product (0.65 g,1.9mmol, 50%).

MS(ESI,pos.ion)m/z：335.2[M+H] ⁺ 。

Step 6: 8-isopropyl-4-methoxy-3- (3-methoxypropyl) -2,3,8, 9-tetrahydro-1H-pyrrolo [3,2 ] f]Isoquinoline (I)

/>

N- (1- (7-methoxy-1- (3-methoxypropyl) indolin-4-yl) -3-methylbutan-2-yl) carboxamide (0.6 g,2 mmol) and acetonitrile (30 mL) were added to the reaction flask, and POCl was added under ice-bath ₃ (0.4 g,3 mmol), and the reaction was refluxed at a temperature of 3 hours. After completion of the reaction by TLC, the reaction was dried by spin-drying, ethyl acetate (30 mL), saturated sodium bicarbonate (30 ml×2), saturated sodium chloride (30 mL) and concentrated column chromatography (PE/EA (V/V) =3/1) gave the title compound as a yellow oil (0.4 g,1mmol, 70%).

MS(ESI,pos.ion)m/z：317.3[M+H] ⁺ 。

Step 7: 5-isopropyl-12-methoxy-1- (3-methoxypropyl) -9-oxo-1, 2,3,4,5,9,10 a- Octahydropyrido [2,1-a ]]Pyrrolo [3,2-f]Isoquinoline-8-carboxylic acid tert-butyl ester

In a reaction flask were added 8-isopropyl-4-methoxy-3- (3-methoxypropyl) -2,3,8, 9-tetrahydro-1H-pyrrolo [3,2-f ] isoquinoline (300 mg,0.9482 mmol), tert-butyl 2- ((dimethylamino) methylene-3-oxobutanoate (0.4 g,1.896 mmol) and ethanol (10 mL), and the mixture was refluxed at elevated temperature for 12H. TLC monitored completion of the reaction, and the reaction was concentrated under reduced pressure and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) =15/1) to give the title compound as an orange oil (0.2 g,0.4mmol, 43%).

MS(ESI,pos.ion)m/z：485.3[M+H] ⁺ 。

Step 8: 5-isopropyl-12-methoxy-1- (3-methoxypropyl) -9-oxo-1,4,5,9-tetrahydropyrido [2,1-a]Pyrrolo [3,2-f]Isoquinoline-8-carboxylic acid

In the reaction flask were charged tert-butyl 5-isopropyl-12-methoxy-1- (3-methoxypropyl) -9-oxo-1, 2,3,4,5,9,10 a-octahydropyrido [2,1-a ] pyrrolo [3,2-f ] isoquinoline-8-carboxylate (0.95 g,2.2 mmol), tetrachlorobenzoquinone (0.63 g,2.6 mmol) and ethylene glycol dimethyl ether (10 mL), and the mixture was refluxed at a temperature of 8h. After completion of the TLC detection, the reaction solution was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (DCM/MeOH (V/V) =15/1), and the obtained crude product was slurried with methanol (5 mL), filtered, and dried to give the title compound as a white solid (0.46 g,1.0mmol, 49%).

MS(ESI,pos.ion)m/z：425.1[M+H] ⁺ ；

¹ H NMR(400MHz,DMSO-d ₆ )δ8.79(s,1H),7.44(s,1H),7.34(d,J＝3.0Hz,1H),7.19(s,1H),6.71(d,J＝3.0Hz,1H),4.61–4.31(m,3H),4.01(s,3H),3.48–3.40(m,2H),3.31–3.25(m,2H),3.23(s,3H),1.97(m,2H),1.75–1.53(m,1H),0.76(dd,J＝54.2,6.6Hz,6H)。

Example 2:1- (2-cyclopropylethyl) -5-isopropyl-12-methoxy-9-oxo-1,4,5,9-tetrahydropyrido-e [2,1-a]Pyrrolo [3,2-f]Isoquinoline-8-carboxylic acid

Starting from 4-bromo-7-methoxyindoline and (2-bromoethyl) cyclopropane, the synthesis of reference example 1, steps 2 to 8, gave the title compound as a white solid.

MS(ESI,pos.ion)m/z：421.2[M+H] ⁺ ；

¹ H NMR(400MHz,DMSO-d ₆ )δ8.99(s,1H),7.48(s,1H),7.34(d,J＝3.1Hz,1H),7.25(s,1H),6.74(d,J＝3.2Hz,1H),4.62–4.30(m,3H),4.01(s,3H),3.30–3.19(m,2H),1.95–1.86(m,2H),1.85–1.54(m,2H),0.99–0.57(m,10H)。

Example 3:1- (cyclopropylmethyl) -5-isopropyl-12-methoxy-9-oxo-1,4,5,9-tetrahydropyrido [2, 1-a]pyrrolo [3,2-f]Isoquinoline-8-carboxylic acid

Starting from 4-bromo-7-methoxyindoline and (bromomethyl) cyclopropane, the synthesis of reference example 1, steps 2 to 8, gave the title compound as a white solid.

MS(ESI,pos.ion)m/z：406.8[M+H] ⁺ ；

¹ H NMR(400MHz,DMSO-d ₆ )δ8.75(s,1H),7.43(s,1H),7.35(d,J＝3.0Hz,1H),7.15(s,1H),6.65(d,J＝3.4Hz,1H),4.62–4.35(m,3H),4.11(s,3H),3.32–3.23(m,2H),1.85–1.51(m,1H),0.99–0.55(m,10H)。

Example 4: 5-isopropyl-12-methoxy-9-oxoGeneration-1- ((tetrahydro-2H-pyran-4-yl) methyl) -1,4,5, 9-tetrahydropyrido [2,1-a ]]Pyrrolo [3,2-f]Isoquinoline-8-carboxylic acid

Starting from 4-bromo-7-methoxyindoline and 4- (bromomethyl) tetrahydro-2H-pyran, the synthesis of reference example 1, steps 2 to 8, gives the title compound as a white solid.

MS(ESI,pos.ion)m/z：451.6[M+H] ⁺ ；

¹ H NMR(400MHz,DMSO-d ₆ )δ8.78(s,1H),7.45(s,1H),7.36(d,J＝3.0Hz,1H),7.18(s,1H),6.67(d,J＝3.4Hz,1H),4.72–4.45(m,3H),4.15(s,3H),3.49-3.30(m,4H),3.32–3.23(m,2H),1.95-1.86(m,5H),1.85–1.51(m,1H),0.83(d,J＝6.6Hz,3H),0.70(d,J＝6.7Hz,3H)。

Example 5: 5-cyclopropyl-12-methoxy-1- (3-methoxypropyl) -9-oxo-1,4,5,9-tetrahydropyrido [2,1-a]Pyrrolo [3,2-f]Isoquinoline-8-carboxylic acid

The synthesis of 4-bromo-7-methoxy-1- (3-methoxypropyl) indoline and 1-cyclopropylmethyl ketone, referred to example 1, steps 3 to 8, gave the title compound as a white solid.

MS(ESI,pos.ion)m/z：423.5[M+H] ⁺ ；

¹ H NMR(400MHz,DMSO-d ₆ )δ9.01(s,1H),7.46(s,1H),7.35(d,J＝3.2Hz,1H),7.30(s,1H),6.98(d,J＝3.1Hz,1H),4.62–4.33(m,3H),4.02(s,3H),3.50–3.41(m,2H),3.32–3.26(m,2H),3.28(s,3H),1.98(m,2H),1.76–1.55(m,1H),0.86–0.45(m,4H)。

Biological Activity test

HBV cell line

The chromosomes of hepg2.2.15 cells (SELLS, PNAS,1987 and SELLS, JV, 1988) integrate the complete HBV genome and stably express viral RNAs and viral proteins. HepG2.2.15 cells are able to secrete mature hepatitis B virus particles and HBsAg into the culture medium. The viral particle DNA and HBsAg secreted by HepG2.2.15 cells can be quantified by qPCR and ELISA methods and the effect of the compounds on viral replication and HBsAg secretion can be detected thereby.

Test 1: inhibition experiments of the compounds of the present invention on the replication of HBVDNA

The experimental method comprises the following steps:

HepG 2.2.15 cells 8,000 cells per well were seeded into 96-well cell culture plates in duplicate and cultured for 3 days until the cells grew to full wells. Cells were treated with 4-fold serial dilutions of the compound for 10 days, and the solution was changed once every other day, the final concentration of DMSO in all wells was 0.5% and DMSO was used as a no drug control. Supernatants were harvested on day 11 for HBV DNA quantification.

The qPCR method detects viral genomic DNA, and HBV primers are as follows:

HBV-For-202，CAGGCGGGGTTTTTCTTGTTGA(SEQ ID NO:1)；

HBV-Rev-315，GTGATTGGAGGTTGGGGACTGC(SEQ ID NO:2)。

viral copy numbers were calculated using SYBR Premix Ex Taq II-Takara DRR081S kit, using 1 μl of cell culture supernatant as a template, using a plasmid containing HBV genome as a standard curve, and using the standard curve. Concentration-viral copy number treatment with Graphpad Prism 5 software and IC of compound inhibition of viral replication was calculated by a four-parameter nonlinear regression model ₅₀ 。

Conclusion: the experiment of inhibiting HBV virus replication by the compound shows that the compound has good inhibiting activity on HBV DNA replication, wherein, the compound has IC of inhibiting activity on HBV DNA replication ₅₀ Less than 0.1. Mu.M, most compounds have IC with replication inhibiting activity on HBV DNA ₅₀ Less than 0.05 μm.

The replication inhibiting activity of some of the compounds of the present invention on HBV DNA is shown in Table 2.

Table 2: replication inhibiting Activity of certain compounds of the invention against HBV DNA

Examples	HBV DNA IC ₅₀ (nM)
		Example 1	1.15

Test 2: inhibition experiment of HBsAg secretion by the Compounds of the invention

The experimental method comprises the following steps:

HepG 2.2.15 cells 8,000 cells per well were seeded into 96-well cell culture plates in duplicate and cultured for 3 days until the cells grew to full wells. Cells were treated with 4-fold serial dilutions of the compound for 10 days, and the solution was changed once every other day, the final concentration of DMSO in all wells was 0.5% and DMSO was used as a no drug control. Supernatants were harvested on day 11 for quantitative detection of HBsAg.

The level of HBsAg secreted by the cells after compound treatment was detected using an ELISA method using a hepatitis b surface antigen diagnostic kit (Shanghai Kochia bioengineering Co., ltd., S10910113). 25. Mu.L of the supernatant to be tested (diluted to 75. Mu.L in PBS) was added to each well of the ELISA plate, and kit positive and negative controls were set. After blocking the ELISA plates with the sealing paper, incubation was carried out for 60 minutes at 37 ℃. The ELISA plate was removed and the seal removed and 50. Mu.L of enzyme conjugate was added to each well. The ELISA plates were blocked with a piece of paper and incubated at 37℃for 30 minutes with shaking on a shaker for 10 seconds. The ELISA plate was removed, the sealing paper was removed and the wash was repeated 5 times: each time, the liquid in the holes is discarded, the holes are filled with the washing liquid, the mixture is stood for 60 seconds, the mixture is dried by spin-drying, and the liquid residue is beaten on the absorbent paper. Immediately after the washing was completed, a freshly prepared mixture of developer a and developer B was added to all wells: 100. Mu.L per well. Shaking on a shaker for 10 seconds, sealing ELISA plate with sealing paper, and incubating at 37deg.C for 3 And 0 minutes. To all wells 50. Mu.L of stop solution was added. Read at wavelength 450nm on an Envision plate reader. concentration-HBsAg OD450 value data were processed with Graphpad Prism 5 software and IC for inhibition of HBsAg secretion by compounds was calculated by a four-parameter nonlinear regression model ₅₀ 。

Conclusion: the inhibition experiment of the compound of the invention on HBsAg secretion shows that. The compound has good inhibitory activity on HBsAg secretion, wherein the compound has IC with the inhibitory activity on HBsAg secretion ₅₀ Less than 0.1. Mu.M, most compounds have IC with inhibitory activity on HBsAg secretion ₅₀ Less than 0.05 μm.

The inhibitory activity of some of the compounds of the present invention on HBsAg secretion was the results shown in table 3.

Table 3: inhibitory Activity of certain Compounds of the invention against HBsAg secretion

Examples	HbsAg IC ₅₀ (nM)
		Example 1	3.27

Test 3: pharmacokinetic experiments of the Compounds of the invention in beagle dogs, mice, rats

(1) Pigeon PK test experiment

PK assay experiments of the Compounds of the invention in beagle dogs (body weight 10-12kg, male age 10-12 months, 3 per group orally, 3 per group intravenously)

The experimental method comprises the following steps:

beagle dogs were given 2.5mg/kg or 5mg/kg by oral gavage or 1mg/kg or 2mg/kg by intravenous injection of the test compound.

Administration of drugsLater, blood was collected by intravenous injection at time points (0.083, 0.25,0.5,1,2,4,6,8 and 24 hours) and collected at EDTA-K addition ₂ Is arranged in the anticoagulation tube. After liquid-liquid extraction, the plasma samples were quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. And calculating pharmacokinetic parameters by a non-atrioventricular model method by using WinNonlin 6.3 software.

Conclusion: the drug generation experimental data show that the compound has better pharmacokinetic property in beagle bodies and has good application prospect in anti-HBV aspect.

(2) Mouse PK test experiment

PK assay experiments of the Compounds of the invention in mice (body weight 20-25g, males, age 45-60 days, 3 per group orally, 3 per group intravenously)

The experimental method comprises the following steps:

ICR mice were given 10mg/kg by oral gavage or 2mg/kg by tail vein injection of the test compound or 10 mg/kg. Blood was collected from orbital veins at time points (0.083,0.25,0.5,1,2,4,6,8 and 24 hours) after administration and collected at EDTA-K addition ₂ Is arranged in the anticoagulation tube. After liquid-liquid extraction, the plasma samples were quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. And calculating pharmacokinetic parameters by a non-atrioventricular model method by using WinNonlin 6.3 software.

Conclusion: the drug generation experimental data show that the compound has better pharmacokinetic property in mice and has good application prospect in the aspect of HBV virus resistance.

(3) SD rat PK test experiment

PK assay experiments of the Compounds of the invention in SD rats (body weight 200-250g, male age 2-3 months, 3 per group orally, 3 per group intravenously)

The experimental method comprises the following steps:

SD rats were given 2.5mg/kg or 5mg/kg or 1mg/kg of test compound by intravenous injection via oral gavage. Intravenous blood was collected at time points (0.083, 0.25, 0.5, 1, 2, 5, 7 and 24 hours) after administration and collected on EDTA-K ₂ Is arranged in the anticoagulation tube. After liquid-liquid extraction of the plasma sample, in three casesQuantitative analysis was performed by multiplex reaction ion monitoring (MRM) on a heavy quadrupole tandem mass spectrometer. And calculating pharmacokinetic parameters by a non-atrioventricular model method by using WinNonlin 6.3 software.

Conclusion: the pharmaceutical generation experimental data show that the compound has better pharmacokinetic property in SD rat body and has good application prospect in anti-HBV aspect.

Test 4: stability test of the inventive Compounds in liver microsomes of different species

The experimental method comprises the following steps:

to a 96-well plate, 30. Mu.L of a mixed solution of a blank solution and liver microsomes was added, and 15. Mu.L of a buffer containing a test compound was added to each well, and two samples were prepared in parallel. After pre-incubation for 10min at 37℃15. Mu.L of NADPH solution (8 mM) was added at time points of 0min, 15min, 20min and 60min, the final concentration of the test compound was 1. Mu.M, the concentration of liver microsomes was 0.1mg/mL, and the final concentration of NADPH was 2mM. Incubation was performed for 0, 15, 30, 60min, respectively, and 150 μl acetonitrile (containing internal standard) was added to the mixed system after incubation was completed. The acetonitrile diluted sample was centrifuged at 4000rpm for 5min, and 150. Mu.L of the supernatant was taken to LC-MS/MS for analysis.

Conclusion: the stability test data of the liver microsome show that the compound of the invention has better stability in the liver microsomes of different species.

Claims

1. A compound which is a compound represented by the formula (II) or a stereoisomer, tautomer or pharmaceutically acceptable salt of the compound represented by the formula (II),

wherein- - -is a double bond; x is X ₁ is-C (R) ^3a )＝；X ₂ Is=c (R ^3a )-；

R ¹ Is R ^1a O-；

X is CH;

R ² is hydrogen, deuterium, HO-, F, cl, br or C _1-6 An alkoxy group;

R ³ is R ¹⁰ -C _1-4 An alkylene group;

R ¹⁰ is hydrogen, deuterium, HO-, C _1-6 Alkyl, C _1-6 Alkoxy or C _3-6 Cycloalkyl, wherein said C _1-6 Alkyl, C _1-6 Alkoxy or C _3-6 Cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

each R is ^3a 、R ⁴ 、R ⁵ 、R ⁷ And R is ⁹ Independently hydrogen, deuterium, F, cl or Br;

R ⁶ is C _1-6 An alkyl group;

R ^1a is hydrogen, deuterium or C _1-6 An alkyl group;

each R is ^w3 Is independently deuterium, F, cl, br, HO-, C _1-6 Alkyl or C _1-6 An alkoxy group.

2. The compound of claim 1, wherein the R ² Is hydrogen, deuterium, HO-, F, cl, br or C _1-4 An alkoxy group;

R ³ is R ¹⁰ -C _1-3 An alkylene group.

3. The compound of claim 1 or 2, wherein the R ² Hydrogen, deuterium, HO-, F, cl, br, methoxy, ethoxy, 1-propoxy or 2-propoxy;

R ³ is R ¹⁰ -CH ₂ -、R ¹⁰ -(CH ₂ ) ₂ -or R ¹⁰ -(CH ₂ ) ₃ -。

4. The compound of claim 1 or 2, wherein the R ¹⁰ Is hydrogen, deuterium, HO-, C _1-4 Alkyl, C _1-4 Alkoxy or C _3-6 Cycloalkyl, wherein said C _1-4 Alkyl, C _1-4 Alkoxy and C _3-6 Cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

R ⁶ is C _1-4 An alkyl group.

5. The compound of claim 1 or 2, wherein the R ¹⁰ Is hydrogen, deuterium, HO-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted with 1, 2, 3 or 4R ^w3 Substituted;

R ⁶ is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl or tert-butyl.

6. The compound of claim 1 or 2, wherein the R ^1a Is hydrogen, deuterium or C _1-4 An alkyl group;

each R is ^w3 Is independently deuterium, F, cl, br, HO-, C _1-4 Alkyl or C _1-4 An alkoxy group.

7. The compound of claim 1 or 2, wherein the R ^1a Hydrogen, deuterium, methyl, ethyl, n-propyl or isopropyl;

each R is ^w3 Independently deuterium, F, cl, br, HO-, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy or 2-propoxy.

8. The compound according to claim 1 or 2, comprising one of the following compounds:

or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof.

9. A pharmaceutical composition comprising a compound according to any one of claims 1-8; optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant or a combination of said adjuvants.

10. The pharmaceutical composition of claim 9, further comprising an additional anti-HBV drug.

11. The pharmaceutical composition according to claim 10, wherein the other anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator or an interferon.

12. The pharmaceutical composition of claim 11, wherein the other anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfaferone, alloferon, cil Mo Baijie, clavuland, emtricitabine, famciclovir, interferon, bazedoxifene CP, idofenane, interferon alpha-1 b, interferon alpha-2 a, interferon beta-1 a, interferon alpha-2, interleukin-2, miltebufoster, nitazoxanide, polyethylene glycol interferon alpha-2 a, ribavirin, luo Raosu-a, cizopyran, euforavac, an Puli, phosphazid, heplisav, interferon alpha-2 b, levamisole or propargite.

13. Use of a compound according to any one of claims 1 to 8 or a pharmaceutical composition according to any one of claims 9 to 12 for the manufacture of a medicament for the prevention, treatment or alleviation of a viral disease in a patient, wherein the viral disease is hepatitis b virus infection or a disease caused by hepatitis b virus infection, wherein the disease caused by hepatitis b virus infection is cirrhosis or hepatocellular carcinoma.

14. Use of a compound according to any one of claims 1 to 8 or a pharmaceutical composition according to any one of claims 9 to 12 for the manufacture of a medicament for inhibiting the production or secretion of HBsAg and/or for inhibiting the production of HBV DNA.