CN108976223B - Fused tricyclic compound and application thereof in medicines - Google Patents

Abstract

The invention relates to a fused tricyclic compound and application thereof in medicines, in particular to application of the fused tricyclic compound as a medicine for treating and/or preventing hepatitis B. Specifically, the invention relates to a compound shown in a general formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, wherein variables are defined in the specification. The invention also relates to the application of the compound shown in the general formula (I) or the stereoisomer, the tautomer, the nitrogen oxide, the solvate, the metabolite, the pharmaceutically acceptable salt or the prodrug thereof as a medicament, in particular to the application as a medicament for treating and/or preventing hepatitis B.

Description

Fused tricyclic compound and application thereof in medicines

Technical Field

The invention relates to a fused tricyclic compound and application thereof as a medicament, in particular to application as a medicament for treating and preventing hepatitis B. The invention also relates to compositions of these fused tricyclic compounds with other antiviral agents, and their use for the treatment and prevention of Hepatitis B (HBV) infection.

Background

Hepatitis b virus belongs to the hepadnaviridae family. It can cause acute and/or persistent progressive chronic disease. Hepatitis b virus also causes many other clinical manifestations in pathological morphology-in particular chronic inflammation of the liver, cirrhosis and canceration of hepatocytes. Estimated by the world health organization, there are 20 million people worldwide infected with HBV, about 3.5 million people with chronic infection, and about 100 million people per year die of liver failure, cirrhosis, and primary hepatocellular carcinoma (HCC) due to HBV infection.

Interferon α (IFN- α) and pegylated IFN- α and 5 nucleoside (acid) analogs (lamivudine, adefovir dipivoxil, entecavir, telbivudine and tenofovir) are approved for clinical treatment by the united states Food and Drug Administration (FDA). interferon is the first anti-HBV drug approved by the FDA and achieves the effect of clearing viruses mainly through direct antiviral action and induction of immune response in the body, but its application is limited due to its low response rate, multiple side effects, high price and limitations in the treated subjects.

The novel fused tricyclic compound provided by the invention has the advantages of good pharmacokinetic property, good solubility, small toxicity, good stability of liver microsome, good inhibitory activity on generation or secretion of HBsAg and replication of HBVDNA, and the like, and has a good application prospect in the aspect of resisting HBV viruses.

Disclosure of Invention

The invention relates to a novel fused tricyclic compound and application thereof in preparing a medicament for treating and preventing HBV infection. In particular, the compounds of the present invention, and the pharmaceutically acceptable compositions thereof, are effective in inhibiting HBV infection.

In one aspect, the invention relates to a compound of formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (I), or a prodrug thereof,

wherein X is N or-CR^6a-；

Y is a single bond, -CH₂-or-C (═ O) -;

q is a single bond, -O-or-N (R)⁹)-；

R¹Is hydrogen, deuterium, F, Cl, Br, I, OH, -COOH, heterocyclic group consisting of 5-6 ring atoms, heteroaryl group consisting of 5-6 ring atoms, C_1-6Alkyl radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-7Cycloalkyl radical, R¹²-S(＝O)₂-、R¹²-(CR^eR^f)_n-or R^aR^bN-wherein said heterocyclic group consisting of 5 to 6 ring atoms, heteroaryl group consisting of 5 to 6 ring atoms, C_1-6Alkyl radical, C_2-6Alkenyl radical, C_2-6Alkynyl and C_3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4R^vSubstituted;

R⁹is hydrogen, deuterium, C_1-6Alkyl or C_1-6Haloalkyl, or R⁹、R¹Together with the nitrogen atom to which they are attached, form a heterocyclic group of 3 to 12 ring atoms, wherein said C_1-6Alkyl radical, C_1-6The heterocyclyl consisting of haloalkyl and 3 to 12 ring atoms being unsubstituted or substituted by 1,2,3 or 4 substituents selected from-COOH, ═ O, tetrazolyl or C_1-6alkyl-O-C (═ O) -;

R²、R³、R⁷and R⁸Each independently hydrogen, deuterium, F, Cl, Br, hydroxy, cyano, C_1-12Alkyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl, heteroaryl of 5 to 10 ring atoms, R¹³-(CR^eR^f)_m-、R¹³-(CR^eR^f)_m-O-、 R¹³-C(＝O)-(CR^eR^f)_m-、R¹³-C(＝O)-N(R^g)-(CR^eR^f)_m-、R¹⁸-N(R^g)-C(＝O)-O-、R¹⁹-N(R^m)-C(＝O)-N(Rⁿ)-、 R¹³-O-C(＝O)-(CR^eR^f)_m-、R¹³-O-C(＝O)-N(R^g)-(CR^eR^f)_m-、R^c-C(＝O)-(CR^eR^f)_m-O-C(＝O)-、

R¹⁴-S(＝O)₂-(CR^eR^f)_m-、R¹⁴-S(＝O)₂-N(R^g)-(CR^eR^f)_m-、R¹⁴-S(＝O)₂-N(R^g)-C(＝O)-、R^aR^bN-、R^cC(＝O)-、 R^aR^bNC(＝O)-、R^dOC (═ O) -or R¹⁰O-wherein said C_1-12Alkyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^wSubstituted;

R¹⁰is hydrogen, deuterium, C_1-12Alkyl radical, C_2-12Alkynyl, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl, heteroaryl of 5 to 10 ring atoms, R¹⁵-(CR^eR^f)_g-、R¹⁵-O-(CR^eR^f)_g-、R¹⁵-C(＝O)-(CR^eR^f)_g-、R¹⁵-O-C(＝O)-(CR^eR^f)_g-、 R¹⁵-O-C(＝O)-N(R^g)-(CR^eR^f)_g-、R¹⁶-S(＝O)₂-(CR^eR^f)_g-or R¹⁶-S(＝O)₂-N(R^g)-(CR^eR^f)_g-, wherein said C_1-12Alkyl radical, C_2-12Alkynyl, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^xSubstituted;

R⁴and R⁵Each independently is deuterium, F, C_1-6Alkyl radical, C_1-6Alkylamino radical, C_1-6Alkoxy radical, C_2-6Alkynyl, C_2-6Alkenyl radical, C_3-7Cycloalkyl or heterocyclyl consisting of 3 to 12 ring atoms, wherein said C is_1-6Alkyl radical, C_1-6Alkylamino radical, C_1-6Alkoxy radical, C_2-6Alkynyl, C_2-6Alkenyl radical, C_3-7Cycloalkyl and heterocyclyl consisting of 3 to 12 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴、R⁵Together with the carbon atom to which they are attached form C_3-7Cycloalkyl or heterocyclyl consisting of 3 to 12 ring atoms, wherein said C is_3-7Cycloalkyl and heterocyclyl consisting of 3 to 12 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴Is F, Cl or Br, with R⁵Is hydrogen;

R⁶is hydrogenDeuterium, C_1-6Alkyl radical, C_2-6Alkenyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl, heteroaryl of 5 to 10 ring atoms or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said C_1-6Alkyl radical, C_2-6Alkenyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^zSubstituted;

R^6ais hydrogen, deuterium, F, Cl, Br, CN, OH, C_1-6Alkyl radical, C_2-6Alkenyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl, heteroaryl of 5 to 10 ring atoms or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said C_1-6Alkyl radical, C_2-6Alkenyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^zSubstituted;

R¹²and R¹⁷Each independently is C_3-7Cycloalkyl radical, C_6-10Aryl radical, C_1-6Alkoxy, amino or C_1-6Alkylamino, wherein said C_3-7Cycloalkyl radical, C_6-10Aryl radical, C_1-6Alkoxy, amino and C_1-6Alkylamino is each independently unsubstituted or substituted by 1,2,3 or 4R^jSubstituted;

R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸and R¹⁹Each independently is C_1-12Alkyl radical, C_1-12Alkoxy radical, C_3-7Cycloalkyl, heteroaryl of 5 to 10 ring atoms, heterocyclyl of 3 to 12 ring atoms or C_6-10Aryl, wherein said C_1-12Alkyl radical, C_1-12Alkoxy radical, C_3-7Cycloalkyl, heteroaryl of 5-10 ring atoms, heterocyclyl of 3-12 ring atoms and C_6-10Aryl is independently not substitutedIs substituted or substituted by 1,2,3 or 4R^hSubstituted;

R^a、R^b、R^c、R^d、R^e、R^f、R^g、R^k、Rⁱ、R^mand RⁿEach independently of the other is H, deuterium, OH, C_1-6Haloalkyl, C_1-6Alkyl radical, C_1-6Alkoxy radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-6Cycloalkyl radical, C_6-10Aryl, heterocyclyl of 3 to 12 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is_1-6Haloalkyl, C_1-6Alkyl radical, C_1-6Alkoxy radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-6Cycloalkyl radical, C_6-10Aryl, heterocyclyl consisting of 3 to 12 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy or C_1-6An alkylamino group;

or R^a、R^bAnd together with the nitrogen atom to which they are attached, form a heterocyclyl of 3 to 8 ring atoms or a heteroaryl of 5 to 8 ring atoms, wherein the heterocyclyl of 3 to 8 ring atoms and the heteroaryl of 5 to 8 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy or C_1-6An alkylamino group;

or R^mAnd RⁿAnd the nitrogen atom to which they are attached, form a heterocyclic group of 3 to 8 ring atoms, wherein said heterocyclic group of 3 to 8 ring atoms is each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy or C_1-6An alkylamino group;

R^v、R^w、R^x、R^y、R^z、R^jand R^hEach independently is F, Cl, Br, CN, OH, -COOH, amino, C_1-12Alkyl radical, C_1-12Haloalkyl, C_1-12Alkoxy radical, C_1-12Haloalkoxy, C_1-12Alkylthio radical, C_1-12Alkylamino radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C_1-12Alkyl radical, C_1-12Haloalkyl, C_1-12Alkoxy radical, C_1-12Haloalkoxy, C_1-12Alkylthio radical, C_1-12Alkylamino radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, ═ O, -COOH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy radical, C_1-6Alkylthio radical, C_1-6Haloalkoxy, C_1-12Alkylamino radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_6-10Aryl radical, C_3-6Cycloalkyl, heteroaryl of 5 to 6 ring atoms, heterocyclyl of 5 to 6 ring atoms, C_1-6Alkoxy radical C_1-6Alkylene or C_1-6alkylamino-C_1-6An alkylene group;

n and q are each independently 0, 1,2,3,4, 5 or 6;

m and g are each independently 0, 1,2,3,4, 5,6, 7, 8, 9 or 10.

In some embodiments, R is described herein¹Is hydrogen, deuterium, F, Cl, Br, I, OH, -COOH, heterocyclic group consisting of 5 ring atoms, heteroaryl group consisting of 5 ring atoms, C_1-4Alkyl radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl radical, R¹²-S(＝O)₂-、R¹²-(CR^eR^f)_n-or R^aR^bN-wherein said heterocyclic group consisting of 5 ring atoms, heteroaryl group consisting of 5 ring atoms, C_1-4Alkyl radical, C_2-4Alkenyl radical, C_2-4Alkynyl and C_3-6Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4R^vSubstituted;

R⁹is hydrogen, deuterium, C_1-4Alkyl or C_1-4Haloalkyl, or R⁹、R¹Together with the nitrogen atom to which they are attached, form a heterocyclic group of 5 to 6 ring atoms, wherein said C_1-4Alkyl radical, C_1-4The heterocyclyl consisting of haloalkyl and 5 to 6 ring atoms being unsubstituted or substituted by 1,2,3 or 4 substituents selected from-COOH, ═ O, tetrazolyl or C_1-6alkyl-O-C (═ O) -;

wherein each R is¹²、n、R^e、R^f、R^a、R^bAnd R^vHave the meaning as described in the present invention.

In other embodiments, R is as described herein¹Is hydrogen, deuterium, F, Cl, Br, I, OH, -COOH, thiazolyl, tetrazolyl, methyl, ethyl, n-propyl, isopropyl, ethenyl, propenyl, ethynyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, R¹²-S(＝O)₂-、 R¹²-(CR^eR^f)_n-or R^aR^bN-, wherein said thiazolyl, methyl, ethyl, N-propyl, isopropyl, ethenyl, propenyl, ethynyl, propynyl, cyclopropyl, cyclobutyl and cyclopentyl are each independently unsubstituted or substituted by 1,2,3 or 4R^vSubstituted;

R⁹is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl or C_1-3Haloalkyl, or R⁹、R¹And together with the nitrogen atom to which they are attached, form a pyrrolidinyl, piperazinyl, piperidinyl or morpholinyl group wherein said methyl, ethyl, n-propyl, isopropyl, C_1-3Haloalkyl, pyrrolidinyl, piperazinyl, piperidinyl and morpholinyl unsubstituted or substituted by 1,2,3 or 4 substituents selected from-COOH, ═ O, tetranitrogenAzolyl or C_1-6alkyl-O-C (═ O) -;

wherein each R is¹²、n、R^e、R^f、R^a、R^bAnd R^vHave the meaning as described in the present invention.

In some embodiments, R is described herein²、R³、R⁷And R⁸Each independently hydrogen, deuterium, F, Cl, Br, hydroxy, cyano, C_1-6Alkyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 6 ring atoms, R¹³-(CR^eR^f)_m-、 R¹³-(CR^eR^f)_m-O-、R¹³-C(＝O)-(CR^eR^f)_m-、R¹³-C(＝O)-N(R^g)-(CR^eR^f)_m-、R¹⁸-N(R^g)-C(＝O)-O-、 R¹⁹-N(R^m)-C(＝O)-N(Rⁿ)-、R¹³-O-C(＝O)-(CR^eR^f)_m-、R¹³-O-C(＝O)-N(R^g)-(CR^eR^f)_m-、 R^c-C(＝O)-(CR^eR^f)_m-O-C(＝O)-、

R¹⁴-S(＝O)₂-(CR^eR^f)_m-、R¹⁴-S(＝O)₂-(NR^g)-(CR^eR^f)_m-、 R¹⁴-S(＝O)₂-N(R^g)-C(＝O)-、R^aR^bN-、R^cC(＝O)-、R^aR^bNC(＝O)-、R^dOC (═ O) -or R¹⁰O-wherein said C_1-6Alkyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^wSubstituted;

R¹⁰is hydrogen, deuterium, C_1-6Alkyl radical, C_2-6Alkynyl radical、C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 6 ring atoms, R¹⁵-(CR^eR^f)_g-、R¹⁵-O-(CR^eR^f)_g-、R¹⁵-C(＝O)-(CR^eR^f)_g-、R¹⁵-O-C(＝O)-(CR^eR^f)_g-、 R¹⁵-O-C(＝O)-N(R^g)-(CR^eR^f)_g-、R¹⁶-S(＝O)₂-(CR^eR^f)_g-or R¹⁶-S(＝O)₂-N(R^g)-(CR^eR^f)_g-, wherein said C_1-6Alkyl radical, C_2-6Alkynyl, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^xSubstituted;

wherein each g, m, R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸、R¹⁹、R^a、R^b、R^c、R^d、R^e、R^f、R^g、R^m、Rⁿ、R^k、Rⁱ、 R^xAnd R^wHave the meaning as described in the present invention.

In other embodiments, R is as described herein²、R³、R⁷And R⁸Each independently hydrogen, deuterium, F, Cl, Br, hydroxy, cyano, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl, n-hexyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl, naphthyl, R¹³-(CR^eR^f)_m-、 R¹³-(CR^eR^f)_m-O-、R¹³-C(＝O)-(CR^eR^f)_m-、R¹³-C(＝O)-N(R^g)-(CR^eR^f)_m-、R¹⁸-N(R^g)-C(＝O)-O-、 R¹⁹-N(R^m)-C(＝O)-N(Rⁿ)-、R¹³-O-C(＝O)-(CR^eR^f)_m-、R¹³-O-C(＝O)-N(R^g)-(CR^eR^f)_m-、 R^c-C(＝O)-(CR^eR^f)_m-O-C(＝O)-、

R¹⁴-S(＝O)₂-(CR^eR^f)_m-、R¹⁴-S(＝O)₂-N(R^g)-(CR^eR^f)_m-、 R¹⁴-S(＝O)₂-N(R^g)-C(＝O)-、R^aR^bN-、R^cC(＝O)-、R^aR^bNC(＝O)-、R^dOC (═ O) -or R¹⁰O-, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl, n-hexyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R^wSubstituted;

R¹⁰is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl, n-hexyl, ethynyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranylTetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl, naphthyl, R¹⁵-(CR^eR^f)_g-、R¹⁵-O-(CR^eR^f)_g-、R¹⁵-C(＝O)-(CR^eR^f)_g-、R¹⁵-O-C(＝O)-(CR^eR^f)_g-、 R¹⁵-O-C(＝O)-N(R^g)-(CR^eR^f)_g-、R¹⁶-S(＝O)₂-(CR^eR^f)_g-or R¹⁶-S(＝O)₂-N(R^g)-(CR^eR^f)_g-, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl, n-hexyl, ethynyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R^xSubstituted;

wherein each g, m, R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸、R¹⁹、R^a、R^b、R^c、R^d、R^e、R^f、R^g、R^m、Rⁿ、R^k、Rⁱ、 R^xAnd R^wHave the meaning as described in the present invention.

In some embodiments, R is described herein⁴And R⁵Each independently is deuterium, F, C_1-4Alkyl radical, C_1-4Alkylamino radical, C_1-4Alkoxy radical, C_2-4Alkynyl, C_2-4Alkenyl radical, C_3-6Cycloalkyl or heterocyclyl consisting of 5 to 6 ring atoms, in which said C is_1-4Alkyl radical, C_1-4Alkylamino radical, C_1-4Alkoxy radical, C_2-4Alkynyl, C_2-4Alkenyl radical, C_3-6Cycloalkyl and heterocyclyl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴、R⁵Together with the carbon atom to which they are attached form C_3-6Cycloalkyl or heterocyclyl consisting of 5 to 6 ring atoms, in which said C is_3-6Cycloalkyl and heterocyclyl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴Is F, Cl or Br, with R⁵Is hydrogen;

R⁶is hydrogen, deuterium, C_1-4Alkyl radical, C_2-4Alkenyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 10 ring atoms or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said C_1-4Alkyl radical, C_2-4Alkenyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^zSubstituted;

R^6ais hydrogen, deuterium, F, Cl, Br, CN, OH, C_1-4Alkyl radical, C_2-4Alkenyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 10 ring atoms or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said C_1-4Alkyl radical, C_2-4Alkenyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^zSubstituted;

each q and R¹⁷、R^e、R^f、R^zAnd R^yHave the meaning as described in the present invention.

In other embodiments, R is as described herein⁴And R⁵Each independently is deuterium, F, C_1-3Alkyl radical, C_1-3Alkylamino radical, C_1-3Alkoxy radical, C_2-4Alkynyl, C_2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl wherein said C is_1-3Alkyl radical, C_1-3Alkylamino radical, C_1-3Alkoxy radical, C_2-4Alkynyl, C_2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴、R⁵And together with the carbon atom to which they are attached form a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl group, wherein said cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substituted with 1,2,3, or 4R^ySubstituted;

or R⁴Is F, Cl or Br, with R⁵Is hydrogen;

R⁶is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, ethenyl, propenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrothiopyra,Piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolyl, purinyl, phenyl, naphthyl or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, vinyl, propenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolyl, purinyl, phenyl and naphthyl are each independently unsubstituted or 1,2,3 or 4R^zSubstituted;

R^6ais hydrogen, deuterium, F, Cl, Br, CN, OH, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, vinyl, propenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolyl, purinyl, phenyl, naphthyl or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, ethenyl, propenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinylIndependently of each other, yl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolyl, purinyl, phenyl and naphthyl are unsubstituted or substituted by 1,2,3 or 4R^zSubstituted;

wherein each q and R¹⁷、R^e、R^f、R^zAnd R^yHave the meaning as described in the present invention.

In some embodiments, R is described herein¹²And R¹⁷Each independently is C_3-6Cycloalkyl, phenyl, naphthyl, C_1-4Alkoxy, amino or C_1-4Alkylamino, wherein said C_3-6Cycloalkyl, phenyl, naphthyl, C_1-4Alkoxy, amino and C_1-4Alkylamino is each independently unsubstituted or substituted by 1,2,3 or 4R^jSubstituted;

R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸and R¹⁹Each independently is C_1-6Alkyl radical, C_1-6Alkoxy radical, C_3-6Cycloalkyl, heteroaryl of 5 to 6 ring atoms, heterocyclyl of 5 to 6 ring atoms, phenyl or naphthyl, wherein C is_1-6Alkyl radical, C_1-6Alkoxy radical, C_3-6Cycloalkyl, heteroaryl of 5 to 6 ring atoms, heterocyclyl of 5 to 6 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4R^hSubstituted;

wherein each R is^j、R^hHave the meaning as described in the present invention.

In other embodiments, R is as described herein¹²And R¹⁷Each independently is cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, methoxy, ethoxy, propoxy, isopropoxy, N-butoxy, amino, N-methylamino, N-ethylamino, N, N-dimethylamino or N, N-diethylamino, wherein the cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, methoxyIndependently of one another, the radicals, ethoxy, propoxy, isopropoxy, N-butoxy, amino, N-methylamino, N-ethylamino, N, N-dimethylamino and N, N-diethylamino radical are each unsubstituted or substituted by 1,2,3 or 4R^jSubstituted;

R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸and R¹⁹Each independently is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl or naphthyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R^hSubstituted;

wherein each R is^j、R^hHave the meaning as described in the present invention.

In some embodiments, R is described herein^a、R^b、R^c、R^d、R^e、R^f、R^g、R^k、Rⁱ、R^mAnd RⁿEach independently of the other is H, deuterium, OH, C_1-4Haloalkyl, C_1-4Alkyl radical, C_1-4Alkoxy radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl, phenyl, naphthyl, heterocyclyl consisting of 5 to 6 ring atoms or heteroaryl consisting of 5 to 6 ring atoms, wherein said C_1-4Haloalkyl, C_1-4Alkyl radical, C_1-4Alkoxy radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl, phenyl, naphthyl, heterocyclyl of 5-6 ring atoms and heteroaryl of 5-6 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group;

or R^a、R^bAnd together with the nitrogen atom to which they are attached, form a heterocyclyl of 5 to 6 ring atoms or a heteroaryl of 5 to 6 ring atoms, wherein the heterocyclyl of 5 to 6 ring atoms and the heteroaryl of 5 to 6 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group;

or R^mAnd RⁿAnd the nitrogen atom to which they are attached, form a heterocyclic group of 3 to 6 ring atoms, wherein said heterocyclic group of 3 to 6 ring atoms is each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group.

In other embodiments, R is as described herein^a、R^b、R^c、R^d、R^e、R^f、R^g、R^k、Rⁱ、R^mAnd RⁿEach independently of the other is H, deuterium, OH, C_1-3Haloalkyl, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxyEthoxy, propoxy, isopropoxy, n-butoxy, ethenyl, propenyl, ethynyl, propynyl, propargyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl or naphthyl, wherein C is a substituent of the formula_1-3Haloalkyl, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, ethenyl, propenyl, ethynyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, n-propyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, ethenyl, propenyl, ethynyl, propinyl, cyclopropyl, cyclobutyl, triazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group;

or R^a、R^bAnd the nitrogen atom to which they are attached, form pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, and pyrimidinylOxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group;

or R^mAnd RⁿAnd the nitrogen atom to which they are attached, form a heterocyclic group of 4 to 6 ring atoms, wherein said heterocyclic group of 4 to 6 ring atoms is each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group.

In some embodiments, R is described herein^v、R^w、R^x、R^y、R^z、R^jAnd R^hEach independently is F, Cl, Br, CN, OH, -COOH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy radical, C_1-6Haloalkoxy, C_1-6Alkylthio radical, C_1-6Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 6 ring atoms or R¹⁹-O-(CR^eR^f)_k-, wherein said amino group, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy radical, C_1-6Haloalkoxy, C_1-6Alkylthio radical, C_1-6Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from the group consisting of F, Cl, Br, CN, OH, ═ O, -COOH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy radical, C_1-4Alkylthio radical, C_1-4Haloalkoxy, C_1-4Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, phenyl, naphthyl, C_3-6Cycloalkyl, heteroaryl of 5 to 6 ring atoms, heterocyclyl of 5 to 6 ring atoms, C_1-4Alkoxy radical C_1-4Alkylene or C_1-4alkylamino-C_1-4An alkylene group;

wherein each k, R¹⁹、R^eAnd R^fHave the meaning as described in the present invention.

In other embodiments, R is as described herein^v、R^w、R^x、R^y、R^z、R^jAnd R^hEach independently is F, Cl, Br, CN, OH, -COOH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy radical, C_1-4Haloalkoxy, C_1-4Alkylthio radical, C_1-4Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl or naphthyl, or R^aR^bN-, wherein said cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, ═ O, -COOH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy radical, C_1-4Alkylthio radical, C_1-4Haloalkoxy, C₁-4 alkylamino, C_2-4Alkenyl radical, C_2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl, naphthyl, C_1-3Alkoxy radical C_1-3Alkylene or C_1-3alkylamino-C_1-3An alkylene group;

wherein each R is^aAnd R^bHave the meaning as described in the present invention.

In another aspect, the present invention also provides a pharmaceutical composition comprising the compound of the present invention, further comprising pharmaceutically acceptable excipients or a combination thereof.

In some embodiments, the pharmaceutical composition of the present invention further comprises an additional anti-HBV agent.

In other embodiments, the pharmaceutical composition of the invention, wherein the anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.

In some embodiments, the anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon interleukin, cladribine, emtricitabine, faplovir, interferon, calamine CP, intefine, interferon α -1b, interferon α, interferon α -2a, interferon β -1a, interferon α -2, interleukin-2, mevoltate, nitazoxanide, peginterferon α -2a, ribavirin, roscovitine-a, cezopyran, Euforavac, azapril, phazid, hepliav, interferon α -2b, levamisole, or propafegermanium.

In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient.

In some embodiments, the use of the invention, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

In still other embodiments, the use of the present invention, wherein the disease caused by hepatitis b infection is liver cirrhosis or hepatocellular carcinoma.

In another aspect, the invention also provides the use of said compound or said pharmaceutical composition in the manufacture of a medicament for inhibiting the production or secretion of HBsAg, and/or for inhibiting the production of HBV DNA.

In another aspect, the invention relates to the use of a compound or pharmaceutical composition described herein in the manufacture of a medicament for the prevention, treatment or amelioration of hepatitis b disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound or pharmaceutical composition described herein.

Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a compound of the invention.

Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a pharmaceutical composition comprising a compound of the invention.

Another aspect of the invention relates to the use of a compound of the invention in the manufacture of a medicament for the prevention, treatment or treatment of HBV disorders in a patient and for lessening the severity thereof.

Another aspect of the present invention relates to the use of a pharmaceutical composition comprising a compound of the present invention in the manufacture of a medicament for preventing or treating HBV conditions in a patient and reducing the severity thereof.

Another aspect of the invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or composition of the invention in an amount effective to inhibit HBV. In other embodiments, the method further comprises contacting the cell with an anti-HBV agent.

Another aspect of the present invention relates to a method of treating HBV disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.

Another aspect of the present invention relates to a method of inhibiting HBV infection in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.

Another aspect of the invention relates to methods for the preparation, isolation and purification of compounds encompassed by formula (I).

The foregoing merely summarizes certain aspects of the invention and is not intended to be limiting. These and other aspects will be more fully described below.

Detailed description of the invention

Definitions and general terms

The invention will be described in detail in the literature corresponding to the identified embodiments, and the examples are accompanied by the graphic illustrations of structural formulae and chemical formulae. The present invention is intended to cover all alternatives, modifications and equivalents, which may be included within the scope of the present invention as defined by the appended claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein which can be used in the practice of the present invention. The present invention is in no way limited to the description of methods and materials. There are many documents and similar materials that may be used to distinguish or contradict the present application, including, but in no way limited to, the definition of terms, their usage, the techniques described, or the scope as controlled by the present application.

The following definitions shall apply unless otherwise indicated. For the purposes of the present invention, the chemical elements are described in the periodic table of elements, CAS version and handbook of chemicals, 75,^thed, 1994. In addition, the general principles of organic chemistry are described in "Organic Chemistry,"Thomas Sorrell, University Science Books,Sausalito:1999,and"March's Advanced Organic Chemistry,"by Michael B.Smith and Jerry March,John Wiley&Sons, New York, 2007, all of which are hereby incorporated by reference.

The compounds of the invention may be optionally substituted with one or more substituents, as described herein, in compounds of the general formula above, or as specifically exemplified, sub-classes, and classes of compounds encompassed by the invention. In general, the term "substituted" indicates that one or more hydrogen atoms in a given structure are replaced with a particular substituent. Unless otherwise indicated, an optional substituent group may have one substituent substituted at each substitutable position of the group. When more than one position in a given formula can be substituted with one or more substituents selected from a particular group, the substituents may be substituted at each position, identically or differently. Wherein the substituent can be, but is not limited to, F, Cl, Br, CN, OH, -COOH, amino, C_1-12Alkyl radical, C_1-12Haloalkyl, C_1-12Alkoxy radical, C_1-12Haloalkoxy, C_1-12Alkylthio radical, C_1-12Alkylamino radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-7Cycloalkyl, heterocyclic group consisting of 3 to 12 atoms, C_6-10Aryl or heteroaryl of 5 to 10 atoms, and the like.

In the various parts of this specification, substituents of the disclosed compounds are disclosed in terms of group type or range. It is specifically intended that the invention includes each and every independent subcombination of the various members of these groups and ranges. For example, the term "C_1-6Alkyl "means in particular independently disclosed methyl, ethyl, C₃Alkyl radical, C₄Alkyl radical, C₅Alkyl and C₆An alkyl group.

In addition, unless otherwise explicitly indicated, the descriptions of the terms "… independently" and "… independently" and "… independently" used in the present invention are interchangeable and should be understood in a broad sense to mean that the specific items expressed between the same symbols do not affect each other in different groups or that the specific items expressed between the same symbols in the same groups do not affect each other.

The term "alkyl" as used herein includes saturated straight or branched chain monovalent hydrocarbon groups of 1 to 20 carbon atoms, wherein the alkyl groups may independently be optionally substituted with one or more substituents described herein. In some embodiments, the alkyl group contains 1 to 12 carbon atoms, in other embodiments, the alkyl group contains 1 to 8 carbon atoms, in other embodiments, the alkyl group contains 1 to 6 carbon atoms, in other embodiments, the alkyl group contains 1 to 4 carbon atoms, and in other embodiments, the alkyl group contains 1 to 3 carbon atoms. Further examples of alkyl groups include, but are not limited to, methyl (Me, -CH)₃) Ethyl (Et, -CH)₂CH₃) N-propyl (n-Pr, -CH)₂CH₂CH₃) Isopropyl (i-Pr, -CH (CH)₃)₂) N-butyl (n-Bu, -CH)₂CH₂CH₂CH₃) 2-methylpropyl or isobutyl (i-Bu, -CH)₂CH(CH₃)₂) 1-methylpropyl or sec-butyl (s-Bu, -CH (CH)₃)CH₂CH₃) Tert-butyl (t-Bu, -C (CH)₃)₃) N-pentyl (-CH)₂CH₂CH₂CH₂CH₃) 2-pentyl (-CH (CH)₃)CH₂CH₂CH₃) 3-pentyl (-CH (CH)₂CH₃)₂) 2-methyl-2-butyl (-C (CH)₃)₂CH₂CH₃) 3-methyl-2-butyl (-CH (CH)₃)CH(CH₃)₂) 3-methyl-1-butyl (-CH)₂CH₂CH(CH₃)₂) 2-methyl-1-butyl (-CH)₂CH(CH₃)CH₂CH₃) N-hexyl (-CH)₂CH₂CH₂CH₂CH₂CH₃) 2-hexyl (-CH (CH)₃)CH₂CH₂CH₂CH₃) 3-hexyl (-CH (CH)₂CH₃)(CH₂CH₂CH₃) 2-methyl-2-pentyl (-C (CH))₃)₂CH₂CH₂CH₃) 3-methyl-2-pentyl (-CH (CH)₃)CH(CH₃)CH₂CH₃) 4-methyl-2-pentyl (-CH (CH)₃)CH₂CH(CH₃)₂) 3-methyl-3-pentyl (-C (CH)₃)(CH₂CH₃)₂) 2-methyl-3-pentyl (-CH (CH)₂CH₃)CH(CH₃)₂) 2, 3-dimethyl-2-butyl (-C (CH)₃)₂CH(CH₃)₂) 3, 3-dimethyl-2-butyl (-CH (CH)₃)C(CH₃)₃) N-heptyl, n-octyl, and the like. The term "alkyl" and its prefix "alkane" as used herein, both include straight and branched saturated carbon chains. The term "haloaliphatic" as used herein means that an aliphatic group is substituted with one or more of the same or different halogen atoms, wherein the aliphatic group or alkyl group has the meaning described herein, i.e., fluorine, chlorine, bromine or iodine, examples of which include, but are not limited to, trifluoromethyl, trifluoroethyl, and the like.

The terms "haloalkyl", "haloalkenyl" or "haloalkoxy" denote alkyl, alkenyl or alkoxy groups substituted with one or more halogen atoms. In some of these embodiments, the haloalkyl group contains 1 to 12 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 10 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 8 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 6 carbon atoms; in other embodiments, the haloalkyl group contains 1 to 4 carbon atoms, and in other embodiments, the haloalkyl group contains 1 to 3 carbon atoms. Examples include, but are not limited to, trifluoromethyl, trifluoroethyl, trifluoromethoxy, 2-fluorovinyl, and the like, wherein the haloalkyl, haloalkenyl, and haloalkoxy groups can independently be unsubstituted or substituted with one or more substituents described herein.

The term "carboxy", whether used alone or in combination with other terms, e.g.) "Carboxyalkyl ", denotes-CO₂H or-COOH.

The term "carbonyl", whether used alone or in combination with other terms, such as "aminocarbonyl" or "acyloxy", denotes- (C ═ O) -.

The terms "alkylamino" and "alkylamino" are used interchangeably and include "N-alkylamino" and "N, N-dialkylamino" in which the amino groups are each independently substituted with one or two alkyl groups. Wherein in some embodiments, alkylamino is one or two C_1-12Lower alkylamino radical in which the alkyl group is attached to the nitrogen atom, in some embodiments, alkylamino is C_1-6In some embodiments, alkylamino is C_1-4Lower alkylamino groups of (a). Suitable alkylamino groups can be monoalkylamino or dialkylamino, examples of which include, but are not limited to, N-methylamino, N-ethylamino, N-dimethylamino, N-diethylamino, N-propylamino, N-dipropylamino, and the like, wherein the alkylamino groups can independently be unsubstituted or substituted with one or more substituents described herein.

The term "alkylene" refers to a saturated divalent hydrocarbon radical resulting from the removal of two hydrogen atoms from a straight or branched chain saturated hydrocarbon radical. Unless otherwise specified, the alkylene group contains 1 to 12 carbon atoms, in other embodiments 1 to 6 carbon atoms, in other embodiments 1 to 4 carbon atoms, and in other embodiments 1 to 3 carbon atoms. In other embodiments, the alkylene group contains 1 to 2 carbon atoms. Examples of this include methylene (-CH)₂-, ethylene (-CH)₂CH₂-, propylene (-CH)₂CH₂CH₂-) isopropylidene (-CH (CH)₃)CH₂-) butylene (-CH)₂CH₂CH₂CH₂-) pentylene (-CH)₂CH₂CH₂CH₂CH₂-) and hexylene (-CH₂CH₂CH₂CH₂CH₂CH₂-) heptylene (-CH₂CH₂CH₂CH₂CH₂CH₂CH₂-) octylene (-CH)₂CH₂CH₂CH₂CH₂CH₂CH₂CH₂-) and the like, wherein the alkylene groups may independently be unsubstituted or substituted with one or more substituents described herein.

The term "alkenyl" denotes a straight or branched monovalent hydrocarbon radical of 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein the C-C in at least one position is sp²Double bonds, wherein the alkenyl group may be independently unsubstituted or substituted with one or more substituents as described herein, including the positioning of the groups "cis", "trans" or "Z" or "E", wherein specific examples include, but are not limited to, vinyl (-CH ═ CH)₂) Allyl (-CH)₂CH＝CH₂) And the like, wherein the alkenyl group can be independently unsubstituted or substituted with one or more substituents described herein.

The term "alkynyl" denotes a straight or branched chain monovalent hydrocarbon radical of 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein the C-C in at least one position is a sp triple bond, wherein the alkynyl radical may independently be unsubstituted or substituted with one or more substituents as described herein, specific examples include, but are not limited to, ethynyl (-C.ident.CH), propargyl (-CH ≡ CH), and₂C.ident.CH), 1-propynyl (-C.ident.C-CH)₃) 1-alkynylbutyl (-CH)₂CH₂C ≡ CH), 2-alkynylbutyl (-CH)₂C≡CCH₃) 3-alkynylbutyl (-C [ identical to ] CCH₂CH₃) And the like, wherein the alkynyl group can be independently unsubstituted or substituted with one or more substituents described herein.

The term "alkoxy" means an alkyl group attached to the rest of the molecule through an oxygen atom, wherein the alkyl group has the meaning as described herein. Unless otherwise specified, the alkoxy group contains 1 to 20 carbon atoms, some examples of which are alkoxy groups containing 1 to 12 carbon atoms, other examples of which are alkoxy groups containing 1 to 8 carbon atoms, other examples of which are alkoxy groups containing 1 to 6 carbon atoms, other examples of which are alkoxy groups containing 1 to 4 carbon atoms, and other examples of which are alkoxy groups containing 1 to 3 carbon atoms.

Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH)₃) Ethoxy (EtO, -OCH)₂CH₃) 1-propoxy (n-PrO, n-propoxy, -OCH)₂CH₂CH₃) 2-propoxy (i-PrO, i-propoxy, -OCH (CH)₃)₂) 1-butoxy (n-BuO, n-butoxy, -OCH)₂CH₂CH₂CH₃) 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH)₂CH(CH₃)₂) 2-butoxy (s-BuO, s-butoxy, -OCH (CH)₃)CH₂CH₃) 2-methyl-2-propoxy (t-BuO, t-butoxy, -OC (CH)₃)₃) 1-pentyloxy (n-pentyloxy, -OCH)₂CH₂CH₂CH₂CH₃) 2-pentyloxy (-OCH (CH)₃)CH₂CH₂CH₃) 3-pentyloxy (-OCH (CH))₂CH₃)₂) 2-methyl-2-butoxy (-OC (CH))₃)₂CH₂CH₃) 3-methyl-2-butoxy (-OCH (CH)₃)CH(CH₃)₂) 3-methyl-l-butoxy (-OCH)₂CH₂CH(CH₃)₂) 2-methyl-l-butoxy (-OCH)₂CH(CH₃)CH₂CH₃) And the like, wherein the alkoxy group may independently be unsubstituted or substituted with one or more substituents described herein.

The terms "carbocycle", "carbocyclyl" or "carbocyclic" are used interchangeably herein and all refer to a non-aromatic carbocyclic ring system containing 3 to 14 ring carbon atoms that is saturated or contains one or more units of unsaturation. In some embodiments, the number of carbon atoms is 3 to 12; in other embodiments, the number of carbon atoms is from 3 to 10; in other embodiments, the number of carbon atoms is from 3 to 8; in other embodiments, the number of carbon atoms is from 3 to 6; in other embodiments, the number of carbon atoms is from 5 to 6; in other embodiments, the number of carbon atoms is from 5 to 8. In other embodiments, the number of carbon atoms is from 6 to 8. Such "carbocyclyl" includes monocyclic, bicyclic or polycyclic fused, spiro or bridged carbocyclic ring systems, and also includes polycyclic ring systems in which the carbocyclic ring may be fused to one or more non-aromatic carbocyclic or heterocyclic rings or one or more aromatic rings or combinations thereof, wherein the atom groups or points of attachment are on the carbocyclic ring. Bicyclic carbocyclyl includes bridged bicyclic carbocyclyl, fused bicyclic carbocyclyl and spirobicyclic carbocyclyl, and a "fused" bicyclic ring system contains two rings that share 2 contiguous ring atoms. The bridged bicyclic group includes two rings that share 3 or 4 adjacent ring atoms. Spiro ring systems share 1 ring atom. Suitable carbocyclic groups include, but are not limited to, cycloalkyl, cycloalkenyl, and cycloalkynyl. Examples of carbocyclic groups further include, but are in no way limited to, cyclopropyl, cyclobutyl, cyclopentyl, 1-cyclopentyl-1-alkenyl, 1-cyclopentyl-2-alkenyl, 1-cyclopentyl-3-alkenyl, cyclohexyl, 1-cyclohexyl-1-alkenyl, 1-cyclohexyl-2-alkenyl, 1-cyclohexyl-3-alkenyl, cyclohexadienyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cycloundecyl, cyclododecyl, and the like. Bridging carbocyclyl groups include, but are not limited to, bicyclo [2.2.2] octyl, bicyclo [2.2.1] heptyl, bicyclo [3.3.1] nonyl, bicyclo [3.2.3] nonyl, and the like.

The term "cycloalkyl" refers to a monocyclic, bicyclic, or tricyclic ring system containing 3 to 12 ring carbon atoms that is saturated, having one or more points of attachment to the rest of the molecule. In some of these embodiments, cycloalkyl is a ring system containing from 3 to 10 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 3 to 8 ring carbon atoms; in other embodiments, cycloalkyl groups are ring systems containing from 3 to 7 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 5 to 8 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 3 to 6 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing 5 to 6 ring carbon atoms; examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like, and the cycloalkyl groups can independently be unsubstituted or substituted with one or more substituents described herein.

The terms "heterocyclyl" and "heterocycle" are used interchangeably herein and refer to a saturated or partially unsaturated, non-aromatic, monocyclic, bicyclic, or tricyclic ring system containing from 3 to 12 ring atoms, wherein at least one ring atom is selected from the group consisting of nitrogen, sulfur, and oxygen, and wherein the ring system has one or more attachment points to the remainder of the molecule. The term "heterocyclyl" includes monocyclic, bicyclic or polycyclic fused, spiro or bridged heterocyclic ring systems, as well as polycyclic ring systems in which the heterocyclic ring may be fused to one or more non-aromatic carbocyclic or heterocyclic rings or one or more aromatic rings or combinations thereof, wherein the radical or point of attachment is on the heterocyclic ring. Bicyclic heterocyclic groups include bridged bicyclic heterocyclic groups, fused bicyclic heterocyclic groups, and spiro bicyclic heterocyclic groups. Unless otherwise specified, heterocyclyl may be carbon-or nitrogen-based, and-CH₂-the group may optionally be replaced by-C (═ O) -. The sulfur atom of the ring may optionally be oxidized to the S-oxide. The nitrogen atom of the ring may optionally be oxidized to an N-oxygen compound. In some embodiments, heterocyclyl is a ring system of 3-12 ring atoms; in other embodiments, heterocyclyl is a ring system of 3-8 ring atoms; in other embodiments, heterocyclyl is a ring system of 3-6 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-7 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-8 ring atoms; in other embodiments, heterocyclyl is a ring system of 6-8 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-6 ring atoms; in other embodiments, heterocyclyl is a ring system of 3 ring atoms; in other embodiments, heterocyclyl is a ring system of 4 ring atoms; in other embodiments, heterocyclyl is a ring system of 5 ring atoms; in other embodiments, heterocyclyl is a ring system of 6 ring atoms; in other embodiments, heterocyclyl is a ring system of 7 ring atoms; in other placesIn some embodiments, heterocyclyl is a ring system of 8 ring atoms.

Examples of heterocyclyl groups include, but are not limited to: the heterocyclic group may be a carbon-based or heteroatom group. "Heterocyclyl" also includes groups formed by the fusion of heterocyclic groups with saturated or partially unsaturated rings or heterocycles. Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thiaxanyl, piperazinyl, homopiperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, epoxypropyl, azepinyl, oxepinyl, azepinyl, diazepinyl, thiazepinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1, 3-dioxolanyl, pyrazolinyl, dithianyl, dithienoalkyl, dithienyl, dihydrothienyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 1,2,3, 4-tetrahydroisoquinolinyl, 3-azabicyclo [3.1.0] hexyl, 3-azabicyclo [4.1.0] heptyl, azabicyclo [2.2.2] hexyl, 3H-indolylquinazinyl and N-pyridylurea. Examples of heterocyclic groups also include, 1, 1-dioxothiomorpholinyl; examples of the group in which the carbon atom on the ring is substituted with an oxo (═ O) group include, but are not limited to, pyrimidinedione group, 1,2, 4-thiadiazol-5 (4H) -one group, 1,2, 4-oxadiazol-5 (4H) -one group, 1H-1,2, 4-triazol-5 (4H) -one group and the like; examples in which the carbon atom on the ring is substituted with an ═ S group include, but are not limited to, 1,2, 4-oxadiazol-5 (4H) -thioketo, 1,3, 4-oxadiazol-2 (3H) -thioketo, and the like. The heterocyclyl group may be optionally substituted with one or more substituents as described herein.

The terms "heterocyclylalkylene" and "heterocyclylalkyl" are used interchangeably herein to mean an alkyl group substituted with 1,2,3 or 4 heterocyclyl groups, where heterocyclyl, alkyl and alkylene have the meanings described herein. Examples include, but are not limited to, pyrrole-2-methyl, morpholine-4-methyl, and the like.

The term "heterocyclylalkoxy" means that the alkoxy group is substituted with 1,2,3 or 4 heterocyclyl groups, wherein the heterocyclyl and alkoxy groups have the meaning described herein. Examples include, but are not limited to pyrrole-2-methoxy, piperidine-2-ethoxy.

The term "heterocyclylalkylamino" includes heterocyclyl-substituted alkylamino groups in which the nitrogen atom is attached to the remainder of the molecule; wherein the heterocyclyl and alkylamino groups have the meaning as described herein, examples of which include, but are not limited to, piperazine-2-ethylamino, morpholine-4-propoxy, morpholine-4-ethylamino, and the like.

The term "heteroatom" means one or more of O, S, N, P and Si, including any oxidation state form of N, S and P; primary, secondary, tertiary amines and quaternary ammonium salt forms; or a form in which a hydrogen on a nitrogen atom in the heterocycle is substituted, for example, N (like N in 3, 4-dihydro-2H-pyrrolyl), NH (like NH in pyrrolidinyl) or NR (like NR in N-substituted pyrrolidinyl).

The term "halogen" or "halogen atom" refers to F, Cl, Br or I.

The term "unsaturated" as used herein means that the moiety contains one or more degrees of unsaturation.

The term "aryl" used alone or as a majority of "aralkyl", "aralkoxy", or "aryloxyalkyl" refers to monocyclic, bicyclic, and tricyclic carbon ring systems containing 6 to 14 carbon atoms, or 6 to 12 carbon atoms, or 6 to 10 carbon atoms, wherein at least one ring system is aromatic, wherein each ring system contains 3 to 7 carbon atoms forming a ring with one or more attachment points to the rest of the molecule. The term "aryl" may be used interchangeably with the terms "aromatic ring" or "aromatic ring", e.g., aryl may include phenyl, naphthyl and anthracenyl. The aryl group can be independently unsubstituted or substituted with one or more substituents described herein.

The term "heteroaryl" may be used alone or as a majority of "heteroarylalkyl" or "heteroarylalkoxy" and denotes monocyclic, bicyclic or tricyclic ring systems containing 5 to 16 ring atoms, wherein at least one ring system is aromatic and at least one ring system contains one or more heteroatoms, wherein each ring system contains a ring of 5 to 7 ring atoms and one or more attachment points are attached to the rest of the molecule. The term "heteroaryl" may be used interchangeably with the terms "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is a heteroaryl consisting of 5 to 14 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 to 12 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 to 10 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 to 8 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 to 7 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 to 6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N.

In other embodiments, heteroaryl includes, but is not limited to, the following monocyclic groups: 2-furyl group, 3-furyl group, N-imidazolyl group, 2-imidazolyl group, 4-imidazolyl group, 5-imidazolyl group, 3-isoxazolyl group, 4-isoxazolyl group, 5-isoxazolyl group, 2-oxazolyl group, 4-oxazolyl group, 5-oxazolyl group, N-pyrrolyl group, 2-pyrrolyl group, 3-pyrrolyl group, 2-pyridyl group, 3-pyridyl group, 4-pyridyl group, 2-pyrimidinyl group, 4-pyrimidinyl group, 5-pyrimidinyl group, pyridazinyl group (e.g., 3-pyridazinyl group), 2-thiazolyl group, 4-thiazolyl group, 5-thiazolyl group, tetrazolyl group (e.g., 5H-tetrazolyl group, 2H-tetrazolyl group), triazolyl group (e.g., 2-triazolyl group, 5-triazolyl group, 4H-1,2, 4-triazolyl, 1H-1,2, 4-triazolyl, 1,2, 3-triazolyl), 2-thienyl, 3-thienyl, pyrazolyl (e.g., 2-pyrazolyl and 3-pyrazolyl), isothiazolyl, 1,2, 3-oxadiazolyl, 1,2, 5-oxadiazolyl, 1,2, 4-oxadiazolyl, 1,3, 4-oxadiazolyl, 1,2, 3-thiadiazolyl, 1,3, 4-thiadiazolyl, 1,2, 5-thiadiazolyl, pyrazinyl, 1,3, 5-triazinyl; the following bi-or tricyclic groups are also included, but are in no way limited to these groups: benzimidazolyl, benzofuranyl, benzothienyl, indolyl (e.g., 2-indolyl), purinyl, quinolyl (e.g., 2-quinolyl, 3-quinolyl, 4-quinolyl), isoquinolyl (e.g., 1-isoquinolyl, 3-isoquinolyl, or 4-isoquinolyl), phenoxathiyl, dibenzoimidazolyl, dibenzofuranyl, or dibenzothienyl, and the like. The heteroaryl group is optionally substituted with one or more substituents described herein.

The term "heteroarylalkyl" means an alkyl group substituted with one or more identical or different heteroaryl groups, wherein the alkyl group and heteroaryl group have the meaning as set forth herein, examples of which include, but are not limited to, pyridine-2-ethyl, thiazole-2-methyl, imidazole-2-ethyl, pyrimidine-2-propyl, and the like.

The term "sulfonyl", whether used alone or in combination with other terms such as "alkylsulfonyl", denotes the divalent radical-SO₂-. The term "alkylsulfonyl" refers to an alkyl-substituted sulfonyl group that forms an alkylsulfonyl group (e.g., -SO)₂CH₃)。

The term "alkylthio" includes C_1-12A linear or branched alkyl group is attached to a divalent sulfur atom, wherein the alkyl group has the meaning as described herein. In some of these embodiments, the alkylthio group is a lower C_1-6Alkylthio, in other embodiments, the alkylthio is lower C_1-4Alkylthio groups, and such examples include, but are not limited to, methylthio (CH)₃S-), ethylthio, and the like.

The terms "aralkyl", "arylalkyl" and "arylalkyl" include aryl-substituted alkyl groups in which the aryl and alkyl groups have the meaning as set forth herein. In some of these embodiments, an aralkyl group or arylalkyl group refers to a "lower aralkyl" group, i.e.Aryl radicals bound to C_1-6On the alkyl group of (a). In other embodiments, the aralkyl or arylalkyl group is C-containing_1-3The "phenylalkylene" of an alkyl group of (a). Specific examples thereof include benzyl, diphenylmethyl, phenethyl and the like. And the aralkyl groups may be independently unsubstituted or substituted with one or more substituents described herein.

The term "haloalkyl-substituted aryl" includes aryl groups which may be substituted with one or more of the same or different haloalkyl groups, wherein the haloalkyl and aryl groups have the meaning as described herein. Examples include, but are not limited to, 2-trifluoromethylphenyl, 3, 5-bis (trifluoromethyl) phenyl, 3-trifluoromethylphenyl, 4-trifluoromethylphenyl, 2, 6-bis (trifluoromethyl) phenyl, and the like.

The term "halogen-substituted aryl" includes aryl groups which may be substituted by one or more of the same or different halogen atoms, wherein the halogen atom (halogen) and the aryl group have the meaning as described herein. Examples include, but are not limited to, fluorophenyl, difluorophenyl, trifluorophenyl, chlorophenyl, dichlorophenyl, trichlorophenyl, bromophenyl, tribromophenyl, dibromophenyl, fluorochlorophenyl, fluorobromophenyl, chlorobromophenyl, and the like.

The term "cycloalkylalkyl" denotes that an alkyl group may be substituted by one or more identical or different cycloalkyl groups, wherein cycloalkyl and alkyl groups have the meaning as described herein. Examples include, but are not limited to, cyclohexylmethyl, cyclopropylethyl, cyclopropylpropyl, and the like. And the cycloalkylalkyl group may be independently unsubstituted or substituted with one or more substituents described herein.

In addition, unless otherwise expressly indicated, the descriptions "… and … are each independently," "… and … are each independently," and "… and … are each independently" used throughout this document are interchangeable and should be broadly construed to mean that the particular choice expressed between the same symbols in different groups does not affect each other, or that the same groups are in the same group, with each otherThe specific options expressed between the same symbols do not influence each other. For example, as in formulas p1 and p2, the particular choices of two m are not affected by each other, two R¹³Are not affected by each other, each R^eAre not affected by each other, each R^fThe specific options of (a) and (b) are not influenced by each other.

Unless otherwise indicated, the structural formulae depicted herein include all isomeric forms (e.g., enantiomers, diastereomers, and geometric isomers (or conformers): for example, the R, S configuration containing an asymmetric center, (Z), (E) isomers of double bonds, and (Z), (E) conformers.

As used herein, "nitroxide" means that when a compound contains several amine functional groups, 1 or more than 1 nitrogen atom can be oxidized to form an N-oxide, a specific example of an N-oxide of a tertiary amine or an N-oxide of a nitrogen-containing heterocyclic nitrogen atom the corresponding amine can be treated with an oxidizing agent such as hydrogen peroxide or a peracid such as a peroxycarboxylic acid to form an N-oxide (see Advanced Organic Chemistry, Wiley Interscience, 4 th edition, Jerry March, pages), especially, the N-oxide can be prepared by the method of L W.Deady (Syn. Comm.1977,7, 509-.

The term "prodrug", as used herein, represents a compound that is converted in vivo to a compound of formula (I). Such conversion is effected by hydrolysis of the prodrug in the blood or by enzymatic conversion to the parent structure in the blood or tissue. The prodrug compound of the invention can be ester, and in the prior invention, the ester can be used as the prodrug and comprises phenyl ester and aliphatic (C)_1-24) Esters, acyloxymethyl esters, carbonates, carbamatesEsters and amino acid esters. For example, a compound of the present invention contains a hydroxy group, i.e., it can be acylated to provide the compound in prodrug form. Other prodrug forms include phosphate esters, such as those obtained by phosphorylation of a hydroxyl group on the parent. For a complete discussion of prodrugs, reference may be made to the following: T.Higuchi and V.Stella, Pro-drugs as Novel delivery systems, Vol.14 of the A.C.S.Sympossium Series, Edward B.Roche, ed., Bioredeployers in Drug designs, American Pharmaceutical Association and PergammonPress, 1987, J.Rautio et al, Prodrugs: Design and Clinical Applications, Nature review Discovery,2008,7, 255-.

Unless otherwise indicated, all tautomeric forms of the compounds of the invention are included within the scope of the invention. In addition, unless otherwise indicated, the structural formulae of the compounds described herein include isotopically enriched concentrations of one or more different atoms.

"metabolite" refers to the product of a particular compound or salt thereof obtained by metabolism in vivo. Metabolites of a compound can be identified by techniques well known in the art, and its activity can be characterized by assay methods as described herein. Such products may be obtained by administering the compound by oxidation, reduction, hydrolysis, amidation, deamidation, esterification, defatting, enzymatic cleavage, and the like. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a compound of the present invention with a mammal for a sufficient period of time.

The definition and convention of Stereochemistry in this invention is generally referred to in the literature of S.P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York, and Eliel, E.and Wilen, S., "Stereochemistry of Organic Compounds", John Wiley & Sons, Inc., New York,1994.

The term "tautomer" or "tautomeric form" means that isomers of structures of different energies may be interconverted through a low energy barrier. For example, proton tautomers (i.e., prototropic tautomers) include tautomers that move through protons, such as keto-enol and imine-enamine isomerizations. Valence (valence) tautomers include tautomers that recombine into bond electrons.

As used herein, "pharmaceutically acceptable salts" refer to organic and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as are: berge et al, descriptive acceptable salts in detail in J. pharmaceutical Sciences,66:1-19,1977. Pharmaceutically acceptable non-toxic acid forming salts include, but are not limited to, inorganic acid salts formed by reaction with amino groups such as hydrochloride, hydrobromide, phosphate, sulfate, perchlorate, and organic acid salts such as acetate, oxalate, maleate,tartrate, citrate, succinate, malonate, or by other methods described in the literature, such as ion exchange. Other pharmaceutically acceptable salts include adipates, malates, 2-hydroxypropionates, alginates, ascorbates, aspartates, benzenesulfonates, benzoates, bisulfates, borates, butyrates, camphorates, camphorsulfonates, cyclopentylpropionates, digluconates, dodecylsulfates, ethanesulfonates, formates, fumarates, glucoheptonates, glycerophosphates, gluconates, hemisulfates, heptanoates, caproates, hydroiodiates, 2-hydroxy-ethanesulfonates, lactobionates, lactates, laurylsulfates, malates, malonates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, palmitates, pamoates, pectinates, persulfates, 3-phenylpropionates, picrates, pivalates, propionates, stearates, thiocyanates, p-toluenesulfonates, undecanoates, pentanoates, and the like. If the compounds of the invention are acidic, the desired salts can be prepared by suitable methods, e.g., using inorganic or organic bases, such as ammonia (primary, secondary, tertiary), alkali metal hydroxides, ammonium, N⁺(R¹⁴)₄Salts and alkaline earth metal hydroxides, and the like. Suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, ammonia, such as primary, secondary and tertiary, N⁺(R¹⁴)₄Salts, e.g. R¹⁴Is H, C_1-4Alkyl radical, C_6-10Aryl radical, C_6-10Aryl radical C_1-4Alkyl, etc., and cyclic amines such as piperidine, morpholine, piperazine, etc., and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Also included are suitable, non-toxic ammonium, quaternary ammonium salts and amine cations resistant to formation of counterions, e.g., halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C_1-8Sulfonates and aromatic sulfonates.

"solvate" of the present invention refers to an association of one or more solvent molecules with a compound of the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, aminoethanol. The term "hydrate" refers to an association of solvent molecules that is water.

The term "protecting group" or "Pg" refers to a substituent that when reacted with another functional group, is typically used to block or protect a particular functionality. For example, "amino protecting group" refers to a substituent attached to an amino group to block or protect the functionality of the amino group in a compound, and suitable amino protecting groups include acetyl, trifluoroacetyl, t-Butoxycarbonyl (BOC), benzyloxycarbonyl (CBZ) and 9-fluorenylmethylenoxycarbonyl (Fmoc). Similarly, "hydroxyl protecting group" refers to the functionality of a substituent of a hydroxyl group to block or protect the hydroxyl group, and suitable protecting groups include acetyl and silyl groups. "carboxy protecting group" refers to the functionality of a substituent of a carboxy group to block or protect the carboxy group, and typical carboxy protecting groups include-CH₂CH₂SO₂Ph, cyanoethyl, 2- (trimethylsilyl) ethyl, 2- (trimethylsilyl) ethoxymethyl, 2- (p-toluenesulfonyl) ethyl, 2- (p-nitrobenzenesulfonyl) ethyl, 2- (diphenylphosphino) ethyl, nitroethyl, and the like. General descriptions of protecting groups can be found in the literature: greene, Protective Groups in Organic Synthesis, John Wiley&Sons,New York,1991；and P.J.Kocienski,Protecting Groups,Thieme,Stuttgart,2005。

Description of the Compounds of the invention

The compound and the pharmaceutically acceptable composition thereof can effectively inhibit HBV infection.

In one aspect, the invention relates to a compound of formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (I), or a prodrug thereof,

wherein X is N or-CR^6a-；

Y is a single bond, -CH₂-or-C (═ O) -;

q is a single bond, -O-or-N (R)⁹)-；

R¹Is hydrogen, deuterium, F, Cl, Br, I, OH, -COOH, heterocyclic group consisting of 5-6 ring atoms, heteroaryl group consisting of 5-6 ring atoms, C_1-6Alkyl radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-7Cycloalkyl radical, R¹²-S(＝O)₂-、R¹²-(CR^eR^f)_n-or R^aR^bN-wherein said heterocyclic group consisting of 5 to 6 ring atoms, heteroaryl group consisting of 5 to 6 ring atoms, C_1-6Alkyl radical, C_2-6Alkenyl radical, C_2-6Alkynyl and C_3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4R^vSubstituted;

R⁹is hydrogen, deuterium, C_1-6Alkyl or C_1-6Haloalkyl, or R⁹、R¹Together with the nitrogen atom to which they are attached, form a heterocyclic group of 3 to 12 ring atoms, wherein said C_1-6Alkyl radical, C_1-6The heterocyclyl consisting of haloalkyl and 3 to 12 ring atoms being unsubstituted or substituted by 1,2,3 or 4 substituents selected from-COOH, ═ O, tetrazolyl or C_1-6alkyl-O-C (═ O) -;

R²、R³、R⁷and R⁸Each independently hydrogen, deuterium, F, Cl, Br, hydroxy, cyano, C_1-12Alkyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl, heteroaryl of 5 to 10 ring atoms, R¹³-(CR^eR^f)_m-、R¹³-(CR^eR^f)_m-O-、R¹³-C(＝O) -(CR^eR^f)_m-、R¹³-C(＝O)-N(R^g)-(CR^eR^f)_m-、R¹⁸-N(R^g)-C(＝O)-O-、R¹⁹-N(R^m)-C(＝O)-N(Rⁿ)-、 R¹³-O-C(＝O)-(CR^eR^f)_m-、R¹³-O-C(＝O)-N(R^g)-(CR^eR^f)_m-、R^c-C(＝O)-(CR^eR^f)_m-O-C(＝O)-、

R¹⁴-S(＝O)₂-(CR^eR^f)_m-、R¹⁴-S(＝O)₂-N(R^g)-(CR^eR^f)_m-、R¹⁴-S(＝O)₂-N(R^g)-C(＝O)-、R^aR^bN-、R^cC(＝O)-、 R^aR^bNC(＝O)-、R^dOC (═ O) -or R¹⁰O-wherein said C_1-12Alkyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^wSubstituted;

R¹⁰is hydrogen, deuterium, C_1-12Alkyl radical, C_2-12Alkynyl, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl, heteroaryl of 5 to 10 ring atoms, R¹⁵-(CR^eR^f)_g-、R¹⁵-O-(CR^eR^f)_g-、R¹⁵-C(＝O)-(CR^eR^f)_g-、R¹⁵-O-C(＝O)-(CR^eR^f)_g-、 R¹⁵-O-C(＝O)-N(R^g)-(CR^eR^f)_g-、R¹⁶-S(＝O)₂-(CR^eR^f)_g-or R¹⁶-S(＝O)₂-N(R^g)-(CR^eR^f)_g-, wherein said C_1-12Alkyl radical, C_2-12Alkynyl, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^xSubstituted;

R⁴and R⁵Each independently is deuterium, F, C_1-6Alkyl radical, C_1-6Alkylamino radical, C_1-6Alkoxy radical, C_2-6Alkynyl, C_2-6Alkenyl radical, C_3-7Cycloalkyl or heterocyclyl consisting of 3 to 12 ring atoms, wherein said C is_1-6Alkyl radical, C_1-6Alkylamino radical, C_1-6Alkoxy radical, C_2-6Alkynyl, C_2-6Alkenyl radical, C_3-7Cycloalkyl and heterocyclyl consisting of 3 to 12 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴、R⁵Together with the carbon atom to which they are attached form C_3-7Cycloalkyl or heterocyclyl consisting of 3 to 12 ring atoms, wherein said C is_3-7Cycloalkyl and heterocyclyl consisting of 3 to 12 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴Is F, Cl or Br, with R⁵Is hydrogen;

R⁶is hydrogen, deuterium, C_1-6Alkyl radical, C_2-6Alkenyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl, heteroaryl of 5 to 10 ring atoms or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said C_1-6Alkyl radical, C_2-6Alkenyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^zSubstituted;

R^6ais hydrogen, deuterium, F, Cl, Br, CN, OH, C_1-6Alkyl radical, C_2-6Alkenyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl, heteroaryl of 5 to 10 ring atoms or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said C_1-6Alkyl radical, C_2-6Alkenyl radical, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently notSubstituted or by 1,2,3 or 4R^zSubstituted;

R¹²and R¹⁷Each independently is C_3-7Cycloalkyl radical, C_6-10Aryl radical, C_1-6Alkoxy, amino or C_1-6Alkylamino, wherein said C_3-7Cycloalkyl radical, C_6-10Aryl radical, C_1-6Alkoxy, amino and C_1-6Alkylamino is each independently unsubstituted or substituted by 1,2,3 or 4R^jSubstituted;

R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸and R¹⁹Each independently is C_1-12Alkyl radical, C_1-12Alkoxy radical, C_3-7Cycloalkyl, heteroaryl of 5 to 10 ring atoms, heterocyclyl of 3 to 12 ring atoms or C_6-10Aryl, wherein said C_1-12Alkyl radical, C_1-12Alkoxy radical, C_3-7Cycloalkyl, heteroaryl of 5-10 ring atoms, heterocyclyl of 3-12 ring atoms and C_6-10Each aryl group is independently unsubstituted or substituted with 1,2,3 or 4R^hSubstituted;

R^a、R^b、R^c、R^d、R^e、R^f、R^g、R^k、Rⁱ、R^mand RⁿEach independently of the other is H, deuterium, OH, C_1-6Haloalkyl, C_1-6Alkyl radical, C_1-6Alkoxy radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-6Cycloalkyl radical, C_6-10Aryl, heterocyclyl of 3 to 12 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is_1-6Haloalkyl, C_1-6Alkyl radical, C_1-6Alkoxy radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-6Cycloalkyl radical, C_6-10Aryl, heterocyclyl consisting of 3 to 12 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy or C_1-6Alkyl ammoniaA group;

or R^a、R^bAnd together with the nitrogen atom to which they are attached, form a heterocyclyl of 3 to 8 ring atoms or a heteroaryl of 5 to 8 ring atoms, wherein the heterocyclyl of 3 to 8 ring atoms and the heteroaryl of 5 to 8 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy or C_1-6An alkylamino group;

or R^mAnd RⁿAnd the nitrogen atom to which they are attached, form a heterocyclic group of 3 to 8 ring atoms, wherein said heterocyclic group of 3 to 8 ring atoms is each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy or C_1-6An alkylamino group;

R^v、R^w、R^x、R^y、R^z、R^jand R^hEach independently is F, Cl, Br, CN, OH, -COOH, amino, C_1-12Alkyl radical, C_1-12Haloalkyl, C_1-12Alkoxy radical, C_1-12Haloalkoxy, C_1-12Alkylthio radical, C_1-12Alkylamino radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C_1-12Alkyl radical, C_1-12Haloalkyl, C_1-12Alkoxy radical, C_1-12Haloalkoxy, C_1-12Alkylthio radical, C_1-12Alkylamino radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_3-7Cycloalkyl, heterocyclic radical consisting of 3-12 ring atoms, C_6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, ═ O, -COOH, amino, C_1-6Alkyl, aryl, heteroaryl, and heteroaryl,C_1-6Haloalkyl, C_1-6Alkoxy radical, C_1-6Alkylthio radical, C_1-6Haloalkoxy, C_1-12Alkylamino radical, C_2-6Alkenyl radical, C_2-6Alkynyl, C_6-10Aryl radical, C_3-6Cycloalkyl, heteroaryl of 5 to 6 ring atoms, heterocyclyl of 5 to 6 ring atoms, C_1-6Alkoxy radical C_1-6Alkylene or C_1-6alkylamino-C_1-6An alkylene group;

n and q are each independently 0, 1,2,3,4, 5 or 6;

m and g are each independently 0, 1,2,3,4, 5,6, 7, 8, 9 or 10.

In some embodiments, R is described herein¹Is hydrogen, deuterium, F, Cl, Br, I, OH, -COOH, heterocyclic group consisting of 5 ring atoms, heteroaryl group consisting of 5 ring atoms, C_1-4Alkyl radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl radical, R¹²-S(＝O)₂-、R¹²-(CR^eR^f)_n-or R^aR^bN-wherein said heterocyclic group consisting of 5 ring atoms, heteroaryl group consisting of 5 ring atoms, C_1-4Alkyl radical, C_2-4Alkenyl radical, C_2-4Alkynyl and C_3-6Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4R^vSubstituted;

R⁹is hydrogen, deuterium, C_1-4Alkyl or C_1-4Haloalkyl, or R⁹、R¹Together with the nitrogen atom to which they are attached, form a heterocyclic group of 5 to 6 ring atoms, wherein said C_1-4Alkyl radical, C_1-4The heterocyclyl consisting of haloalkyl and 5 to 6 ring atoms being unsubstituted or substituted by 1,2,3 or 4 substituents selected from-COOH, ═ O, tetrazolyl or C_1-6alkyl-O-C (═ O) -;

wherein each R is¹²、n、R^e、R^f、R^a、R^bAnd R^vHave the meaning as described in the present invention.

In other embodiments, R is as described herein¹Is hydrogen, deuterium,F. Cl, Br, I, OH, -COOH, thiazolyl, tetrazolyl, methyl, ethyl, n-propyl, isopropyl, ethenyl, propenyl, ethynyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, R¹²-S(＝O)₂-、 R¹²-(CR^eR^f)_n-or R^aR^bN-, wherein said thiazolyl, methyl, ethyl, N-propyl, isopropyl, ethenyl, propenyl, ethynyl, propynyl, cyclopropyl, cyclobutyl and cyclopentyl are each independently unsubstituted or substituted by 1,2,3 or 4R^vSubstituted;

R⁹is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl or C_1-3Haloalkyl, or R⁹、R¹And together with the nitrogen atom to which they are attached, form a pyrrolidinyl, piperazinyl, piperidinyl or morpholinyl group wherein said methyl, ethyl, n-propyl, isopropyl, C_1-3Haloalkyl, pyrrolidinyl, piperazinyl, piperidinyl and morpholinyl unsubstituted or substituted by 1,2,3 or 4 substituents selected from-COOH, ═ O, tetrazolyl or C_1-6alkyl-O-C (═ O) -;

wherein each R is¹²、n、R^e、R^f、R^a、R^bAnd R^vHave the meaning as described in the present invention.

In some embodiments, R is described herein²、R³、R⁷And R⁸Each independently hydrogen, deuterium, F, Cl, Br, hydroxy, cyano, C_1-6Alkyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 6 ring atoms, R¹³-(CR^eR^f)_m-、 R¹³-(CR^eR^f)_m-O-、R¹³-C(＝O)-(CR^eR^f)_m-、R¹³-C(＝O)-N(R^g)-(CR^eR^f)_m-、R¹⁸-N(R^g)-C(＝O)-O-、 R¹⁹-N(R^m)-C(＝O)-N(Rⁿ)-、R¹³-O-C(＝O)-(CR^eR^f)_m-、R¹³-O-C(＝O)-N(R^g)-(CR^eR^f)_m-、 R^c-C(＝O)-(CR^eR^f)_m-O-C(＝O)-、

R¹⁴-S(＝O)₂-(CR^eR^f)_m-、R¹⁴-S(＝O)₂-(NR^g)-(CR^eR^f)_m-、 R¹⁴-S(＝O)₂-N(R^g)-C(＝O)-、R^aR^bN-、R^cC(＝O)-、R^aR^bNC(＝O)-、R^dOC (═ O) -or R¹⁰O-wherein said C_1-6Alkyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^wSubstituted;

R¹⁰is hydrogen, deuterium, C_1-6Alkyl radical, C_2-6Alkynyl, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 6 ring atoms, R¹⁵-(CR^eR^f)_g-、R¹⁵-O-(CR^eR^f)_g-、R¹⁵-C(＝O)-(CR^eR^f)_g-、R¹⁵-O-C(＝O)-(CR^eR^f)_g-、 R¹⁵-O-C(＝O)-N(R^g)-(CR^eR^f)_g-、R¹⁶-S(＝O)₂-(CR^eR^f)_g-or R¹⁶-S(＝O)₂-N(R^g)-(CR^eR^f)_g-, wherein said C_1-6Alkyl radical, C_2-6Alkynyl, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^xSubstituted;

wherein each g, m, R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸、R¹⁹、R^a、R^b、R^c、R^d、R^e、R^f、R^g、R^m、Rⁿ、R^k、Rⁱ、 R^xAnd R^wHave the meaning as described in the present invention.

In other embodiments, R is as described herein²、R³、R⁷And R⁸Each independently hydrogen, deuterium, F, Cl, Br, hydroxy, cyano, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl, n-hexyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl, naphthyl, R¹³-(CR^eR^f)_m-、 R¹³-(CR^eR^f)_m-O-、R¹³-C(＝O)-(CR^eR^f)_m-、R¹³-C(＝O)-N(R^g)-(CR^eR^f)_m-、R¹⁸-N(R^g)-C(＝O)-O-、 R¹⁹-N(R^m)-C(＝O)-N(Rⁿ)-、R¹³-O-C(＝O)-(CR^eR^f)_m-、R¹³-O-C(＝O)-N(R^g)-(CR^eR^f)_m-、 R^c-C(＝O)-(CR^eR^f)_m-O-C(＝O)-、

R¹⁴-S(＝O)₂-(CR^eR^f)_m-、R¹⁴-S(＝O)₂-N(R^g)-(CR^eR^f)_m-、 R¹⁴-S(＝O)₂-N(R^g)-C(＝O)-、R^aR^bN-、R^cC(＝O)-、R^aR^bNC(＝O)-、R^dOC (═ O) -or R¹⁰O-, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl, n-hexyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R^wSubstituted;

R¹⁰is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl, n-hexyl, ethynyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl, naphthyl, R¹⁵-(CR^eR^f)_g-、R¹⁵-O-(CR^eR^f)_g-、R¹⁵-C(＝O)-(CR^eR^f)_g-、R¹⁵-O-C(＝O)-(CR^eR^f)_g-、 R¹⁵-O-C(＝O)-N(R^g)-(CR^eR^f)_g-、R¹⁶-S(＝O)₂-(CR^eR^f)_g-or R¹⁶-S(＝O)₂-N(R^g)-(CR^eR^f)_g-, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl, n-hexyl, ethynyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranylPyranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R^xSubstituted;

wherein each g, m, R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸、R¹⁹、R^a、R^b、R^c、R^d、R^e、R^f、R^g、R^m、Rⁿ、R^k、Rⁱ、 R^xAnd R^wHave the meaning as described in the present invention.

In some embodiments, R is described herein⁴And R⁵Each independently is deuterium, F, C_1-4Alkyl radical, C_1-4Alkylamino radical, C_1-4Alkoxy radical, C_2-4Alkynyl, C_2-4Alkenyl radical, C_3-6Cycloalkyl or heterocyclyl consisting of 5 to 6 ring atoms, in which said C is_1-4Alkyl radical, C_1-4Alkylamino radical, C_1-4Alkoxy radical, C_2-4Alkynyl, C_2-4Alkenyl radical, C_3-6Cycloalkyl and heterocyclyl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴、R⁵Together with the carbon atom to which they are attached form C_3-6Cycloalkyl or heterocyclyl consisting of 5 to 6 ring atoms, in which said C is_3-6Cycloalkyl and heterocyclyl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴Is F, Cl or Br, with R⁵Is hydrogen;

R⁶is hydrogen, deuterium, C_1-4Alkyl radical, C_2-4Alkenyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, hetero-ring consisting of 5 to 10 ring atomsAryl or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said C_1-4Alkyl radical, C_2-4Alkenyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^zSubstituted;

R^6ais hydrogen, deuterium, F, Cl, Br, CN, OH, C_1-4Alkyl radical, C_2-4Alkenyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 10 ring atoms or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said C_1-4Alkyl radical, C_2-4Alkenyl radical, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4R^zSubstituted;

wherein each q and R¹⁷、R^e、R^f、R^zAnd R^yHave the meaning as described in the present invention.

In other embodiments, R is as described herein⁴And R⁵Each independently is deuterium, F, C_1-3Alkyl radical, C_1-3Alkylamino radical, C_1-3Alkoxy radical, C_2-4Alkynyl, C_2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl wherein said C is_1-3Alkyl radical, C_1-3Alkylamino radical, C_1-3Alkoxy radical, C_2-4Alkynyl, C_2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

or R⁴、R⁵And together with the carbon atom to which they are attached form a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl group, wherein said cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substituted with 1,2,3, or 4R^ySubstituted;

or R⁴Is F, Cl or Br, with R⁵Is hydrogen;

R⁶is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, vinyl, propenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolyl, purinyl, phenyl, naphthyl or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, vinyl, propenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolyl, purinyl, phenyl and naphthyl are each independently unsubstituted or 1,2,3 or 4R^zSubstituted;

R^6ais hydrogen, deuterium, F, Cl, Br, CN, OH, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, vinyl, propenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolyl, purinyl, phenyl, naphthyl or R¹⁷-C(＝O)-O-(CR^eR^f)_q-, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, vinyl, propenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolyl, purinyl, phenyl and naphthyl are each independently unsubstituted or 1,2,3 or 4R^zSubstituted;

wherein each q and R¹⁷、R^e、R^f、R^zAnd R^yHave the meaning as described in the present invention.

In some embodiments, R is described herein¹²And R¹⁷Each independently is C_3-6Cycloalkyl, phenyl, naphthyl, C_1-4Alkoxy, amino or C_1-4Alkylamino, wherein said C_3-6Cycloalkyl, phenyl, naphthyl, C_1-4Alkoxy, amino and C_1-4Alkylamino is each independently unsubstituted or substituted by 1,2,3 or 4R^jSubstituted;

R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸and R¹⁹Each independently is C_1-6Alkyl radical, C_1-6Alkoxy radical, C_3-6Cycloalkyl, heteroaryl of 5 to 6 ring atoms, heterocyclyl of 5 to 6 ring atoms, phenyl or naphthyl, wherein C is_1-6Alkyl radical, C_1-6Alkoxy radical, C_3-6Cycloalkyl, heteroaryl of 5 to 6 ring atoms, heterocyclyl of 5 to 6 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4R^hSubstituted;

wherein each R is^j、R^hHave the meaning as described in the present invention.

In other embodiments, R is as described herein¹²And R¹⁷Each independently of the other is cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, methoxy, ethoxy, propoxy, isopropoxy, N-butoxy, amino, N-methylamino, N-ethylamino, N, N-dimethylamino or N, N-diethylamino, where the cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, methoxy, ethoxy, propoxy, isopropoxy, N-butoxy, amino, N-methylamino, N-ethylamino, N, N-dimethylamino and N, N-diethylamino are each independently unsubstituted or substituted by 1,2,3 or 4R^jSubstituted;

R¹³、R¹⁴、R¹⁵、R¹⁶、R¹⁸and R¹⁹Each independently is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl or naphthyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, n-butyl, isobutyl, tert-butyl, methoxy, or naphthylAryl, ethoxy, propoxy, isopropoxy, n-butoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4R^hSubstituted;

wherein each R is^j、R^hHave the meaning as described in the present invention.

In some embodiments, R is described herein^a、R^b、R^c、R^d、R^e、R^f、R^g、R^k、Rⁱ、R^mAnd RⁿEach independently of the other is H, deuterium, OH, C_1-4Haloalkyl, C_1-4Alkyl radical, C_1-4Alkoxy radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl, phenyl, naphthyl, heterocyclyl consisting of 5 to 6 ring atoms or heteroaryl consisting of 5 to 6 ring atoms, wherein said C_1-4Haloalkyl, C_1-4Alkyl radical, C_1-4Alkoxy radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl, phenyl, naphthyl, heterocyclyl of 5-6 ring atoms and heteroaryl of 5-6 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group;

or R^a、R^bAnd together with the nitrogen atom to which they are attached, form a heterocyclyl of 5 to 6 ring atoms or a heteroaryl of 5 to 6 ring atoms, wherein the heterocyclyl of 5 to 6 ring atoms and the heteroaryl of 5 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituentsThe substituents are independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group;

or R^mAnd RⁿAnd the nitrogen atom to which they are attached, form a heterocyclic group of 3 to 6 ring atoms, wherein said heterocyclic group of 3 to 6 ring atoms is each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group.

In other embodiments, R is as described herein^a、R^b、R^c、R^d、R^e、R^f、R^g、R^k、Rⁱ、R^mAnd RⁿEach independently of the other is H, deuterium, OH, C_1-3Haloalkyl, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, vinyl, propenyl, ethynyl, propynyl, propargyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl or naphthyl, wherein said C is C_1-3Haloalkyl, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, ethenyl, propenyl, ethynyl, propynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridyl, n-butyl, n-butoxy, ethenyl, propenyl, ethynyl, propynyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, thienyl, pyridyl, thienyl, and the likeEach of the group, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl is independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group;

or R^a、R^bAnd together with the nitrogen atom to which they are attached form pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group;

or R^mAnd RⁿAnd the nitrogen atom to which they are attached, form a heterocyclic group of 4 to 6 ring atoms, wherein said heterocyclic group of 4 to 6 ring atoms is each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4An alkylamino group.

In some embodiments, R is described herein^v、R^w、R^x、R^y、R^z、R^jAnd R^hEach independently is F, Cl, Br, CN, OH, -COOH, amino, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy radical, C_1-6Haloalkoxy, C_1-6Alkylthio radical, C_1-6Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 to 6 ring atoms or R¹⁹-O-(CR^eR^f)_k-, wherein said amino group, C_1-6Alkyl radical, C_1-6Haloalkyl, C_1-6Alkoxy radical, C_1-6Haloalkoxy, C_1-6Alkylthio radical, C_1-6Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, C_3-6Cycloalkyl, heterocyclyl consisting of 5 to 6 ring atoms, phenyl, naphthyl and heteroaryl consisting of 5 to 6 ring atoms are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from the group consisting of F, Cl, Br, CN, OH, ═ O, -COOH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy radical, C_1-4Alkylthio radical, C_1-4Haloalkoxy, C_1-4Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, phenyl, naphthyl, C_3-6Cycloalkyl, heteroaryl of 5 to 6 ring atoms, heterocyclyl of 5 to 6 ring atoms, C_1-4Alkoxy radical C_1-4Alkylene or C_1-4alkylamino-C_1-4An alkylene group;

wherein each R is¹⁹、k、R^eAnd R^fHave the meaning as described in the present invention.

In other embodiments, R is as described herein^v、R^w、R^x、R^y、R^z、R^jAnd R^hEach independently is F, Cl, Br, CN, OH, -COOH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy radical, C_1-4Haloalkoxy, C_1-4Alkylthio radical, C_1-4Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienylTetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl or naphthyl or R^aR^bN-, wherein said cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, CN, OH, ═ O, -COOH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy radical, C_1-4Alkylthio radical, C_1-4Haloalkoxy, C_1-4Alkylamino radical, C_2-4Alkenyl radical, C_2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, phenyl, naphthyl, C_1-3Alkoxy radical C_1-3Alkylene or C_1-3alkylamino-C_1-3An alkylene group;

wherein each R is^aAnd R^bHave the meaning as described in the present invention.

In some embodiments, the present invention relates to compounds, or stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof, of one of the following, but in no way limited to these compounds:

unless otherwise specified, stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof of the compounds of formula (I) are included within the scope of the present invention.

In another aspect, the present invention also provides a pharmaceutical composition comprising the compound of the present invention, further comprising pharmaceutically acceptable excipients or a combination thereof.

In some embodiments, the pharmaceutical composition of the present invention further comprises an additional anti-HBV agent.

In other embodiments, the pharmaceutical composition of the invention, wherein the anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.

In some embodiments, the anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon interleukin, cladribine, emtricitabine, faplovir, interferon, calamine CP, intefine, interferon α -1b, interferon α, interferon α -2a, interferon β -1a, interferon α -2, interleukin-2, mevoltate, nitazoxanide, peginterferon α -2a, ribavirin, roscovitine-a, cezopyran, Euforavac, azapril, phazid, hepliav, interferon α -2b, levamisole, or propafegermanium.

In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient.

In some embodiments, the use of the invention, wherein the viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

In still other embodiments, the use of the present invention, wherein the disease caused by hepatitis b infection is liver cirrhosis or hepatocellular carcinoma.

In another aspect, the invention also provides the use of said compound or said pharmaceutical composition in the manufacture of a medicament for inhibiting the production or secretion of HBsAg, and/or for inhibiting the production of HBV DNA.

In another aspect, the invention relates to the use of a compound or pharmaceutical composition described herein in the manufacture of a medicament for the prevention, treatment or amelioration of hepatitis b disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound or pharmaceutical composition described herein.

Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a compound of the invention.

Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a pharmaceutical composition comprising a compound of the invention.

Another aspect of the invention relates to the use of a compound of the invention in the manufacture of a medicament for the prevention, treatment or treatment of HBV disorders in a patient and for lessening the severity thereof.

Another aspect of the present invention relates to the use of a pharmaceutical composition comprising a compound of the present invention in the manufacture of a medicament for preventing or treating HBV conditions in a patient and reducing the severity thereof.

Another aspect of the invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or composition of the invention in an amount effective to inhibit HBV. In other embodiments, the method further comprises contacting the cell with an anti-HBV agent.

Another aspect of the present invention relates to a method of treating HBV disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.

Another aspect of the present invention relates to a method of inhibiting HBV infection in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.

Another aspect of the invention relates to methods for the preparation, isolation and purification of compounds encompassed by formula (I).

The invention also encompasses the use of the compounds of the invention and pharmaceutically acceptable salts thereof for the manufacture of a pharmaceutical product effective in inhibiting HBV infection, including those described herein. The application of the compound of the invention in the production of the drugs for effectively inhibiting HBV infection. The compounds of the invention are also useful in the manufacture of a medicament for alleviating, preventing, controlling or treating a condition of hepatitis b in a patient. The present invention encompasses pharmaceutical compositions comprising a therapeutically effective amount of a compound represented by formula (I) in combination with at least one pharmaceutically acceptable excipient.

The invention also encompasses a method of effectively inhibiting HBV-infected diseases, or susceptibility to such conditions, which comprises treating a patient with a therapeutically effective amount of a compound represented by formula (I).

Unless otherwise indicated, all stereoisomers, tautomers, nitric oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof, of the compounds of the invention are within the scope of the invention.

In particular, the salts are pharmaceutically acceptable salts. The term "pharmaceutically acceptable" includes materials or compositions which must be compatible chemically or toxicologically, with the other components comprising the formulation, and with the mammal being treated.

The salts of the compounds of the present invention also include intermediates used in the preparation or purification of the compounds of formula (I) or salts of formula (I) or isomers thereof, but are not necessarily pharmaceutically acceptable salts.

The term "pharmaceutically acceptable" refers to a substance that is acceptable from a toxicological standpoint for pharmaceutical use and does not adversely interact with the active ingredient.

Salts of the compounds of the present invention also include, but are not necessarily pharmaceutically acceptable salts of intermediates used in the preparation or purification of the compounds of formula (I) or isolated enantiomers of the compounds of formula (I).

If the compounds of the invention are basic, the desired salts may be prepared by any suitable method provided in the literature, for example, using inorganic acids such as hydrochloric, hydrobromic, sulfuric, nitric and phosphoric acids and the like, or using organic acids such as acetic, maleic, succinic, mandelic, fumaric, malonic, pyruvic, malic, 2-hydroxypropionic, citric, oxalic, glycolic and salicylic acids, pyranonic acids such as glucuronic and galacturonic acids, α -hydroxy acids such as citric and tartaric acids, amino acids such as aspartic and glutamic acids, aromatic acids such as benzoic and cinnamic acids, sulfonic acids such as p-toluenesulfonic, benzenesulfonic, methanesulfonic, ethanesulfonic, trifluoromethanesulfonic and the like, or combinations thereof.

If the compound of the present invention is acidic, a desired salt can be prepared by an appropriate method, and an inorganic base such as a salt of a compound represented by the formula (I) with methylamine, dimethylamine, trimethylamine, ethylamine, diethylamine, triethylamine, tromethamine, diethylaminoethanol, isopropylamine, 2-ethylamino ethanol, pyridine, picoline, ethanolamine, diethanolamine, ammonium, dimethylethanolamine, tetramethylammonium, tetraethylammonium, triethanolamine, piperidine, piperazine, morpholine, imidazole salt, lysine, arginine, L-arginine, histidine, N-methylglucamine, dimethylglucamine, ethylglucamine, dicyclohexylamine, 1, 6-hexanediamine, ethylenediamine, sarcosine, serinol, aminopropanediol, 1-amino-2, 3, 4-butanetriol, L-lysine, ornithine, and the like can be used.

Compositions, formulations, administration of the compounds of the invention and uses of the compounds and compositions

The pharmaceutical composition comprises a compound with a structure shown in a formula (I) or a compound with a structure shown in an embodiment, or a stereoisomer, a tautomer, an oxynitride, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, and pharmaceutically acceptable auxiliary materials. The compound in the composition can effectively inhibit the hepatitis B virus and is suitable for treating diseases caused by the virus, particularly acute and chronic persistent HBV virus infection.

For the compounds of the invention, mention may be made of the indicator regions, for example: treatment of acute and chronic viral infections, which may lead to infectious hepatitis, e.g., hepatitis B virus infection. The compounds of the invention are particularly suitable for the treatment of chronic hepatitis B infections and acute and chronic hepatitis B virus infections.

The invention encompasses pharmaceutical preparations which, in addition to nontoxic, inert, pharmaceutically suitable adjuvants, also contain one or more compounds (I) according to the invention.

The above pharmaceutical preparation may also contain other active pharmaceutical ingredients than compound (I).

The compounds of the invention exist in free form or, where appropriate, as pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adduct or derivative that can be administered directly or indirectly in accordance with the needs of the patient, compounds described in other aspects of the invention, metabolites thereof, or residues thereof.

As described herein, The Pharmaceutical composition of The present invention comprises any one of The compounds of formula (I) of The present invention, further comprises pharmaceutically acceptable excipients, such as those used herein, including any solvent, solid excipient, diluent, binder, disintegrant, or other liquid excipient, dispersing agent, flavoring agent or suspending agent, surfactant, isotonic agent, thickening agent, emulsifying agent, preservative, solid binder or lubricant, and The like, suitable for The proper target dosage form, as described In In Remington: The Science and practice of Pharmacy,21 description, 2005, ed.D.B.Troy, &l &/t &g ping inpicotina Williams & Wilkins, Philadelphia, and Encydopenta of Pharmacy, Switch, and C, In a range of The invention and any other pharmaceutically acceptable excipients, such as those used In The general formulation, and other Pharmaceutical compositions that are not compatible with each other, but are not compatible with each other pharmaceutically acceptable excipients, such as The invention, Pharmaceutical composition used In The general Pharmaceutical composition of The general method of The invention, and method of The invention, generally applicable to The extent of The invention, and The range of The invention, generally known to be used In any other acceptable excipients, In The general use of The invention, as indicated by The general use of The invention.

Substances that may serve as pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum albumin; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; partial glyceride mixtures of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silica; magnesium trisilicate; polyvinylpyrrolidone; polyacrylate esters; a wax; polyethylene-polyoxypropylene-blocking polymers; lanolin; sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gum powder; malt; gelatin; talc powder; adjuvants such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic salt; ringer's solution; ethanol; phosphoric acid buffer solution; and other non-toxic suitable lubricants such as sodium lauryl sulfate and magnesium stearate; a colorant; a release agent; coating the coating material; a sweetener; a flavoring agent; a fragrance; preservatives and antioxidants.

Pharmaceutical compositions of the compounds of the invention may be administered in any of the following ways: oral administration, spray inhalation, topical administration, rectal administration, nasal administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrapulmonary, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or by means of a reservoir of external value. Preferred modes of administration are oral, intramuscular, intraperitoneal or intravenous.

The compounds of the present invention or compositions containing them which are pharmaceutically acceptable may be administered in unit dosage form. The administration dosage form can be liquid dosage form or solid dosage form. The liquid dosage forms can be true solutions, colloids, microparticles, and suspensions. Other dosage forms such as tablet, capsule, dripping pill, aerosol, pill, powder, solution, suspension, emulsion, granule, suppository, lyophilized powder for injection, clathrate, implant, patch, liniment, etc.

Oral tablets and capsules may contain excipients such as binding agents, for example syrup, acacia, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, such as lactose, sucrose, corn starch, calcium phosphate, sorbitol, glycine; lubricants, such as magnesium stearate, talc, polyethylene glycol, silica; disintegrants, such as potato starch; or acceptable humectants such as sodium lauryl sulfate. The tablets may be coated by methods known in the art of pharmacy.

Oral liquids may be in the form of suspensions of hydrated oils, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, sorbitol, cellulose methyl ether, glucose syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gelatin, hydrogenated edible fats and oils, emulsifying agents such as lecithin, sorbitan monooleate, gum arabic; or non-aqueous vehicles (which may include edible oils), such as almond oil, fats and oils such as glycerol, ethylene glycol, or ethanol; preservatives, e.g. methyl or propyl p-hydroxybenzoates, sorbic acid. Flavoring or coloring agents may be added if desired.

Suppositories may contain conventional suppository bases such as cocoa butter or other glycerides.

For parenteral administration, the liquid dosage form is usually prepared from the compound and a sterile excipient. The auxiliary material is preferably water. According to different selected adjuvants and drug concentrations, the compound can be dissolved in adjuvants or made into suspension solution, and can be dissolved in water for injection, filtered, sterilized and filled into sealed bottle or ampoule.

When applied topically to the skin, the compounds of the present invention may be formulated in the form of a suitable ointment, lotion, or cream in which the active ingredient is suspended or dissolved in one or more excipients which may be used in ointment formulations including, but not limited to: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; lotions and creams adjuvants that may be used include, but are not limited to: mineral oil, sorbitan monostearate, tween 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.

In general, it has proven advantageous, both in human medicine and in veterinary medicine, to administer the active compounds according to the invention in a total amount of from about 0.01 to 500mg/kg of body weight, preferably from 0.01 to 100mg/kg of body weight, if appropriate in multiple single doses, per 24 hours in order to achieve the desired effect. The amount of active compound contained in a single dose is preferably about 1 to 80mg, more preferably 1 to 50mg per kg body weight, but may be varied from the above-mentioned dose, i.e., depending on the kind and body weight of the subject to be treated, the nature and severity of the disease, the type of preparation and the mode of administration of the drug, and the period or interval of administration.

The pharmaceutical composition provided by the invention also comprises an anti-HBV medicament. Wherein the anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, an interferon or other emerging anti-HBV agent such as an HBV RNA replication inhibitor, an HBsAg secretion inhibitor, an HBV capsid inhibitor, an antisense oligomer, siRNA, an HBV therapeutic vaccine, an HBV prophylactic vaccine, an HBV antibody therapy (monoclonal or polyclonal) and an agonist for the treatment or prevention of HBV.

anti-HBV drugs include lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon interleukin, cladribine, emtricitabine, faprivir, interferon, calamine CP, intefine, interferon α -1b, interferon α, interferon α -2a, interferon β -1a, interferon α -2, interleukin-2, mefenate, nitazoxanide, peginterferon α -2a, ribavirin, rosmarin-A, cizopyran, Euforavac, ritolimod, phosziphad, hepisiva, interferon α -2b, levamisole or propagum.

In one aspect, the use of a compound or pharmaceutical composition of the invention for the manufacture of a medicament for the prevention, treatment or amelioration of hepatitis b disease in a patient, comprises administering to the patient a pharmaceutically acceptable effective amount. Hepatitis B disease refers to liver diseases caused by hepatitis B virus infection or hepatitis B infection, including acute hepatitis, chronic hepatitis, liver cirrhosis and stem cell carcinoma. Acute hepatitis b virus infection may be asymptomatic or manifest as acute hepatitis symptoms. Patients with chronic viral infections have active disease and can develop cirrhosis and liver cancer.

The compound or the pharmaceutical composition of the invention can be used for inhibiting the generation or secretion of HBsAg, and comprises the step of administering an effective dose which is acceptable in pharmacy to a patient.

The compound or the pharmaceutical composition of the invention can be used for inhibiting HBV DNA generation, and comprises the step of administering an effective dose which is pharmaceutically acceptable to a patient to the patient.

In one aspect, the compound or pharmaceutical composition of the present invention can be used for inhibiting the expression of HBV genes, comprising administering to a patient a pharmaceutically acceptable effective amount.

The anti-HBV agent may be administered separately from a composition comprising a compound of the present invention as part of a multiple dosing regimen. Alternatively, those agents may be part of a single dosage form, mixed together with the compounds of the present invention to form a single composition. If administered as part of a multiple dosing regimen, the two active agents can be delivered to each other simultaneously, sequentially or over a period of time, to achieve the desired agent activity.

The amount of compound and composition that can be combined with an adjuvant material to produce a single dosage form (those containing a composition like that described herein) will vary depending on the indication and the particular mode of administration. Normally, the amount of the composition of the invention will not exceed the amount of the composition normally administered containing as the only active agent.

The compound of the invention shows stronger antiviral effect. The compounds have unexpected antiviral activity on HBV, and are suitable for treating various diseases caused by viruses, especially diseases caused by acute and chronic persistent HBV virus infection. Chronic viral diseases caused by HBV can lead to a variety of syndromes of varying severity, and chronic hepatitis b virus infection is known to cause cirrhosis and/or hepatocellular carcinoma.

Examples of indications that can be treated with the compounds of the invention are: treating acute and chronic viral infections that can lead to infectious hepatitis, such as heterohepatitis virus infection. Particularly preferred are the treatment of chronic hepatitis B infection and the treatment of acute hepatitis B virus infection.

The invention also relates to the use of the compounds and compositions of the invention for the preparation of medicaments for the treatment and prophylaxis of viral diseases, in particular hepatitis b.

General synthetic methods

To illustrate the invention, the following examples are set forth. It is to be understood that the invention is not limited to these embodiments, but is provided as a means of practicing the invention.

In general, the compounds of the present invention may be prepared by the methods described herein, wherein the substituents are as defined in formula (I), unless otherwise indicated. The following reaction schemes and examples serve to further illustrate the context of the invention.

Those skilled in the art will recognize that: the chemical reactions described herein may be used to suitably prepare a number of other compounds of the invention, and other methods for preparing the compounds of the invention are considered to be within the scope of the invention. For example, the synthesis of those non-exemplified compounds according to the present invention can be successfully accomplished by those skilled in the art by modification, such as appropriate protection of interfering groups, by the use of other known reagents in addition to those described herein, or by some routine modification of reaction conditions. In addition, the reactions disclosed herein or known reaction conditions are also recognized as being applicable to the preparation of other compounds of the present invention.

The examples described below, unless otherwise indicated, all temperatures are in degrees Celsius (. degree. C.). Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, Arco Chemical Company and Alfa Chemical Company and were used without further purification unless otherwise indicated. General reagents were purchased from Shantou Wen Long chemical reagent factory, Guangdong Guanghua chemical reagent factory, Guangzhou chemical reagent factory, Tianjin HaoLiyu Chemicals Co., Ltd, Qingdao Tenglong chemical reagent Co., Ltd, and Qingdao Kaseiki chemical plant.

NMR spectral data were measured by Bruker Avance 400 NMR spectrometer or Bruker Avance IIIHD 600 NMR spectrometer, in CDCl₃,DMSO-d₆,CD₃OD or d₆Acetone as solvent (reported in ppm) with TMS (0ppm) or chloroform (7.26ppm) as reference standard. When multiple peaks occur, the following abbreviations will be used: s (singlets, singlet), s, s (singlets, singlet), d (doublets ), t (triplets, triplets), m (multiplets ), br (broadcasters, broadpeaks), dd (doublets of doublets), ddd (doublets of doublets), dt (doublets of doublets, doublets of doublets, and doublets of doublets) Ddt (doublet of doublet of triplets), td (triplet of triplets), br. Coupling constant J, in Hertz (Hz).

Low resolution Mass Spectral (MS) data were measured by Agilent 6320 series L C-MS spectrometer equipped with G1312A binary pump and a G1316A TCC (column temperature maintained at 30 ℃), with G1329A auto sampler and G1315B DAD detector applied for analysis and ESI source applied to L C-MS spectrometer.

Low resolution Mass Spectral (MS) data were measured by Agilent 6120 series L C-MS spectrometer equipped with G1311A quaternary pump and G1316A TCC (column temperature maintained at 30 ℃), with G1329A auto sampler and G1315D DAD detector applied for analysis and ESI source applied to L C-MS spectrometer.

Both spectrometers above were equipped with an Agilent Zorbax SB-C18 column, specification 2.1 × 30mm, 5 μm injection volume was determined by sample concentration, flow rate 0.6m L/min, peak value of HP L C was recorded read by UV-Vis wavelength at 210nm and 254 nm.mobile phase 0.1% formic acid acetonitrile solution (phase a) and 0.1% formic acid ultra pure water solution (phase B). gradient elution conditions are shown in table 1:

table 1: gradient elution conditions

Time (min)	A(CH3CN,0.1％HCOOH)	B(H2O,0.1％HCOOH)
			0-3	5-100	95-0
3-6	100	0
			6-6.1	100-5	0-95
6.1-8	5	95

The compound purification was assessed by Agilent 1100 series high performance liquid chromatography (HP L C) with UV detection at 210nm and 254nm, a Zorbax SB-C18 column, 2.1 × 30mm, 4 μm,10 minutes, flow rate 0.6m L/min, 5-95% (0.1% formic acid in acetonitrile) (0.1% formic acid in water), the column temperature was maintained at 40 ℃.

The following acronyms are used throughout the invention:

MeCN,CH₃CN acetonitrile

DCM,CH₂Cl₂Methylene dichloride

CHCl₃Chloroform, chloroform

CDC1₃Deuterated chloroform

CCl₄Carbon tetrachloride

Boc tert-butyloxycarbonyl group

PE Petroleum Ether

EtOAc, EA ethyl acetate

HCl hydrochloric acid

K₂CO₃Potassium carbonate

NaHCO₃Sodium bicarbonate

NaOH sodium hydroxide

NaCl sodium chloride

Na₂SO₄Sodium sulfate

Et₃N, TEA Triethylamine

NBS N-bromosuccinimide

D₂Heavy O water

H₂O water

m L ml

RT, RT Room temperature

Rt Retention time

H₂Hydrogen gas

HCl/EtOAc hydrogen chloride in ethyl acetate

HOAt 1-hydroxy-7-azobenzotriazol

DIPEA N, N-diisopropylethylamine

DCC N, N' -dicyclohexylcarbodiimide

DMF dimethyl formamide

DME dimethyl ether

THF tetrahydrofuran

LiOH.H₂O-lithium hydroxide monohydrate

NaBH₃CN Cyanoborohydride sodium salt

NaHMDS sodium bis (trimethylsilyl) amide

IPA isopropyl alcohol

DMSO dimethyl sulfoxide

CuCN cuprous cyanide

CH₃OH methanol

N₂Nitrogen gas

NH₄Cl ammonium chloride

Ac₂O acetic anhydride

t_1/2Half life

AUC area under the time curve

Vss steady state apparent distribution volume

C L clean clearance

Bioavailability of F, absolute bioavailalability

Amount of Dose

T_maxTime to peak

C_maxMaximum concentration

hr^*ng/m L blood concentration time

Synthesis method

The following synthetic schemes set forth the experimental procedures for preparing the compounds disclosed in the present invention. Wherein each R is¹Is C_1-6Alkyl radical, R²、R³、R⁴、 R⁵、R⁶、R⁷And R⁸Have the meaning as described in the present invention.

Synthesis scheme 1

Formula (II)(a-9)The compounds shown can be prepared by the methods described in scheme 1. First, the compound(a-1)Reacting with formaldehyde in alkali (such as dimethylamine) and suitable solvent (such as acetonitrile, mixed solvent of acetonitrile and water, etc.) to obtain compound(a-2). Compound (I)(a-2)With Me₃The cyclization reaction of SOI in base (such as potassium tert-butoxide) and appropriate solvent (such as THF) to obtain compound(a-3). Compound (I)(a-3)And NH₄OAc, reducing agents (e.g. NaBH)₃CN, etc.) and a suitable solvent (e.g., methanol, etc.) to produce a compound(a-4). Compound (I)(a-4)With formic acid or ethyl formate in a suitable solvent (e.g., 1,4 dioxane, tetrahydrofuran, etc.) to form the compound(a-5). Compound (I)(a-5)With phosphorus oxychloride in a suitable solvent (e.g., DCM, etc.) to formCompound (I)(a-6). Then, the compound(a-6)And compounds(j-1)Or(j-2)Cyclization reaction in a suitable solvent (e.g., isopropanol, ethanol, DMSO, etc.) occurs to produce compound (a-7). Next, the compound(a-7)With chloranil, dehydrogenating in proper solvent (DME, etc.) to produce compound(a-8)Finally, the compounds(a-8)In a base (e.g., lithium hydroxide, sodium hydroxide, etc.) and a suitable solvent (e.g., THF/H)₂O、EtOH/H₂O、MeOH/H₂O、MeOH/THF、H₂O, etc.) to produce a compound(a-9)。

Synthesis scheme 2

Formula (II)(b-5)The compounds shown can be prepared by the methods described in scheme 2. First, the compound(b-1)Reacting with potassium iodide in base (such as sodium hydride, etc.), at appropriate temperature and in appropriate solvent (such as tetrahydrofuran, etc.) to obtain compound(b-2). Compound (I)(b-2)With NaHMDS and methyl iodide, and a suitable solvent (such as THF, etc.) to form a compound(b-3). Compound (I)(b-3)With hydroxylamine in a suitable solvent (e.g. pyridine, etc.) to form the compound(b-4). Compound (I)(b-4) with hydrogen inReducing agent (such as Raney nickel) and suitable solvent (such as methanol) to obtain compound(b-5)。

Synthesis scheme 3

Formula (II)(c-6)The compounds shown can be prepared by the methods described in scheme 3. First, the compound(c-1)With formic acid or ethyl formate in a suitable solvent (e.g., 1,4 dioxane, tetrahydrofuran, etc.) to form the compound(c-2). Compound (I)(c-2)Reacting with phosphorus oxychloride in a suitable solvent (such as DCM, etc.) to form a compoundArticle (A)(c-3). Then, the compound(c-3)And compounds(j-1)Or(j-2)Cyclization reaction in a suitable solvent (e.g., isopropanol, ethanol, DMSO, etc.) occurs to produce compound (c-4). Next, the compound(c-4)With chloranil, dehydrogenating in proper solvent (DME, etc.) to produce compound(c-5)Finally, the compounds(c-5)In a base (e.g., lithium hydroxide, sodium hydroxide, etc.) and a suitable solvent (e.g., THF/H)₂O、EtOH/H₂O、MeOH/H₂O、MeOH/THF、 H₂O, etc.) to produce a compound(c- 6)。

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Preparation examples

In the following preparation examples, the inventors described in detail the preparation of the compounds of the present invention by taking some of the compounds of the present invention as examples.

Example 1: 6 '-isopropyl-10' -methoxy-9 '- (3-methoxypropoxy) -2' -oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylic acid

Step 1: 1- (4-methoxy-3- (3-methoxypropoxy) phenyl) -3-methyl-2-butanone

In a 100m L three-necked flask were added 4, 5-bis-diphenylphosphine-9, 9-dimethylxanthene (0.211g,0.36mmol), 4-bromo-1-methoxy-2- (3-methoxy) benzene (1.0g,3.6mmol), 3-methyl-2-butanone (0.47g,5.5mmol), sodium tert-butoxide (0.7g,7mmol), 1, 4-dioxane (20m L) and tris (dibenzylideneacetone) dipalladium (0.211g,0.36mmol) in this order, and under nitrogen protection, the reaction mixture was heated to 100 ℃ and stirred for 10 hours, after completion of the reaction, the reaction mixture was cooled to 25 ℃ and water (10m L) was added, followed by extraction with (20m L×), the combined organic layers were washed with a saturated sodium chloride solution, dried again with anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/V) ═ 2 (539) to give the title compound as a light yellow solid (0.6 g).

MS(ESI,Pos.ion)m/z:281.3[M+H]⁺。

Step 2: 2- (4-methoxy-3- (3-methoxypropoxy) phenyl-4-methyl-1-penten-3-one

1- (4-methoxy-3- (3-methoxypropoxy) phenyl) -3-methyl-2-butanone (1.11g,3.96 mmol), aqueous dimethylamine (1.07g,9.49mmol, mass: 40%), aqueous formaldehyde (0.71g,8.71mmol, mass: 37%), and acetonitrile (20M L) were added in this order to a 100M L single-neck flask, the reaction mixture was warmed to 85 ℃ and stirred for 18 hours, then cooled to 25 ℃ and concentrated under reduced pressure, the resulting residue was diluted with ethyl acetate (20M L), 1M hydrochloric acid (5M L), and water (10M L), the layers were allowed to stand, the aqueous layer was extracted with EtOAc (20M L× 2) and the organic phases were combined, the combined organic phases were washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure, and the resulting residue was chromatographed over a silica gel column (PE/EtOAc (V/V) 10/1) to give the title compound as a pale yellow solid (1.02g, 88%).

MS(ESI,Pos.ion)m/z:293.3[M+H]⁺。

And step 3: 1- (1- (4-methoxy-3- (3-methoxypropoxy) phenyl) cyclopropyl) -2-methyl-1-propanone

DMSO (2M L), trimethyl sulphoxide iodide (0.84g,3.8mmol), potassium tert-butoxide (0.43g, 3.8mmol) and THF (10M L) were added sequentially in a 100M L one-necked flask, stirred for 10min at 25 ℃, then a solution of 2- (4-methoxy-3- (3-methoxypropoxy) phenyl-4-methyl-1-penten-3-one (0.56g,1.9mmol) in THF (10M L) was added dropwise over 30min, the dropwise addition was complete, stirring was continued for 1h at 25 ℃, then 1M hydrochloric acid (10M L), ethyl acetate (20M L) and water (15M L) were added, the layers were allowed to settle, the aqueous phase was extracted with ethyl acetate (20M L), the combined organic phases were washed with a saturated sodium chloride solution, dried over anhydrous sodium sulfate, the oil EtOAc was filtered and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/V10/1) to afford the title compound as a pale yellow solid (95%).

MS(ESI,Pos.ion)m/z:307.2[M+H]⁺。

Step 4 1- (1- (4-methoxy-3- (3-methoxypropoxy) phenyl) cyclopropyl) -2-methyl-1-propylamine

1- (1- (4-methoxy-3- (3-methoxypropoxy) phenyl) cyclopropyl) -2-methyl-1-propanone (0.55g,1.8mmol) was dissolved in methanol (2m L) and ammonium acetate (0.97g,13mmol) was added thereto and, after addition, the resulting reaction mixture was stirred for a further 30min, then cooled to 0 ℃ and NaBH was added to the reaction mixture₃CN (230mg,3.660mmol), the reaction mixture was transferred to 25 ℃ and stirred for 20 h after completion of the reaction, concentrated by reduced pressure evaporation, the resulting residue was diluted with EtOAc (200m L) and then washed with saturated brine, and the organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound as a pale yellow oil (0.25g, 45%).

MS(ESI,Pos.ion)m/z:308.3[M+H]⁺。

And 5: n- (1- (1- (4-methoxy-3- (3-methoxypropoxy) phenyl) cyclopropyl) -2-methylpropyl) methyl Amides of carboxylic acids

1- (1- (4-methoxy-3- (3-methoxypropoxy) phenyl) cyclopropyl) -2-methyl-1-propylamine (400mg,1.301mmol) was dissolved in dioxane (10m L), and formic acid (2m L) was added thereto and the reaction mixture was heated under reflux for 21 hours after the completion of the reaction, the reaction solution was cooled to 50 ℃ and then concentrated under reduced pressure, then EtOAc (100m L) was added to the residue, which was washed with saturated brine, the organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound as a pale brown oil (0.32g, 73%)

MS(ESI,Pos.ion)m/z:336.3[M+H]⁺。

Step 6: 3' -isopropyl-7 ' -methoxy-6 ' - (3-methoxypropoxy) -3' H-spiro [ cyclopropyl-1, 4' -isoquinoline Quinoline (III)]

Dissolving N- (1- (1- (4-methoxy-3- (3-methoxypropoxy) phenyl) cyclopropyl) -2-methylpropyl) formamide (0.05g,0.15mmol) in acetonitrile (2m L), cooling the reaction solution to 0 ℃, adding phosphorus oxychloride (1m L, 10.73mmol), after the addition is finished, heating the reaction mixture to reflux, stirring for 2 hours, then cooling to 0 ℃, adding DCM (50m L) for dilution, slowly adding water (20m L), adjusting the pH of the obtained mixture to 7-8 with ammonia water, standing for layering, extracting the water layer with DCM (30m L× 2) again, washing the combined organic layers with saturated saline, drying over anhydrous sodium sulfate, filtering, and concentrating the filtrate under reduced pressure to obtain the title compound as a gray solid (0.020g, 42%)

MS(ESI,Pos.ion)m/z:318.2[M+H]⁺。

And 7: 6' -isopropyl-10 ' -methoxy-9 ' - (3-methoxypropoxy) -2' -oxo-1 ',2',6',11 b- Tetrahydropiro [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid ethyl ester

Adding 3' -isopropyl-7 ' -methoxy-6 ' - (3-methoxy propoxy) -3' H-spiro [ cyclopropyl-1, 4' -isoquinoline into a reaction bottle in sequence](70mg, 0.221mmol), ethyl 2- (ethoxymethylene) -3-oxo-butanoate (60mg,0.32mmol) and isopropanol (5m L), the reaction mixture was heated to reflux and stirred for 17 hours after which time it was concentrated under reduced pressure to give a residue which was passed through silica gelColumn chromatography (DCM/CH)₃OH (V/V) ═ 50/1) to give the title compound as a brown solid (30mg, 29.73%).

MS(ESI,Pos.ion)m/z:458.2[M+H]⁺。

And 8: 6 '-isopropyl-10' -methoxy-9 '- (3-methoxypropoxy) -2' -oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid ethyl ester

Ethyl 6 '-isopropyl-10' -methoxy-9 '- (3-methoxypropoxy) -2' -oxo-1 ',2',6',11b' -tetrahydrospiro [ cyclopropyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylate (80mg,0.17mmol) was added to DME (2m L) and, after stirring to homogeneity, tetrachlorobenzoquinone (42mg,0.17 mmol) was added and the reaction mixture was heated to reflux and stirred for 3 hours after the reaction was complete, concentrated by reduced pressure evaporation and the residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 50/1) to afford the title compound as a pale brown solid (50mg, 62.79%).

MS:(ESI,Pos.ion)m/z:456.2[M+H]⁺。

And step 9: 6 '-isopropyl-10' -methoxy-9 '- (3-methoxypropoxy) -2' -oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid

Mixing 6' -isopropyl-10 ' -methoxy-9 ' - (3-methoxypropoxy) -2' -oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-ethyl 3' -carboxylate (30mg,0.07mmol) was dissolved in methanol (1m L), and L iOH. H was added thereto₂O (14mg,0.33 mmol), the reaction mixture was stirred for 2 hours and then concentrated under reduced pressure, the resulting residue was diluted with water (30m L) and EtOAc (50m L), the pH was adjusted to 5-7 with concentrated hydrochloric acid, the mixture was allowed to stand for separation, the organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, isopropanol (2m L) was added to the resulting residue, and then sonication was carried out again, thenPost-filtration, the resulting filter cake was rinsed with isopropanol (1m L) to afford the title compound as an off-white solid (22mg, 71.03%).

MS(ESI,Pos.ion)m/z:428.2[M+H]⁺；

¹H NMR(400MHz,CDCl₃)16.15(s,1H),8.40(s,1H),7.23(s,1H),7.12(s,1H),6.60(s,1H),4.24-4.15(m, 2H),3.95(s,3H),3.60(t,2H),3.39(s,3H),2.99(d,1H),2.18-2.12(m,2H),1.97-1.88(m,1H),1.82-1.77(m, 1H),1.01(d,3H),0.92-0.85(m,2H),0.83(d,3H),0.64-0.59(m,1H)。

Example 2: 9'- (benzyloxy) -6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylic acid

Step 1: 2- (benzyloxy) -4-bromo-1-methoxybenzene

To a 250m L single neck flask was added 5-bromo-2-methoxyphenol (20.0g,98.5mmol), potassium carbonate (20.4g,148mmol), benzyl bromide (17.7g,103mmol) and acetone (200m L). the reaction mixture was heated to 65 ℃ and stirred for 6 h.

Step 2: 1- (3- (benzyloxy) -4-methoxyphenyl) -3-methyl-2-butanone

A 250m L one-necked flask was charged with 2- (benzyloxy) -4-bromo-1-methoxybenzene (11.80g,40.25mmol), 3-methyl-2-butanone (10.8m L, 101 mmol), sodium tert-butoxide (11.6g,121mmol), tetrahydrofuran (150m L), tris (dibenzylideneacetone) dipalladium (2.36g,4.02mmol) and 4, 5-bis-diphenylphosphino-9, 9-dimethylxanthene (2.5g,4.0 mmol). the mixture was replaced with nitrogen 3 times, then heated to 60 ℃ and stirred for 6h, and concentrated under reduced pressure to give a residue which was purified by silica gel column chromatography (PE/EA (V/V) ═ 20/1) to afford the title compound as a brown solid (7.37g, 24.7mmol, 61.4%).

MS(ESI,Pos.ion)m/z:299.4[M+H]⁺。

And step 3: 2- (3- (benzyloxy) -4-methoxyphenyl) -4-methyl-1-penten-3-one

Aqueous formaldehyde (11.0m L, 147mmol,37 mass%), aqueous dimethylamine (18.2m L, 147mmol, 40 mass%) and acetonitrile (120m L) were added to a 500m L single neck flask and sonicated for 20 minutes 1- (3- (benzyloxy) -4-methoxyphenyl) -3-methyl-2-butanone (11.0g, 36.9mmol) was dissolved in acetonitrile (200m L), the solution was slowly dropped into the reaction flask using a constant pressure dropping funnel while sonicating, after the completion of 30min dropping, sonication was continued for 16 hours, after the reaction was completed, the mixture was concentrated under reduced pressure, the residue was diluted with water (30m L), extracted with ethyl acetate (60m L × 3), the organic phases were combined, the combined organic phases were washed with a saturated sodium chloride solution (80m L), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) 20/1) to obtain the title compound as a pale yellow oil (24.65 g, 24.65 mmol).

MS(ESI,Pos.ion)m/z:311.2[M+H]⁺。

And 4, step 4:1- (1- (3- (benzyloxy) -4-methoxyphenyl) cyclopropyl) -2-methyl-1-pentanone

Dimethyl sulfoxide (10M L), trimethyl sulfoxide iodide (11g,49.939mmol), anhydrous tetrahydrofuran (30M L) and potassium tert-butoxide (5.4g,48mmol) were added to a 250M L two-necked flask, and the mixture was stirred at room temperature for 30 minutes under nitrogen protection, 2- (3- (benzyloxy) -4-methoxyphenyl) -4-methyl-1-penten-3-one (7.4g,24mmol) was dissolved in anhydrous tetrahydrofuran (30M L), the solution was added to the flask using a constant pressure dropping funnel, and the reaction mixture was stirred at room temperature for 1 hour, followed by addition of hydrochloric acid (1M,10M L), ethyl acetate (40M L) and water (15M L), followed by extraction and separation, the aqueous phase was extracted with ethyl acetate (40M L×), the organic phases were combined, the combined organic phases were washed with a saturated sodium chloride solution (40M L), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (V/EA) (V/20/1) as a pale yellow title compound (52 mmol).

MS(ESI,Pos.ion)m/z:325.1[M+H]⁺。

And 5: 1- (1- (3- (benzyloxy) -4-methoxyphenyl) cyclopropyl) -2-methyl-1-pentylamine

1- (1- (3- (benzyloxy) -4-methoxyphenyl) cyclopropyl) -2-methyl-1-pentanone (4.00g,12.3mmol), methanol (20M L) and ammonium acetate (6.65g,86.3mmol) were added to a 100M L single-neck flask, the mixture was stirred at room temperature for 1h, then sodium cyanoborohydride (2.39g,38.0 mmol) was added, the reaction mixture was heated to 80 ℃ and stirred for 24h, then concentrated under reduced pressure, water (10M L) was added, 1M hydrochloric acid was added to adjust the pH to 2-3, then ethyl acetate (10M L) was used for washing, the aqueous phase was retained, the aqueous phase was adjusted to a pH of greater than 12 with a potassium carbonate solution, extracted with ethyl acetate (50M L× 3), the organic phases were combined, the combined organic phases were washed with a saturated saline (30M L), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound as a colorless oil (4.0g,12mmol, 100%).

MS(ESI,Pos.ion)m/z:326.3[M+H]⁺。

Step 6: n- (1- (1- (3- (benzyloxy) -4-methoxyphenyl) cyclopropyl) -2-methylpentyl) formamide

1- (1- (3- (benzyloxy) -4-methoxyphenyl) cyclopropyl) -2-methyl-1-pentylamine (4.0g,12mmol) and ethyl formate (80m L) were added to a 250m L single-necked bottle the reaction mixture was heated to reflux for 24h, then concentrated under reduced pressure, the residue was diluted with saturated sodium bicarbonate solution (50m L), then extracted with ethyl acetate (50m L× 3), the organic phases were combined, the combined organic phases were washed with saturated sodium chloride solution (70m L), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound as a pale yellow oil (4.0g,11mmol, 92%).

MS(ESI,Pos.ion)m/z:354.1[M+H]⁺。

And 7: 6' - (benzyloxy) -3' -isopropyl-7 ' -methoxy-3 ' H-spiro [ cyclopropyl-1, 4' -isoquinoline]

N- (1- (1- (3- (benzyloxy) -4-methoxyphenyl) cyclopropyl) -2-methylpentyl) formamide (4.0g,11 mmol) and dichloromethane (80m L) were added to a 250m L single vial, the temperature was reduced to 0 ℃, phosphorus oxychloride (2.4m L, 26mmol) was added, the reaction mixture was moved to 40 ℃ and stirred for 12h, then concentrated under reduced pressure, the resulting residue was added with a saturated sodium bicarbonate solution (20m L) and dichloromethane (20m L), then stirred until no bubble was released, the liquid was separated, the aqueous phase was extracted with dichloromethane (20m L), the organic phases were combined, the combined organic phases were dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 20/1) to give the title compound as a yellow solid (2.1g,6.3 mmol, 55%).

MS(ESI,Pos.ion)m/z:336.3[M+H]⁺。

And 8: 9'- (benzyloxy) -6' -isopropyl-10 '-methoxy-2' -oxo-1 ',2',6',11b' -tetrahydrospiro [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid ethyl ester

6' - (benzyloxy) -3' -isopropyl-7 ' -methoxy-3 ' H-spiro [ cyclopropyl-1, 4' -isoquinoline ] (1.60g,4.77 mmol), ethyl 2- (ethoxymethylene) -3-oxo-butyrate (2.66g,14.3mmol) and dimethyl sulfoxide (15m L) were added to a 100m L single-neck flask, the reaction mixture was heated to 120 ℃ and stirred for 12H, then ethyl acetate (50m L) and water (30m L) were added in order to dilute, stir, separate, extract the aqueous phase with ethyl acetate (30m L), combine the organic phases, wash the combined organic phases with water (40m L× 3), dry over anhydrous sodium sulfate, filter and concentrate under reduced pressure to give the title compound as a brown oil which was used in the next reaction without purification.

MS(ESI,Pos.ion)m/z:476.2[M+H]⁺。

And step 9: 9'- (benzyloxy) -6' -isopropyl-10 '-methoxy-2' -oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -Carboxylic acid ethyl ester

To a 100m L one-necked flask was added 9'- (benzyloxy) -6' -isopropyl-10 '-methoxy-2' -oxo-1 ',2',6',11b' -tetrahydrospiro [ cyclopropyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylic acid ethyl ester (500mg,1.05mmol), 2,3,5, 6-tetrachloro-1, 4-benzoquinone (248mg,1.01mmol) and ethylene glycol dimethyl ether (8m L). the reaction mixture was heated to 100 ℃ stirred for 4h, then cooled to room temperature and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 10/1) to give the title compound as a tan solid (300mg,0.6334mmol, 60.25%).

MS(ESI,Pos.ion)m/z:474.2[M+H]⁺。

Step 10: 9'- (benzyloxy) -6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid

To a 50M L one-necked flask was added ethyl 9'- (benzyloxy) -6' -isopropyl-10 '-methoxy-2' -oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylate (40mg,0.08446mmol), methanol (4M L) and lithium hydroxide monohydrate (17mg,0.41 mmol). the reaction mixture was stirred at room temperature for 12h, then 1M hydrochloric acid was added to adjust the pH to 2-3, then concentrated under reduced pressure, and the residue was purified by thin layer chromatography (DCM/MeOH (V/V) ═ 10/1) to afford the title compound as a pale gray solid (20mg,0.045mmol,98.39 mass%).

MS(ESI,Pos.ion)m/z:446.20[M+H]⁺；

¹H NMR(400MHz,CDCl₃)16.13(s,1H),8.41(s,1H),7.45(d,J＝6.9Hz,2H),7.41(t,J＝7.2Hz,2H),7.35 (t,J＝7.0Hz,1H),7.25(s,1H),7.13(s,1H),6.57(s,1H),5.23(s,2H),3.97(s,3H),2.98(d,J＝9.6Hz,1H), 1.88(d,J＝9.1Hz,1H),1.65(d,J＝8.5Hz,1H),1.23(s,1H),0.94(d,J＝6.7Hz,3H),0.91–0.84(m,1H), 0.82(d,J＝6.7Hz,3H),0.54(s,1H)。

Example 3: 9'- (cyclopropylmethoxy) -6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylic acid

Step 1: 9 '-hydroxy-6' -isopropyl-10-methoxy-2 '-oxo-2', 6 '-dihydrospiro [ cyclopropane-1, 7' Pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid ethyl ester

Adding 9'- (benzyloxy) -6' -isopropyl-10 '-methoxy-2' -oxo-2 ',6' -dihydrospiro [ cyclopropyl-1, 7 '-pyridine [2,1-a ] isoquinoline ] -3' -carboxylic acid ethyl ester (150mg,0.3167mmol), methanol (10m L), palladium carbon (150mg,10 mass%), exchanging hydrogen for 4 times, stirring under a hydrogen balloon at room temperature for 8 hours, post-treating, filtering with diatomaceous earth to remove the palladium carbon, washing the filter cake with 10m L methanol, and concentrating the solvent under vacuum to obtain a brown solid (80mg, 66% Yield)

MS-ESI:(ESI,Pos.ion)m/z:384.3[M+H]⁺

Step 2: 9' - (cyclopropylmethoxy) -6' -isopropyl-10-methoxy-2-oxo-9 ' -2',6' -dihydrospiro [ ring Propyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid ethyl ester

In a single vial was added ethyl 9 '-hydroxy-6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropylalkyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylate (100mg,0.26mmol), DMF (2m L), potassium carbonate (108mg,0.78mmol) and bromomethylcyclopropane (88mg, 0.65mmol) the reaction mixture was stirred at room temperature for 8h, then water (10m L) and ethyl acetate (20m L) were added and the aqueous phase was extracted with ethyl acetate (20m L), the organic phases were combined, the combined organic phases were washed with half-saturated sodium chloride solution (40m L× 2), dried over anhydrous sodium sulfate, concentrated under reduced pressure and the residue was purified by thin layer chromatography (DCM/MeOH (V/V) ═ 10/1) to afford the title compound as a yellow solid (100mg, 90%).

MS(ESI,pos.ion)m/z:438.2[M+H]⁺。

And step 3: 9'- (cyclopropylmethoxy) -6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropyl Alkyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid

In a 50m L single neck flask was added 9' - (cyclopropylmethoxy) -6' -isopropyl-10-methoxy-2-oxo-9 ' -2',6' -dihydrospiro [ cyclopropanyl-1, 7' -pyrido [2,1-a ] isoquinoline ] -3' -carboxylic acid ethyl ester (100mg,0.23mmol), methanol (2m L) and lithium hydroxide monohydrate (30mg,0.7mmol) the reaction mixture was stirred at room temperature for 12h, then water (10m L) and ethyl acetate (20m L) were added to dilute, extract the liquid, the aqueous phase was extracted with ethyl acetate (20m L), the organic phases were combined, the combined organic phases were washed with sodium chloride solution (20m L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the residue was purified by thin layer chromatography (DCM/MeOH (V/V) ═ 10/1) to afford the title compound as a solid (50mg, 50%).

MS(ESI,pos.ion)m/z:410.20[M+H]⁺；

¹H NMR(400MHz,CDCl₃)16.18(s,1H),8.43(s,1H),7.24(s,1H),7.13(s,1H),6.53(s,1H),3.96(s,3H), 3.93(dd,J＝7.0,2.1Hz,2H),3.03(d,J＝9.6Hz,1H),1.91(m,1H),1.77(d,J＝8.9Hz,2H),1.40–1.31(m, 1H),1.00(d,J＝6.7Hz,3H),0.90(d,J＝5.8Hz,1H),0.83(d,J＝6.7Hz,3H),0.76–0.67(m,2H),0.60(s,1H), 0.41(d,J＝5.0Hz,2H)。

Example 4: 9 '-isobutoxy-6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropane-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylic acid

Step 1: 9 '-isobutoxy-6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropylalkyl-1, 7' pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid ethyl ester

In a single vial was added ethyl 9 '-hydroxy-6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropylalkyl-1, 7 'pyrido [2,1-a ] isoquinoline ] -3' -carboxylate (100mg,0.26mmol), DMF (2m L), potassium carbonate (108mg,0.781mmol) and 1-iodo-2-methylpropane (0.05m L, 0.4 mmol). the reaction mixture was stirred at room temperature for 8h, then water (10m L) and ethyl acetate (20m L) were added, the extract was separated, the aqueous phase was extracted with ethyl acetate (20m L), the organic phases were combined, the combined organic phases were washed with half-saturated sodium chloride solution (40m L× 2), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by thin layer chromatography (DCM/MeOH (V/V) ═ 10/1) to give the title compound as a yellow solid (90mg, 80%).

MS(ESI,pos.ion)m/z:440.3[M+H]⁺。

Step 2: 9 '-isobutoxy-6' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropylalkyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid

Adding 9' -isobutoxy-6 ' -isopropyl-10-methoxy-2-oxo-2 ',6' -dihydrospiro [ cyclopropane-1, 7' pyrido [2,1-a ] into a 50m L single-neck bottle]Isoquinoline derivatives]-ethyl 3' -carboxylate (0.10g,0.23mmol), MeOH (2m L), and L iOH.H₂O (30mg,0.7 mmol.) the reaction mixture was stirred at room temperature for 12h, then diluted with water (10m L) and ethyl acetate (20m L), extracted for liquid separation, the aqueous phase was extracted with ethyl acetate (20m L), the organic phases were combined, the combined organic phases were washed with half-saturated sodium chloride solution (40m L× 2), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by thin layer chromatography (DCM/MeOH (V/V) ═ 10/1) to afford the title compound as a pale yellow solid (50mg, 50%).

MS(ESI,pos.ion)m/z:412.3[M+H]⁺；

¹H NMR(400MHz,CDCl₃)16.18(s,1H),8.43(s,1H),7.24(s,1H),7.13(s,1H),6.53(s,1H),3.95(s,3H), 3.82(t,J＝6.5Hz,2H),3.01(d,J＝9.7Hz,1H),2.27(m,1H),1.99(m,1H),1.79(m,1H),1.65(m,1H),1.08 (dd,J＝6.7,1.8Hz,6H),1.01(d,J＝6.8Hz,3H),0.90(t,J＝6.7Hz,1H),0.83(d,J＝6.7Hz,3H),0.62(m,

1H)。

Example 5: 6 '-isopropyl-9' - (3-methoxypropoxy) -2 '-oxo-10' - (2-thiazolyl) -2',6' -dihydrospiro [ cyclopropyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylic acid

Step 1: 4-bromo-2-hydroxythiophenylamide

Ethanol (50m L) was added to a 250m L one-neck flask, and then P was slowly added₂S₅(11.2g,50.4mmol) was dissolved with stirring, 4-bromo-2-hydroxy-phenylacetonitrile (5.00g,25.2mmol) was then added and the reaction mixture was heated to 100 ℃ under reflux for 12h, after completion of the reaction, the mixture was cooled to room temperature and then slowly added to a cake with ice water (200m L) and stirred until a solid precipitated,suction filtration was again carried out to give the title compound as a yellow solid (5.5 g, 94%).

MS(ESI,pos.ion)m/z:232.05[M+H]⁺。

Step 2: 5-bromo-2- (2-thiazole) phenol

In a single neck flask was added 4-bromo-2-hydroxythiobenzamide (6.00g,25.9mmol), ethanol (240m L), water (0.93g,52mmol), 2-bromo-1, 1-dimethoxy-ethane (4.8g,28mmol) and p-methylbenzenesulfonic acid (0.492g,2.59mmol), and the mixture was heated to 100 ℃ under reflux for 12h and then concentrated under reduced pressure to give the title compound as a yellow solid (6.50g, 98.2%).

MS(ESI,pos.ion)m/z:256.0[M+H]⁺。

And step 3: 2- (4-bromo-2- (3-methoxypropoxy) phenyl) thiazole

In a single vial 5-bromo-2- (2-thiazole) phenol (6.50g,25.4mmol), potassium carbonate (7.02g,50.8mmol), DMF (30m L) and 1-bromo-3-methoxypropane (4.66g,30.5mmol) were added, the reaction mixture was heated to 90 ℃ and stirred for 3h, then water (20m L) was added to dilute, followed by extraction with ethyl acetate (30m L× 2), the organic phases combined, the combined organic phases washed with saturated sodium chloride solution (50m L× 2), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 10/1) to afford the title compound as a yellow oil (7.5g, 90%).

MS(ESI,pos.ion)m/z:327.95[M+H]⁺。

And 4, step 4:1- (3- (3-Methoxypropoxy) -4- (2-thiazole) phenyl) -3-methylbutyl-2-one

Adding 2- (4-bromo-2- (3-methoxypropoxy) into a single-mouth bottle) Phenyl) thiazole (5.70g,17.4mmol), 3-methyl-2-butanone (1.94g, 22.5mmol), sodium tert-butoxide (3.34g,34.8mmol), dioxane (50M L), tris (dibenzylideneacetone) dipalladium (1.02g,1.74mmol) and XantPhos (1.04mg,0.00174mmol), the mixture was exchanged with nitrogen 3 times, then heated to 90 ℃ and stirred for 5H, after completion of the reaction, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 10/1) to give the title compound as a pale yellow oil (4.65g, 80.3%). MS (ESI, pos.ion) M/z 334.3[ M + H ═ 10/1%]⁺。

And 5: 2- (3- (3-Methoxypropoxy) -4- (2-thiazole) phenyl) -4-methylpentyl-1-en-3-one

Aqueous formaldehyde (4.18m L, 55.8mmol, 37%), aqueous dimethylamine (6.9m L, 56mmol, 40%) and acetonitrile (70m L) were added to a single vial and sonicated for 20 minutes 1- (3- (3-methoxypropoxy) -4- (2-thiazole) phenyl) -3-methylbutyl-2-one (4.65g,13.9mmol) was dissolved in acetonitrile (70m L), the solution was slowly dropped into the vial using a constant pressure dropping funnel with sonication for 30 minutes, the resulting mixture was sonicated for 9 hours and then concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (PE/EA (V/V) 10/1) to give the title compound as a pale yellow oil (3.60g, 74.7%).

MS(ESI,pos.ion)m/z:346.3[M+H]⁺。

Step 6:1- (1- (3- (3-methoxypropoxy) -4- (2-thiazole) phenyl) cyclopropyl) -2-methylpropyl-1-one

Dimethyl sulfoxide (5M L), trimethyl sulfoxide iodide (4.59g,20.8mmol), tetrahydrofuran (30M L) and potassium tert-butoxide (2.34g,20.9mmol) were added to a two-necked flask, and stirred at room temperature under nitrogen for 20 minutes, 2- (3- (3-methoxypropoxy) -4- (2-thiazole) phenyl) -4-methylpentyl-1-en-3-one (3.60g,10.4mmol) was dissolved in tetrahydrofuran (30M L), the solution was added to the flask using a constant pressure dropping funnel, and the addition was completed for 30 minutes, the resulting mixture was stirred at room temperature for 0.5h, after completion of the reaction, the reaction mixture was diluted with hydrochloric acid (1M,80M L) and ethyl acetate (40M L), liquid separation was extracted, the aqueous phase was extracted with ethyl acetate (40M 2), the combined organic phases were washed with a saturated sodium chloride solution (40M L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (EA/PE) to obtain a pale yellow title compound 10/1/1.3876 g).

MS(ESI,pos.ion)m/z:360.3[M+H]⁺。

And 7: 1- (1- (3- (3-methoxypropoxy) -4- (2-thiazole) phenyl) cyclopropyl) -2-methylpropyl-1-amine

1- (1- (3- (3-methoxypropoxy) -4- (2-thiazole) phenyl) cyclopropyl) -2-methylpropyl-1-one (3.28g,9.12 mmol), methanol (20M L) and ammonium acetate (3.52g,45.7mmol) were added to a single vial, the mixture was stirred at room temperature for 1h, then sodium cyanoborohydride (1.72g,27.4mmol) was added at 0 ℃, then heated to 70 ℃ and stirred for 12h after reaction was complete, the reaction mixture was added to water (10M L), 1M hydrochloric acid was added to adjust the pH to 2-3, then ethyl acetate (10M L) was used for extraction, the aqueous phase was adjusted to a pH of greater than 12 with potassium carbonate solution and then extracted with ethyl acetate (50M L× 3), the organic phases were combined, the combined organic phases were washed with saturated brine (30M L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give the title compound as a colorless oil (3.2g, 97%) which was directly charged to the next step without purification.

And 8: n- (1- (1- (3- (3-methoxypropoxy) -4- (2-thiazole) phenyl) cyclopropane) -2-methylpropane Yl) carboxamides

1- (1- (3- (3-methoxypropoxy) -4- (2-thiazole) phenyl) cyclopropyl) -2-methylpropyl-1-amine (3.20g,8.88 mmol) and ethyl formate (15m L) were added to a single vial, heated to reflux with stirring for 12h, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA/DCM (V/V) ═ 3/1/1) to give the title compound as a pale yellow oil (1.82g, 52.8%).

MS(ESI,pos.ion)m/z:389.3[M+H]⁺。

And step 9: 2- (3 '-isopropyl-6' - (3-methoxypropoxy) -3 'H-spiro [ cyclopropane-1, 4' -isoquinoline]-7'- Yl) thiazole

N- (1- (1- (3- (3-methoxypropoxy) -4- (2-thiazole) phenyl) cyclopropane) -2-methylpropyl) carboxamide (0.050g, 0.13mmol) and dichloromethane (1M L) were added to a double-neck flask, nitrogen exchange was carried out 3 times, oxalyl chloride (0.012M L, 0.14mmol) was added at room temperature, after stirring for 30 minutes, the bath was cooled to-15 ℃ and ferric trichloride (0.025g,0.15mmol) was added, the mixture was stirred at room temperature for 12 hours, 1M hydrochloric acid (10M L) was added and stirred at room temperature for 1 hour, then dichloromethane was used for extraction (20M L), the organic phase was washed with a saturated sodium chloride solution (20M L), anhydrous sodium sulfate was dried, and concentrated under reduced pressure to give a gray solid, the gray solid obtained was dissolved with methanol (15M L), then (0.5M L) was added, heating was stirred under reflux for 10 hours, then a saturated sodium carbonate solution (10M L) was added to dilute the dichloromethane (20M L), the solid was filtered under reduced pressure to give the title compound, concentrated sodium sulfate was filtered and dried to give a gray solid.

MS(ESI,pos.ion)m/z:371.3[M+H]⁺。

Step 10: 6' -isopropyl-9 ' - (3-methoxypropoxy) -2' -oxo-10 ' - (2-thiazole) -1',2',6', 11b '-Tetrahydropyrido [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid ethyl ester

2- (3' -isopropyl-6 ' - (3-methoxypropoxy) -3' H-spiro [ cyclopropane-1, 4' -isoquinolin ] -7' -yl) thiazole (0.10g,0.27 mmol), ethyl 2- (acetylether) -3-acetoacetate (0.10g,0.54mmol) and tert-butanol (3m L) were added to a single vial, the reaction was heated to 90 ℃ and stirred for 8H, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 1/1) to afford the title compound as a brown oil (0.10g, 73%).

MS(ESI,pos.ion)m/z:511.4[M+H]⁺。

Step 11: 6 '-isopropyl-9' - (3-methoxypropoxy) -2 '-oxo-10' - (2-thiazole) -2',6' -dihydro Spiro [ cyclopropane-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid ethyl ester

Ethyl 6 '-isopropyl-9' - (3-methoxypropoxy) -2 '-oxo-10' - (2-thiazole) -1',2',6',11b' -tetrahydropyrido [ cyclopropyl-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylate (0.250g,0.490mmol), tetrachlorobenzoquinone (0.241g,0.980mmol) and DME (5m L) were added to a single vial, the reaction was heated to 80 ℃ and stirred for 3h, then concentrated under reduced pressure, and the resulting residue was purified by thin layer chromatography (DCM/MeOH (V/V) ═ 12/1) to afford the title compound as a yellow solid (0.101g, 40.6%).

MS(ESI,pos.ion)m/z:509.4[M+H]⁺。

Step 12: 6 '-isopropyl-9' - (3-methoxypropoxy) -2 '-oxo-10' - (2-thiazolyl) -2',6' -bis Hydrospiro [ cyclopropyl-1, 7' -pyrido [2,1-a ]]Isoquinoline derivatives]-3' -carboxylic acid

Ethyl 6 '-isopropyl-9' - (3-methoxypropoxy) -2 '-oxo-10' - (2-thiazole) -2',6' -dihydro [ cyclopropane-1, 7 '-pyrido [2,1-a ] isoquinoline ] -3' -carboxylate (0.065g,0.13mmol), methanol (2M L) and lithium hydroxide monohydrate (0.027g,0.64mmol) were added to a single vial, the reaction was stirred at room temperature for 3h, then 1M hydrochloric acid was added dropwise to the reaction solution to pH 6, followed by extraction with dichloromethane (20M L), the organic phase was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 12/1) to give the title compound as a gray solid (0.06g, 95%).

MS(ESI,pos.ion)m/z:481.18[M+H]⁺；

¹H NMR(400MHz,CDCl₃)16.31(s,1H),8.93(s,1H),8.49(s,1H),7.96(d,J＝2.8Hz,1H),7.46(d,J＝2.8 Hz,1H),7.36(s,1H),6.75(s,1H),4.41–4.36(m,2H),3.70(t,J＝5.7Hz,2H),3.39(s,3H),3.16(d,J＝9.6 Hz,1H),2.31–2.28(m,2H),1.90(s,2H),1.02(d,J＝6.5Hz,3H),0.82(d,J＝6.5Hz,3H),0.71(s,1H)。

Example 6: 6-isopropyl-10-methoxy-9- (3-methoxypropoxy) -7, 7-dimethyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid

Step 1: 1- (4-methoxy-3- (3-methoxypropoxy) phenyl) -3-methyl-2-butanone

To a reaction flask were added 4, 5-bis-diphenylphosphine-9, 9-dimethylxanthene (0.21g,0.36mmol), 4-bromo-1-methoxy-2- (3-methoxy) benzene (1.0g,3.6mmol), 3-methyl-2-butanone (0.47g,5.5mmol), sodium tert-butoxide (0.7g,7mmol), 1, 4-dioxane (20m L), and tris (dibenzylideneacetone) dipalladium (0.21g,0.36mmol), the mixture was replaced with nitrogen 3 times, then heated to 100 ℃ and stirred for 10h after the reaction was completed, the reaction mixture was diluted with water (10m L), then extracted with ethyl acetate (20m L× 3), the combined organic phases were washed with a saturated sodium chloride solution (30m L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 10/1) to obtain the title compound as a pale yellow solid (0.386 g, 386%).

MS(ESI,Pos.ion)m/z:281.3[M+H]⁺。

Step 2: 2- (4-methoxy-3- (3-methoxypropoxy) phenyl-4-methyl-3-pentanone

1- (4-methoxy-3- (3-methoxypropoxy) phenyl) -3-methyl-2-butanone (5.0g,17.83mmol) and THF (40m L) were added to a 100m L two-necked flask, the mixture was nitrogen exchanged 3 times, then cooled to 0 ℃ and sodium cyanide (2.5g,63mmol,60 mass%) was added in portions under nitrogen protection and stirred for 0.5h, iodomethane (3.3m L, 53.5mmol) was further added dropwise at 0 ℃, after completion of the dropwise addition, the resulting mixture was kept at 0 ℃ and stirred for 1h, after completion of the reaction, methanol (2m L) was added to quench the reaction, ammonium chloride solution (20m L) and ethyl acetate (50m L) were added to dilute the extract, separate the liquid, the aqueous phase was extracted with ethyl acetate (20m L), the organic phases were combined, the combined organic phases were washed with saturated sodium chloride solution (40m L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give the title compound as a colorless oil (5.2g, 99.1.1.99%).

MS(ESI,pos.ion)m/z:295.1[M+H]⁺。

And step 3: 2- (4-methoxy-3- (3-methoxypropoxy) phenyl) -2, 4-dimethyl-3-pentanone

2- (4-methoxy-3- (3-methoxypropoxy) phenyl-4-methyl-3-one (5.2g,17.7mmol) and THF (40m L) were added to a 250m L double neck flask, cooled to 0 deg.C, and NaHMDS (12.7m L, 25.4mmol,2 mol/L) was added, after stirring for 0.5h, iodomethane (2.2m L, 35 mmol) was slowly added to the reaction flask, the mixture was stirred at 0 deg.C for 1h, then saturated ammonium chloride solution (20m L) and water (20m L) were added, followed by extraction with ethyl acetate (40m L× 2), the combined organic phases were washed with saturated sodium chloride solution (40m L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) 20/1) to give the title compound as a yellow oil (5.04g, 92.5%).

MS(ESI,pos.ion)m/z:309.1[M+H]⁺。

And 4, step 4: 2- (4-methoxy-3- (3-methoxypropoxy) phenyl) -2, 4-dimethyl-3-pentanone oxime

In a 100m L single neck bottle 2- (4-methoxy-3- (3-methoxypropoxy) phenyl) -2, 4-dimethyl-3-pentanone (4.20g,13.62 mmol), pyridine (20m L, 248mmol) and hydroxylamine hydrochloride (4.73g,68.1mmol) were added the mixture was heated to 130 ℃ and stirred for 24h, then concentrated under reduced pressure the residue was diluted with water (20m L) and extracted with ethyl acetate (50m L× 3), the organic phases combined and the combined organic phases washed with saturated brine (30m L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give the title compound as a colorless oil (2.4g, 54.5%).

MS(ESI,pos.ion)m/z:324.3[M+H]⁺。

And 5: 2- (4-methoxy-3- (3-methoxypropoxy) phenyl) -2, 4-dimethyl-3-pentylamine

After the mixture of 2- (4-methoxy-3- (3-methoxypropoxy) phenyl) -2, 4-dimethyl-3-pentanone oxime (1.40g,4.33mmol), methanol (20m L), and raney nickel (2.0g) was replaced with hydrogen three times in an autoclave, and then heated to 60 ℃ under a hydrogen atmosphere of 2.8MPa and stirred for 12 h.

MS(ESI,pos.ion)m/z:310.2[M+H]⁺。

Step 6: n- (2- (4-methoxy-3- (3-methoxypropoxy) phenyl) -2, 4-dimethylpentyl-3-yl) formyl Amines as pesticides

2- (4-methoxy-3- (3-methoxypropoxy) phenyl) -2, 4-dimethyl-3-pentylamine (1.0g,3.2mmol) and 1, 4-dioxane (10m L) were added to a single vial, the mixture was heated under reflux for 8h, after completion of the reaction, concentrated under reduced pressure, the residue was diluted with saturated sodium bicarbonate solution (50m L) and then extracted with ethyl acetate (50m L× 3), the organic phases were combined, the combined organic phases were washed with saturated sodium chloride solution (70m L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give the title compound as a pale yellow oil (1.0g, 92%).

MS(ESI,pos.ion)m/z:338.1[M+H]⁺。

And 7: 3-isopropyl-7-methoxy-6- (3-methoxypropoxy) -4, 4-dimethyl-3, 4-dihydroisoquinoline

N- (2- (4-methoxy-3- (3-methoxypropoxy) phenyl) -2, 4-dimethylpentyl-3-yl) carboxamide (2.6g, 7.71mmol) and acetonitrile (30m L) were added to a 50m L single vial, the mixture was cooled to 0 ℃ in a cold bath, phosphorus oxychloride (2.2m L, 24mmol) was added, then heated to 60 ℃ and stirred for 24 hours after the reaction was complete, the reaction mixture was cooled to 0 ℃ in an ice bath, then water (10m L) was added and stirred, then dichloromethane (20m L× 2) was used for extraction, the combined organic phases were washed with saturated sodium chloride solution (20m L), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 20/1) to give the title compound as a tan viscous mass (1.0g, 40.6%).

MS(ESI,pos.ion)m/z:320.3[M+H]⁺。

And 8: 6-isopropyl-10-methoxy-9- (3-methoxypropoxy) -7, 7-dimethyl-2-oxo-2, 6,7, 11 b-tetrahydro-1H-pyrido [2,1-a]Isoquinoline-3-acetic acid ethyl ester

In a 50m L one-necked flask were charged 3-isopropyl-7-methoxy-6- (3-methoxypropoxy) -4, 4-dimethyl-3, 4-dihydroisoquinoline (0.3g,0.94 mmol), ethyl 2- (acetylether) -3-acetoacetate (0.37g,2.0mmol) and t-butanol (3m L), the mixture was heated to 90 ℃ and stirred for 10h, after completion of the reaction, the reaction mixture was diluted with a half-saturated sodium chloride solution (10m L), followed by extraction with ethyl acetate (20m L× 2), the organic phases were combined, the combined organic phases were washed with a half-saturated sodium chloride solution (20m L× 3), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 20/1) to give the title compound as a brown black oil (0.27g, 63%).

MS(ESI,pos.ion)m/z:460.2[M+H]⁺。

And step 9: 6-isopropyl-10-methoxy-9- (3-methoxypropoxy) -7, 7-dimethyl-2-oxo-6, 7-di hydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid ethyl ester

To a 25m L single neck flask was added ethyl 6-isopropyl-10-methoxy-9- (3-methoxypropoxy) -7, 7-dimethyl-2-oxo-2, 6,7,11 b-tetrahydro-1H-pyrido [2,1-a ] isoquinoline-3-acetate (0.22g,0.48mmol), tetrachlorobenzoquinone (0.14g,0.57mmol) and DME (6m L). the reaction mixture was heated to 100 ℃ stirred for 2H and then concentrated under reduced pressure and the resulting residue was purified by thin layer chromatography (DCM/MeOH (V/V) ═ 20/1) to afford the title compound as a yellow solid (0.20g, 91%).

MS(ESI,Pos.ion)m/z:458.4[M+H]⁺。

Step 10: 6-isopropyl-10-methoxy-9- (3-methoxypropoxy) -7, 7-dimethyl-2-oxo-6, 7-di hydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid

In a 50m L one-necked flask was added ethyl 6-isopropyl-10-methoxy-9- (3-methoxypropoxy) -7, 7-dimethyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (65mg,0.142mmol), MeOH (2m L) and lithium hydroxide monohydrate (35mg,0.83mmol) the mixture was stirred at room temperature for 5H, then water (10m L) and ethyl acetate (20m L) were added in sequence, the extract was partitioned, the aqueous phase was extracted with ethyl acetate (20m L), the organic phases were combined, the combined organic phases were washed with half-saturated sodium chloride solution (40m L× 2), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by thin layer chromatography (DCM/MeOH (V/V) ═ 10/1) as pale yellow to afford the title compound as a solid (20mg, 33%).

MS(ESI,Pos.ion)m/z:410.1976[M+H]⁺；

¹H NMR(400MHz,CDCl₃)16.08(s,1H),8.43(s,1H),7.17(s,1H),7.09(s,1H),6.91(s,1H),4.22(t,J＝6.5 Hz,2H),3.94(s,3H),3.70(d,J＝3.9Hz,1H),3.61(t,J＝5.9Hz,2H),3.39(s,3H),2.15(dd,J＝12.5,6.3Hz, 3H),1.58(s,3H),1.18(s,3H),1.06(d,J＝6.8Hz,3H),0.34(d,J＝6.9Hz,3H)。

Biological activity assay

HBV cell line

HepG2.2.15 cells (SE LL S, PNAS,1987and SE LL S, JV,1988) have the complete HBV genome integrated into their chromosomes and stably express viral RNA and viral proteins HepG2.2.15 cells are capable of secreting mature hepatitis B virus particles into the culture medium and virion DNA and HBsAg secreted by HepG2.2.15 cells can be quantified by qPCR and the E L ISA method, and the effect of compounds on viral replication and HBsAg secretion is thereby examined.

Test 1: inhibition of HBV viral replication by Compounds of the invention

HepG2.2.15 cells 8,000 cells per well were seeded into 96-well cell culture plates in duplicate and cultured for 3 days until the cells grew to full well. Cells were treated with 4-fold serial dilutions of compounds for 10 days, dosed every other day with a final concentration of 0.5% DMSO in all wells and DMSO was used as no drug control. Supernatants were harvested on day 11 for quantitative detection of HBV DNA.

The qPCR method is used For detecting virus genome DNA, primers are HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA, HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC, SYBR Premix Ex Taq II-Takara DRR081S is used, 1 mu L cell culture supernatant is used as a template, a plasmid containing HBV genome is used as a standard curve, the standard curve is used For calculating virus copy number, Graphpad Prism 5 software is used For processing concentration-virus copy number, and a four-parameter nonlinear regression model is used For calculating compound-to-virus genome DNACopy-inhibited IC₅₀。

And (4) conclusion: the inhibition experiment of the compound of the invention on HBV virus replication shows that the compound of the invention has IC of HBV DNA replication inhibition activity₅₀IC of replication inhibitory Activity of most Compounds on HBV DNA less than 0.5. mu. mol₅₀Less than 0.1. mu. mol.

Table 2: inhibitory Activity of partial Compounds on replication of HBV DNA

Examples	IC50(nmol)	Examples	1C50(nmol)
				Example 1	23.65	Example 2	39.09
Example 3	20.95	Example 4	38.35
				Example 5	3.99

And (3) testing 2: inhibition of HBsAg secretion by Compounds of the invention

HepG2.2.15 cells 8,000 cells per well were seeded into 96-well cell culture plates in duplicate and cultured for 3 days until the cells grew to full well. Cells were treated with 4-fold serial dilutions of compounds for 10 days, dosed every other day with a final concentration of 0.5% DMSO in all wells and DMSO was used as no drug control. Supernatants were harvested on day 11 for HBsAg quantification.

Detecting the level of HBsAg secreted by cells after compound treatment using the E L ISA method using hepatitis B surface antigen diagnostic kit (Shanghai Kehua bioengineering, Inc. S10910113.) 25 μ L test supernatants (PBS diluted to 75 μ L) were added to each well of E L ISA plate, with positive and negative controls of the kit being set, after E L ISA plate was sealed with mounting paper, incubation was carried out at 37 ℃ for 60 minutes, E L ISA plate was removed, mounting of 50 μ L enzyme conjugate was removed, shaking was carried out on the shaker for 10 seconds, E L ISA plate was sealed with mounting paper, incubation was carried out at 37 ℃ for 30 minutes, E L ISA plate was removed, mounting of sealing paper was carried out repeatedly 5 times, liquid in each well was discarded, wells was filled with washing solution, standing for 60 seconds, spin-drying was carried out, liquid was left on blotting paper, after washing was completed, freshly prepared developer A and B was added to all wells immediately, then the sealing solution was added to each well, the HBsAg concentration of freshly prepared developer A and dye was read on 100 μ 35, the sealing solution, and the sealing solution was read by means of linear shaking was carried out on the HBsAg meter, the meter reading was carried out at 30 minutes, the meter reading was carried out by means, the meter reading was carried out at 30 minutes, the meter reading the meter was carried out at 30 minutes, the meter was carried out by means, the₅₀。

And (4) conclusion: the compound of the invention has an inhibition experiment on HBsAg secretion. IC for inhibitory Activity of Compounds of the present invention against HBsAg secretion₅₀IC of inhibitory Activity of most Compounds on HBsAg secretion less than 0.5. mu. mol₅₀Less than 0.1. mu. mol.

Table 3: inhibitory Activity of partial Compounds on HBsAg secretion

And (3) testing: pharmacokinetic experiments of the compounds of the invention in beagle dogs, mice and rats

(1) Beagle PK test experiment

The compound of the invention is used for PK determination experiment in beagle dogs which are 10-12kg in weight, male age and 10-12 months, 3 per group are orally taken, 3 per group are intravenously injected and) in vivo

The experimental method comprises the following steps:

beagle dogs were administered 2.5mg/kg or 5mg/kg by oral gavage or 1mg/kg or 2mg/kg by intravenous injection of the test compound.

Blood was collected intravenously at time points (0.083, 0.25, 0.5, 1,2,4, 6, 8 and 24 hours) after administration and collected at the time of EDTA-K addition₂In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.

And (4) conclusion: the pharmaceutical experiment data show that the compound has better pharmacokinetic property in beagle dogs and has good application prospect in the aspect of anti-HBV.

(2) Mouse PK assay:

PK assay experiment of the compound of the present invention in mice (body weight 20-25g, male, age 45-60 days, 3 per group orally, 3 per group intravenously)

The experimental method comprises the following steps:

ICR mice were orally gavaged with 10mg/kg or injected via the tail vein with 2mg/kg or 10mg/kg of the test compound. Blood was collected at time points (0.083, 0.25, 0.5, 1,2,4, 6, 8 and 24 hours) from the orbital vein after administration and collected by adding EDTA-K₂In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.1 software.

And (4) conclusion: the data of the drug-induced experiment show that the compound has better pharmacokinetic property in mice and has good application prospect in the aspect of anti-HBV.

(3) SD rat PK assay:

PK assay experiment of the compound of the present invention in SD rats (body weight 200-

The experimental method comprises the following steps:

rats were dosed either 2.5mg/kg or 5mg/kg per oral gavage or 1mg/kg per intravenous injection of the test compound.

Blood was collected intravenously at time points (0.083, 0.25, 0.5, 1,2,5, 7and 24 hours) after administration and collected by adding EDTA-K₂In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.

And (4) conclusion: the pharmaceutical experiment data show that the compound has better pharmacokinetic property in SD rats and has good application prospect in the aspect of anti-HBV.

And (4) testing: stability testing of Compounds of the invention in liver microsomes of different species

Liver microsome stability test of the Compounds of the invention in different species

The experimental method comprises the following steps:

adding 30 mu L of mixed solution of blank solution and liver microsome into a 96-well plate, adding 15 mu L of buffer solution containing a compound to be detected into each well, preparing two samples in parallel, pre-incubating at 37 ℃ for 10min, adding 15 mu L NADPH solution (8mM) according to time points, wherein the final concentration of the compound to be detected is 1 mu M, the concentration of the liver microsome is 0.1mg/M L, the final concentration is 2 mM., incubating for 0, 15, 30 and 60min respectively, adding 150 mu L acetonitrile (containing an internal standard) into the mixed system after the incubation is finished, centrifuging the sample diluted by 4000rpm for 5min, and taking 150 mu L supernatant to L C-MS/MS for analysis.

And (4) conclusion: the stability experiment data of the liver microsome shows that the compound has better stability in different types of liver microsomes.

Claims (16)

1. A compound which is a compound of formula (I) or a pharmaceutically acceptable salt of a compound of formula (I), wherein:

x is-CR^6a-；

Y is-C (═ O) -;

q is-O-;

R¹is hydrogen, deuterium or C_1-6Alkyl radical, wherein said C_1-6Alkyl unsubstituted or substituted by 1,2,3 or 4R^vSubstituted;

R²is heteroaryl consisting of 5 to 6 ring atoms or R¹⁰O-, in which the 5-6 ring members constituting the heteroaryl radical are unsubstituted or substituted by 1,2 or 3R^wSubstituted;

R³is R¹³-(CR^eR^f)_m-O-or R¹⁰O-；

R⁷And R⁸Each independently of the others is hydrogen, deuterium, F, Cl, Br or C_1-6An alkyl group;

R¹⁰is hydrogen, deuterium or C_1-6Alkyl, wherein said C_1-6Alkyl unsubstituted or substituted by 1,2,3 or 4R^xSubstituted;

R⁴、R⁵together with the carbon atom to which they are attached form C_3-6Cycloalkyl, wherein said C_3-6Cycloalkyl unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

R⁶is hydrogen, deuterium, C_1-4Alkyl or C_3-6A cycloalkyl group;

R^6ais hydrogen, deuterium or C_1-4An alkyl group;

R¹³is C_1-6Alkyl radical, C_1-6Alkoxy radical, C_3-6Cycloalkyl or phenyl, wherein said C_1-6Alkyl radical, C_1-6Alkoxy radical, C_3-6Cycloalkyl and phenyl are each independently unsubstituted or substituted with 1,2,3 or 4R^hSubstituted;

R^eand R^fEach independently of the other is H, deuterium, OH, C_1-4Haloalkyl or C_1-4An alkyl group;

R^y、R^vand R^wEach independently is F, Cl, Br, OH, C_1-6Alkyl or C_1-6A haloalkyl group;

R^xand R^hEach independently of the others being F, Cl, Br, OH, amino, C_1-6Alkyl radical, C_1-6Alkoxy or C_3-6Cycloalkyl, wherein said amino, C_1-6Alkyl radical, C_1-6Alkoxy or C_3-6Cycloalkyl is each independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-4Alkoxy radical C_1-4An alkylene group;

m is 0, 1,2,3 or 4.

2. The compound of claim 1, wherein R is¹Is hydrogen, deuterium or C_1-4Alkyl radical, wherein said C_1-4Alkyl unsubstituted or substituted by 1,2,3 or 4R^vAnd (4) substituting.

3. The compound of claim 1, wherein R is¹Is hydrogen, deuterium, methyl, ethyl, n-propyl or isopropyl, wherein said methyl, ethyl, n-propyl and isopropyl are each independently unsubstituted or substituted by 1,2,3 or 4R^vAnd (4) substituting.

4. The compound of claim 1, wherein R is²Is furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl or R¹⁰O-, wherein said furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1,2,3 or 4R^wSubstituted;

R³is R¹³-(CR^eR^f)_m-O-or R¹⁰O-；

R⁷And R⁸Each independently hydrogen, deuterium, F, Cl, Br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl or n-pentyl;

R¹⁰is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl or n-hexyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, n-pentyl and n-hexyl are each independently unsubstituted or substituted by 1,2,3 or 4R^xAnd (4) substituting.

5. A compound according to claim 1, R⁴、R⁵And together with the carbon atom to which they are attached form a cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl group, wherein said cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl groups are each independently unsubstituted or substituted by 1,2,3 or 4R^ySubstituted;

R⁶is hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl;

R^6ahydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl or tert-butyl.

6. The compound of claim 1, wherein R is¹³Is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or phenyl, wherein the methyl, ethyl, n-propylIndependently of one another, the radicals, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and phenyl are unsubstituted or substituted by 1,2,3 or 4R^hAnd (4) substituting.

7. The compound of claim 1, wherein R is^eAnd R^fEach independently of the other is H, deuterium, OH, C_1-3Haloalkyl, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, or tert-butyl.

8. The compound of claim 1, wherein R is^y、R^vAnd R^wEach independently is F, Cl, Br, OH, C_1-4Alkyl or C_1-4A haloalkyl group;

R^xand R^hEach independently of the others being F, Cl, Br, OH, amino, C_1-4Alkyl radical, C_1-4Alkoxy, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein each of said cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl is independently unsubstituted or substituted with 1,2,3 or 4 substituents independently selected from F, Cl, Br, OH, amino, C_1-4Alkyl radical, C_1-4Haloalkyl, C_1-4Alkoxy or C_1-3Alkoxy radical C_1-3An alkylene group.

9. The compound of claim 1, comprising a compound of one of:

or a pharmaceutically acceptable salt thereof.

10. A pharmaceutical composition comprising a compound of any one of claims 1-9, and a pharmaceutically acceptable adjuvant, or a combination thereof.

11. The pharmaceutical composition according to claim 10, further comprising an anti-HBV agent.

12. The pharmaceutical composition of claim 11, wherein the anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.

13. The pharmaceutical composition of claim 12, wherein the anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simon interleukin, cladribine, emtricitabine, faplovir, interferon, calamin CP, intefine, interferon α -1b, interferon α, interferon α -2a, interferon β -1a, interferon α -2, interleukin-2, mevoxil, nitazoxanide, peginterferon α -2a, ribavirin-a, cizopyran, Euforavac, ampheta, phoshainav, interferon α -2b, levamisole or propaferaggermanium.

14. Use of a compound according to any one of claims 1 to 9 or a pharmaceutical composition according to any one of claims 10 to 13 in the manufacture of a medicament for the prevention, treatment or alleviation of a viral disease in a patient, wherein said viral disease is hepatitis b infection or a disease caused by hepatitis b infection.

15. The use according to claim 14, wherein the disease caused by hepatitis b infection is cirrhosis or hepatocellular carcinoma.

16. Use of a compound according to any one of claims 1 to 9 or a pharmaceutical composition according to any one of claims 10 to 13 in the manufacture of a medicament for inhibiting the production or secretion of HBsAg, and/or for inhibiting the production of HBV DNA.