CN110950860A - Fused tricyclic compound and application thereof in medicines - Google Patents

Fused tricyclic compound and application thereof in medicines Download PDF

Info

Publication number
CN110950860A
CN110950860A CN201910911197.7A CN201910911197A CN110950860A CN 110950860 A CN110950860 A CN 110950860A CN 201910911197 A CN201910911197 A CN 201910911197A CN 110950860 A CN110950860 A CN 110950860A
Authority
CN
China
Prior art keywords
radical
substituted
ring atoms
heteroaryl
alkynyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910911197.7A
Other languages
Chinese (zh)
Other versions
CN110950860B (en
Inventor
任青云
黄建洲
熊金锋
刘洋
于方彩
刘为顺
王益锋
S·戈尔德曼
张英俊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangdong HEC Pharmaceutical
Original Assignee
Sunshine Lake Pharma Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sunshine Lake Pharma Co Ltd filed Critical Sunshine Lake Pharma Co Ltd
Publication of CN110950860A publication Critical patent/CN110950860A/en
Application granted granted Critical
Publication of CN110950860B publication Critical patent/CN110950860B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)

Abstract

The invention relates to a fused tricyclic compound and application thereof in medicines, in particular to application of the fused tricyclic compound as a medicine for treating and/or preventing hepatitis B. Specifically, the present invention relates to a compound represented by the general formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, wherein each of the compounds isThe variables are as defined in the specification. The invention also relates to the application of the compound shown in the general formula (I) or the stereoisomer, the tautomer, the nitrogen oxide, the solvate, the metabolite, the pharmaceutically acceptable salt or the prodrug thereof as a medicament, in particular to the application as a medicament for treating and/or preventing hepatitis B.

Description

Fused tricyclic compound and application thereof in medicines
Technical Field
The invention belongs to the field of medicaments, and relates to a fused tricyclic compound and application thereof as a medicament, in particular to application of the fused tricyclic compound as a medicament for treating and/or preventing hepatitis B. The invention also relates to a composition of the fused tricyclic compounds and other antiviral agents, and application of the fused tricyclic compounds in treatment and/or prevention of Hepatitis B Virus (HBV) infection.
Background
Hepatitis b virus belongs to the hepadnaviridae family. It can cause acute and/or persistent progressive chronic disease. Hepatitis b virus also causes many other clinical manifestations in pathological morphology-in particular chronic inflammation of the liver, cirrhosis and canceration of hepatocytes. Estimated by the world health organization, there are 20 million people worldwide infected with HBV, about 3.5 million people with chronic infection, and about 100 million people per year die of liver failure, cirrhosis, and primary hepatocellular carcinoma (HCC) due to HBV infection.
Interferon α (IFN- α), pegylated IFN- α and 5 nucleotide analogs (lamivudine, adefovir dipivoxil, entecavir, telbivudine and tenofovir) are approved by the united states Food and Drug Administration (FDA) for clinical treatment.
Therefore, there is still a need for new compounds that can be effectively used as antiviral drugs, especially as drugs for the treatment and/or prevention of hepatitis b in the clinic.
Disclosure of Invention
The invention relates to a novel fused tricyclic compound and application thereof in preparing a medicament for treating and preventing HBV infection. The inventor finds that the novel fused tricyclic compound has the advantages of better pharmacokinetic property, good solubility, small toxicity, good stability of liver microsomes, good inhibitory activity on generation or secretion of HBsAg and replication of HBV DNA and the like, and has good application prospect in the aspect of anti-HBV. In particular, the compounds of the present invention, and the pharmaceutically acceptable compositions thereof, are also effective in inhibiting HBV infection.
In one aspect, the invention relates to a compound of formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (I), or a prodrug thereof, wherein:
Figure BDA0002214794320000011
each X1And X2Independently is CR7Or N;
R1is R1aO-or RaRbN-；
R2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4RxSubstituted by 1,2 or 3RxSubstituted;
or, R2Is C1-4Alkoxy radicals, in the meantime, R3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is1-4Alkoxy is unsubstituted or substituted by 1,2,3 or 4RwAnd (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
each RxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio group、C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is8-C1-4C in alkylene1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
R8is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-6Alkyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhSubstituted;
each RkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radicalBase, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl or C3-7Cycloalkyl, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl and C3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, C1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently is H, deuterium, C1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy or C1-6Substituted by alkylamino.
In another aspect, the present invention relates to a compound that is a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt, or a prodrug thereof of the compound of formula (II) or the compound of formula (II), wherein:
Figure BDA0002214794320000031
each X1And X2Independently is CR7Or N;
R1is R1aO-or RaRbN-；
R2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolylA group selected from the group consisting of an oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, a heteroaryl group consisting of 6 to 10 ring atoms, a phenyl group and a naphthyl group; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4RxSubstituted;
or, R2Is C1-4Alkoxy radicals, in the meantime, R3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is1-4Alkoxy is unsubstituted or substituted by 1,2,3 or 4RwAnd (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
each RxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is8-C1-4C in alkylene1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
R8is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-6Alkyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhSubstituted;
each RkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl or C3-7Cycloalkyl, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl and C3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, C1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently is H, deuterium, C1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl of 3 to 6 ring atoms and heteroaryl of 5 to 10 ring atoms are each independently notSubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy or C1-6Substituted by alkylamino.
In some embodiments, R is as described herein2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4RxSubstituted by 1,2 or 3RxSubstituted;
or, R2Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4RwSubstituted pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinylPyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4Rx1Substituted;
wherein each R isa，Rb，Rw，RxAnd Rx1Have the meaning as described in the present invention.
In some embodiments, R is as described herein2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4RxSubstituted;
or, R2Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4RwSubstituted pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxazolylOxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4Rx1Substituted;
wherein each R isa，Rb，Rw，RxAnd Rx1Have the meaning as described in the present invention.
In some embodiments, each R described hereinxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-3Alkylene, amino, C1-6Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein R is as defined above8-C1-3C in alkylene1-3Alkylene, amino, C1-6Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
wherein each R isa、Rb、R8And RkHave the meaning as described in the present invention.
In some embodiments, each R described hereinxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-CH2-、R8-(CH2)2-、R8-(CH2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, nitrogenA heterocycloalkyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl group, wherein R is a nitrogen atom8-CH2-CH of (A-O-)2-、R8-(CH2)2In- (CH)2)2-、R8-(CH2)3In- (CH)2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted with 1,2,3 or 4RkSubstituted;
wherein each R isa、Rb、R8And RkHave the meaning as described in the present invention.
In some embodiments, each R described hereinxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-CH2-、R8-(CH2)2-、R8-(CH2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is optionally substituted with one or more substituents selected from the group consisting of alkyl, aryl, heteroaryl, and heteroaryl, wherein R is optionally substituted with one or more substituents selected from the group consisting of alkyl, heteroaryl, and heteroaryl8-CH2-CH of (A-O-)2-、R8-(CH2)2In- (CH)2)2-、R8-(CH2)3In- (CH)2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
wherein each R isa、Rb、R8And RkHave the meaning as described in the present invention.
In some embodiments, each R described herein8Is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4An alkenyl group,C2-4Alkynyl, C3-6Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C6-10Aryl, heteroaryl of 5 ring atoms or heteroaryl of 6 ring atoms, wherein said amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C6-10Aryl, heteroaryl of 5 ring atoms and heteroaryl of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-4Alkyl radical, C3-6Cycloalkyl or heterocyclyl consisting of 3 to 6 ring atoms, wherein said C is1-4Alkyl radical, C3-6Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhSubstituted;
wherein each R is8、Rc、RfAnd RhHave the meaning as described in the present invention.
In some embodiments, R is as described herein8Is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl,wherein said amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substituted with 1,2,3, or 4RhSubstituted;
wherein each R is8、Rc、RfAnd RhHave the meaning as described in the present invention.
In some embodiments, each R described hereinkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-4Alkyl radical, C1-6Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein said amino, C1-4Alkyl radical, C1-6Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, Cl, Br, CN, OH, ═ O, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Haloalkoxy or C1-4Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, HOOC-, amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl or C3-6Cycloalkyl, wherein said amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl and C3-6Cycloalkyl is independently of one another unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, Cl, Br, CN, HO-, -O, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Haloalkoxy or C1-4Substituted by alkylamino;
wherein each R is10、R11And RcHave the meaning as described in the present invention.
In some embodiments, each R described hereinkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-3Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said amino, C, t-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl is substituted with one or more substituents selected from the group consisting of alkyl, alkoxy, pyridyl1-3Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-3Alkyl radical, C1-3Haloalkyl, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Haloalkoxy or C1-3Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-3Alkyl radical, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Alkylamino radical、C2-4Alkenyl radical, C2-4Alkynyl or C3-6Cycloalkyl, wherein said amino, C1-3Alkyl radical, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl and C3-6Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-3Alkyl radical, C1-3Haloalkyl, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Haloalkoxy or C1-3Substituted by alkylamino;
wherein each R is10、R11And RcHave the meaning as described in the present invention.
In some embodiments, each R described herein4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl radical, C3-6Cycloalkyl or heterocyclic group consisting of 3 to 6 ring atoms, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl radical, C3-6Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, trimorpholinyl, piperazinyl, thienyl, pyridyl, and the likeOxazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy or C1-4Substituted by alkylamino;
wherein each R iswHave the meaning as described in the present invention.
In some embodiments, each R described herein4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl,Thiocyclobutyl, oxacyclopropyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C-triazinyl, thiazolyl or pyrimidinyl is substituted with one or more substituents selected from the group consisting of alkyl, alkoxy, pyridyl, pyrimidinyl, pyridyl1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy or C1-4Substituted by alkylamino;
wherein each R iswHave the meaning as described in the present invention.
In another aspect, the present invention also provides a pharmaceutical composition comprising the compound of the present invention, optionally further comprising a pharmaceutically acceptable adjuvant or a combination of said adjuvants.
In some embodiments, the pharmaceutical composition of the present invention further comprises an additional anti-HBV agent.
In some embodiments, the pharmaceutical composition of the invention, wherein the other anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.
In some embodiments, the pharmaceutical composition of the invention, wherein the other anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon interleukin, cladribine, emtricitabine, famciclovir, interferon, calamine CP, intefine, interferon α -1b, interferon α, interferon α -2a, interferon β -1a, interferon α -2, interleukin-2, mevoxil, nitazoxanide, peginterferon α -2a, ribavirin, roscovitine-a, cezopyran, Euforavac, ampril, Phosphazid, heplav, interferon α -2b, levamisole, or propafegermanium.
In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient.
In some embodiments, the use of the invention, wherein the viral disease is hepatitis b virus infection or a disease caused by hepatitis b virus infection.
In still other embodiments, the use of the present invention, wherein the disease caused by hepatitis b virus infection is liver cirrhosis or hepatocellular carcinoma.
In another aspect, the invention also provides the use of said compound or said pharmaceutical composition in the manufacture of a medicament for inhibiting the production or secretion of HBsAg, and/or for inhibiting the production of HBV DNA.
In another aspect, the invention relates to the use of said compound or pharmaceutical composition in the manufacture of a medicament for the prevention, treatment or alleviation of hepatitis b disease in a patient.
Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a compound of the invention.
Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV disorders in a patient, said method comprising administering to the patient a pharmaceutically acceptable effective amount of a pharmaceutical composition comprising a compound of the present invention.
Another aspect of the present invention pertains to the use of a compound of the present invention in the manufacture of a medicament for the prevention, treatment, or treatment of an HBV condition in a patient, and for lessening the severity of the HBV condition in the patient.
Another aspect of the present invention relates to the use of a pharmaceutical composition comprising a compound of the present invention in the manufacture of a medicament for preventing or treating HBV conditions in a patient and reducing the severity thereof.
Another aspect of the present invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or composition of the present invention in an amount effective to inhibit HBV. In other embodiments, the method further comprises contacting the cell with an anti-HBV agent.
Another aspect of the present invention pertains to methods for treating HBV disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.
Another aspect of the present invention pertains to a method for inhibiting HBV infection in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.
Another aspect of the invention relates to methods for the preparation, isolation and purification of compounds encompassed by formula (I).
The foregoing merely summarizes certain aspects of the invention and is not intended to be limiting. These and other aspects will be more fully described below.
Detailed description of the invention
Definitions and general terms
The invention will be described in detail in the literature corresponding to the identified embodiments, and the examples are accompanied by the graphic illustrations of structural formulae and chemical formulae. The present invention is intended to cover all alternatives, modifications and equivalents, which may be included within the scope of the present invention as defined by the appended claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein which can be used in the practice of the present invention. The present invention is in no way limited to the description of methods and materials. There are many documents and similar materials that may be used to distinguish or contradict the present application, including, but in no way limited to, the definition of terms, their usage, the techniques described, or the scope as controlled by the present application.
The following definitions shall apply unless otherwise indicated. For the purposes of the present invention, the chemical elements are described in the periodic table of elements, CAS version and handbook of chemicals, 75,thed, 1994. In addition, the general principles of Organic Chemistry are described in "Organic Chemistry," Thomas Sorrell, University Science Books, Sausaltio: 1999, and "March's Advanced Organic Chemistry," by Michael B.Smith and Jerry March, John Wiley Chemistry&Sons, New York, 2007, all of which are hereby incorporated by reference.
The compounds of the invention may be substituted with one or more substituents as described herein, such as compounds of the general formula above, or as specifically exemplified, sub-classes, and classes of compounds encompassed by the invention. In general, the term "substituted" indicates that one or more hydrogen atoms in a given structure are replaced with a particular substituent. Unless otherwise indicated, a substituted group may have one substituent substituted at each substitutable position of the group. When more than one position in a given formula can be substituted with one or more substituents selected from a particular group, the substituents may be substituted at each position, identically or differently. In each part of this specificationThe substituents of the compounds disclosed herein are disclosed in terms of group type or range. It is specifically intended that the invention includes each and every independent subcombination of the various members of these groups and ranges. For example, the term "C1-6Alkyl "means in particular independently disclosed methyl, ethyl, C3Alkyl radical, C4Alkyl radical, C5Alkyl and C6An alkyl group.
In addition, unless otherwise explicitly indicated, the descriptions of the terms "… independently" and "… independently" and "… independently" used in the present invention are interchangeable and should be understood in a broad sense to mean that the specific items expressed between the same symbols do not affect each other in different groups or that the specific items expressed between the same symbols in the same groups do not affect each other.
The term "alkyl" as used herein includes saturated straight or branched chain monovalent hydrocarbon groups of 1 to 20 carbon atoms, wherein the alkyl groups may independently be optionally substituted with one or more substituents described herein. In some embodiments, the alkyl group contains 1 to 12 carbon atoms, in other embodiments, the alkyl group contains 1 to 8 carbon atoms, in other embodiments, the alkyl group contains 1 to 6 carbon atoms, in other embodiments, the alkyl group contains 1 to 4 carbon atoms, and in other embodiments, the alkyl group contains 1 to 3 carbon atoms. Further examples of alkyl groups include, but are not limited to, methyl (Me, -CH)3) Ethyl (Et, -CH)2CH3) N-propyl (n-Pr, -CH)2CH2CH3) Isopropyl (i-Pr, -CH (CH)3)2) N-butyl (n-Bu, -CH)2CH2CH2CH3) 2-methylpropyl or isobutyl (i-Bu, -CH)2CH(CH3)2) 1-methylpropyl or sec-butyl (s-Bu, -CH (CH)3)CH2CH3) Tert-butyl (t-Bu, -C (CH)3)3) N-pentyl (-CH)2CH2CH2CH2CH3) 2-pentyl (-CH (CH)3)CH2CH2CH3) 3-pentyl (-CH (CH)2CH3)2) 2-methyl-2-butyl (-C (CH)3)2CH2CH3) 3-methyl-2-butyl (-CH (CH)3)CH(CH3)2) 3-methyl-1-butyl (-CH)2CH2CH(CH3)2) 2-methyl-1-butyl (-CH)2CH(CH3)CH2CH3) N-hexyl (-CH)2CH2CH2CH2CH2CH3) 2-hexyl (-CH (CH)3)CH2CH2CH2CH3) 3-hexyl (-CH (CH)2CH3)(CH2CH2CH3) 2-methyl-2-pentyl (-C (CH))3)2CH2CH2CH3) 3-methyl-2-pentyl (-CH (CH)3)CH(CH3)CH2CH3) 4-methyl-2-pentyl (-CH (CH)3)CH2CH(CH3)2) 3-methyl-3-pentyl (-C (CH)3)(CH2CH3)2) 2-methyl-3-pentyl (-CH (CH)2CH3)CH(CH3)2) 2, 3-dimethyl-2-butyl (-C (CH)3)2CH(CH3)2) 3, 3-dimethyl-2-butyl (-CH (CH)3)C(CH3)3) 3, 3-dimethyl-butyl (-CH)2CH2C(CH3)3) N-heptyl, n-octyl, and the like. The term "alkyl" and its prefix "alkane" as used herein, both include straight and branched saturated carbon chains. The term "haloaliphatic" as used herein means that an aliphatic group is substituted with one or more of the same or different halogen atoms, wherein the aliphatic group or alkyl group has the meaning described herein, i.e., fluorine, chlorine, bromine or iodine, examples of which include, but are not limited to, trifluoromethyl, trifluoroethyl, and the like.
The term "haloalkyl" denotes an alkyl group substituted with one or more halogen atoms, wherein alkyl has the meaning described herein. In some of these embodiments, the haloalkyl group contains 1 to 12 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 10 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 8 carbon atoms; in still other embodiments, the haloalkyl group contains 1 to 6 carbon atoms; in other embodiments, the haloalkyl group contains 1 to 4 carbon atoms, and in other embodiments, the haloalkyl group contains 1 to 3 carbon atoms. Examples include, but are not limited to, trifluoromethyl, trifluoroethyl, and the like.
The term "carboxy", whether used alone or in combination with other terms (e.g., "carboxyalkyl"), means-CO2H or-COOH.
The term "carbonyl", whether used alone or in combination with other terms (such as "aminocarbonyl" or "acyloxy"), denotes- (C ═ O) -.
The terms "alkylamino" and "alkylamino" are used interchangeably and include "N-alkylamino" and "N, N-dialkylamino" in which the amino groups are each independently substituted with one or two C1-12Alkyl groups. Wherein in some embodiments, alkylamino is one or two C1-12Lower alkylamino radical in which the alkyl group is attached to the nitrogen atom, in some embodiments, alkylamino is C1-6In some embodiments, alkylamino is C1-4Lower alkylamino groups of (a). Suitable alkylamino groups can be monoalkylamino or dialkylamino, examples of which include, but are not limited to, N-methylamino, N-ethylamino, N-dimethylamino, N-diethylamino, N-propylamino, N-dipropylamino, and the like, wherein the alkylamino groups can independently be unsubstituted or substituted with one or more substituents described herein.
The term "alkylene" refers to a saturated divalent hydrocarbon radical resulting from the removal of two hydrogen atoms from a straight or branched chain saturated hydrocarbon radical. Unless otherwise specified, the alkylene group contains 1 to 12 carbon atoms, in other embodiments 1 to 6 carbon atoms, in other embodiments 1 to 4 carbon atoms, and in other embodiments 1 to 3 carbon atoms. In additionIn other embodiments, the alkylene group contains 1 to 2 carbon atoms. Examples of this include methylene (-CH)2-) ethylene (-CH2CH2-, propylene (-CH)2CH2CH2-) isopropylidene (-CH (CH)3)CH2-) butylene (-CH)2CH2CH2CH2-) pentylene (-CH)2CH2CH2CH2CH2-) and hexylene (-CH2CH2CH2CH2CH2CH2-) heptylene (-CH2CH2CH2CH2CH2CH2CH2-) octylene (-CH)2CH2CH2CH2CH2CH2CH2CH2-) and the like, wherein the alkylene groups may independently be unsubstituted or substituted with one or more substituents described herein.
The term "alkenyl" denotes a straight or branched chain monovalent hydrocarbon group of 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein C-C in at least one position is sp2Double bonds, wherein the alkenyl groups may be independently unsubstituted or substituted with one or more substituents as described herein, include the "cis", "trans" or "Z", "E" isomers, specific examples of which include, but are not limited to, vinyl (-CH ═ CH)2) Propenyl (-CH ═ CHCH)3) Allyl (-CH)2CH＝CH2) And the like, wherein the alkenyl group can be independently unsubstituted or substituted with one or more substituents described herein.
The term "alkynyl" denotes a straight or branched chain monovalent hydrocarbon radical containing 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein at least one position of the C-C is a sp triple bond, and wherein the alkynyl radical may independently be unsubstituted or substituted with one or more substituents as described herein, specific examples include, but are not limited to, ethynyl (-C.ident.CH), propargyl (-CH)2C ≡ CH), propynyl (-C ≡ C-CH)3)、1-alkynylbutyl (-CH)2CH2C ≡ CH), 2-alkynylbutyl (-CH)2C≡CCH3) 3-alkynylbutyl (-C [ identical to ] CCH2CH3) And the like, wherein the alkynyl group can be independently unsubstituted or substituted with one or more substituents described herein.
The term "alkoxy" means an alkyl group attached to the rest of the molecule through an oxygen atom, wherein the alkyl group has the meaning as described herein. Unless otherwise specified, the alkoxy group contains 1 to 20 carbon atoms, some examples of which are alkoxy groups containing 1 to 12 carbon atoms, other examples of which are alkoxy groups containing 1 to 8 carbon atoms, other examples of which are alkoxy groups containing 1 to 6 carbon atoms, other examples of which are alkoxy groups containing 1 to 4 carbon atoms, and other examples of which are alkoxy groups containing 1 to 3 carbon atoms.
Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH)3) Ethoxy (EtO, -OCH)2CH3) 1-propoxy (n-propoxy, n-PrO, n-propoxy, -OCH2CH2CH3) 2-propoxy (isopropoxy, i-PrO, i-propoxy, -OCH (CH)3)2) 1-butoxy (n-BuO, n-butoxy, -OCH)2CH2CH2CH3) 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH)2CH(CH3)2) 2-butoxy (s-BuO, s-butoxy, -OCH (CH)3)CH2CH3) 2-methyl-2-propoxy (t-BuO, t-butoxy, -OC (CH)3)3) 1-pentyloxy (n-pentyloxy, -OCH)2CH2CH2CH2CH3) 2-pentyloxy (-OCH (CH))3)CH2CH2CH3) 3-pentyloxy (-OCH (CH)2CH3)2) 2-methyl-2-butoxy (-OC (CH))3)2CH2CH3) 3-methyl-2-butoxy (-OCH (CH)3)CH(CH3)2) 3-methyl-l-butoxy (-OCH)2CH2CH(CH3)2) 2-methyl-l-butoxy (-OCH)2CH(CH3)CH2CH3) And the like, wherein the alkoxy group may independently be unsubstituted or substituted with one or more substituents described herein.
The term "haloalkoxy" denotes an alkoxy group substituted with one or more halogen atoms, wherein alkoxy has the meaning described herein. In some of these embodiments, the haloalkoxy group contains 1 to 12 carbon atoms; in still other embodiments, the haloalkoxy group contains 1 to 10 carbon atoms; in still other embodiments, the haloalkoxy group contains 1 to 8 carbon atoms; in still other embodiments, the haloalkoxy group contains 1 to 6 carbon atoms; in other embodiments, the haloalkoxy group contains 1 to 4 carbon atoms, and in other embodiments, the haloalkoxy group contains 1 to 3 carbon atoms. Examples include, but are not limited to, trifluoromethoxy and the like.
The term "cycloalkyl" refers to a monocyclic, bicyclic, or tricyclic ring system containing 3 to 12 ring carbon atoms that is saturated, having one or more points of attachment to the rest of the molecule. In some of these embodiments, cycloalkyl is a ring system containing from 3 to 10 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 3 to 8 ring carbon atoms; in other embodiments, cycloalkyl groups are ring systems containing from 3 to 7 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 5 to 8 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing from 3 to 6 ring carbon atoms; in other embodiments, cycloalkyl is a ring system containing 5 to 6 ring carbon atoms; examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like, and the cycloalkyl groups can independently be unsubstituted or substituted with one or more substituents described herein.
The terms "heterocyclyl" and "heterocycle" are used interchangeably herein and refer to a saturated or partially unsaturated, non-aromatic, monocyclic, bicyclic, or tricyclic ring system containing from 3 to 12 ring atoms, wherein at least one ring atom is selected from the group consisting of nitrogen, sulfur, and oxygen, and wherein the ring system has one or more attachment points to the remainder of the molecule. Term "Heterocyclyl "includes monocyclic, bicyclic or polycyclic fused, spiro or bridged heterocyclic ring systems, and also includes polycyclic ring systems in which the heterocyclic ring may be fused to one or more non-aromatic carbocyclic or heterocyclic rings or one or more aromatic rings or combinations thereof, wherein the radical or point of attachment is on the heterocyclic ring. Bicyclic heterocyclic groups include bridged bicyclic heterocyclic groups, fused bicyclic heterocyclic groups, and spiro bicyclic heterocyclic groups. Unless otherwise indicated, a-CH of a heterocyclic radical2-the group may optionally be replaced by-C (═ O) -. The sulfur atom of the ring may optionally be oxidized to the S-oxide. The nitrogen atom of the ring may optionally be oxidized to an N-oxygen compound. In some embodiments, heterocyclyl is a ring system of 3-12 ring atoms; in other embodiments, heterocyclyl is a ring system of 3-8 ring atoms; in other embodiments, heterocyclyl is a ring system of 3-6 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-7 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-8 ring atoms; in other embodiments, heterocyclyl is a ring system of 6-8 ring atoms; in other embodiments, heterocyclyl is a ring system of 5-6 ring atoms; in other embodiments, heterocyclyl is a ring system of 3 ring atoms; in other embodiments, heterocyclyl is a ring system of 4 ring atoms; in other embodiments, heterocyclyl is a ring system of 5 ring atoms; in other embodiments, heterocyclyl is a ring system of 6 ring atoms; in other embodiments, heterocyclyl is a ring system of 7 ring atoms; in other embodiments, heterocyclyl is a ring system of 8 ring atoms.
Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thiaxanyl, piperazinyl, homopiperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxetanyl, azepinyl, thietanyl, oxazepinyl, diazepinyl, thiazepinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1, 3-dioxolanyl, pyrazolinyl, dithianyl, dithienylalkyl, dihydrothienyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 1,2,3, 4-tetrahydroisoquinolinyl, 3-azabicyclo [3.1.0] hexyl, 3-azabicyclo [4.1.0] heptyl, azabicyclo [2.2.2] hexyl, 3H-indolylquinazinyl and N-pyridylurea. Examples of heterocyclic groups also include, 1, 1-dioxothiomorpholinyl; examples of the group in which the carbon atom on the ring is substituted with an oxo (═ O) group include, but are not limited to, pyrimidinedione group, 1,2, 4-thiadiazol-5 (4H) -one group, 1,2, 4-oxadiazol-5 (4H) -one group, 1H-1,2, 4-triazol-5 (4H) -one group and the like; examples in which the carbon atom on the ring is substituted with an ═ S group include, but are not limited to, 1,2, 4-oxadiazol-5 (4H) -thioketo, 1,3, 4-oxadiazol-2 (3H) -thioketo, and the like. The heterocyclyl group may be optionally substituted with one or more substituents as described herein.
The term "M-M1"consisting of one ring atom" means that the cyclic group consists of M-M1And the ring atoms comprise carbon atoms and/or heteroatoms such as O, N, S, P. For example, "heteroaryl of 6 to 10 atoms" means that it includes heteroaryl of 6,7, 8, 9 or 10 atoms.
The term "heteroalkylene" denotes an alkylene group substituted by 1 or 2 heteroatoms selected from O, S, N or P, the alkylene group having the meaning described herein, examples of "heteroalkylene" being-CH2-O-CH2-、-CH2-NH-CH2-、-CH2-CH2-NH-, etc.
The term "heteroatom" means one or more of O, S, N, P and Si, including any oxidation state form of N, S and P; primary, secondary, tertiary amines and quaternary ammonium salt forms; or a form in which a hydrogen on a nitrogen atom in the heterocycle is substituted, for example, N (like N in 3, 4-dihydro-2H-pyrrolyl), NH (like NH in pyrrolidinyl) or NR (like NR in N-substituted pyrrolidinyl, R representing a substituent as described herein).
The term "halogen" or "halogen atom" refers to F, Cl, Br or I.
The term "unsaturated" as used herein means that the moiety contains one or more degrees of unsaturation.
The term "aryl" used alone or as a majority of "aralkyl", "aralkoxy", or "aryloxyalkyl" refers to monocyclic, bicyclic, and tricyclic carbon ring systems containing 6 to 14 carbon atoms, or 6 to 12 carbon atoms, or 6 to 10 carbon atoms, wherein at least one ring system is aromatic, wherein each ring system contains 3 to 7 carbon atoms forming a ring and one or more attachment points are attached to the rest of the molecule. The term "aryl" may be used interchangeably with the terms "aromatic ring" or "aromatic ring", e.g., aryl may include phenyl, naphthyl and anthracenyl. The aryl group can be independently unsubstituted or substituted with one or more substituents described herein.
The term "heteroaryl" may be used alone or as a majority of "heteroarylalkyl" or "heteroarylalkoxy" and refers to a monocyclic, bicyclic, or tricyclic ring system of 5 to 16 ring atoms, at least one of which is aromatic, and at least one of which contains one or more heteroatoms, wherein each ring system contains a ring of 5 to 7 ring atoms, and one or more attachment points are attached to the rest of the molecule. The term "heteroaryl" may be used interchangeably with the terms "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is a heteroaryl consisting of 5 to 14 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 to 12 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 to 10 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 to 8 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 to 7 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 to 6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is heteroaryl consisting of 5 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N. In other embodiments, heteroaryl is a heteroaryl consisting of 6 ring atoms containing 1,2,3, or 4 heteroatoms independently selected from O, S, and N.
In other embodiments, heteroaryl includes, but is not limited to, the following monocyclic groups: 2-furyl group, 3-furyl group, N-imidazolyl group, 2-imidazolyl group, 4-imidazolyl group, 5-imidazolyl group, 3-isoxazolyl group, 4-isoxazolyl group, 5-isoxazolyl group, 2-oxazolyl group, 4-oxazolyl group, 5-oxazolyl group, N-pyrrolyl group, 2-pyrrolyl group, 3-pyrrolyl group, 2-pyridyl group, 3-pyridyl group, 4-pyridyl group, 2-pyrimidinyl group, 4-pyrimidinyl group, 5-pyrimidinyl group, pyridazinyl group (e.g., 3-pyridazinyl group), 2-thiazolyl group, 4-thiazolyl group, 5-thiazolyl group, tetrazolyl group (e.g., 5H-tetrazolyl group, 2H-tetrazolyl group), triazolyl group (e.g., 2-triazolyl group, 5-triazolyl group, 4H-1,2, 4-triazolyl, 1H-1,2, 4-triazolyl, 1,2, 3-triazolyl), 2-thienyl, 3-thienyl, pyrazolyl (e.g., 2-pyrazolyl and 3-pyrazolyl), isothiazolyl, 1,2, 3-oxadiazolyl, 1,2, 5-oxadiazolyl, 1,2, 4-oxadiazolyl, 1,3, 4-oxadiazolyl, 1,2, 3-thiadiazolyl, 1,3, 4-thiadiazolyl, 1,2, 5-thiadiazolyl, pyrazinyl, 1,3, 5-triazinyl; the following bi-or tricyclic groups are also included, but are in no way limited to these groups: benzimidazolyl, benzofuranyl, benzothienyl, indolyl (e.g., 2-indolyl), purinyl, quinolyl (e.g., 2-quinolyl, 3-quinolyl, 4-quinolyl), isoquinolyl (e.g., 1-isoquinolyl, 3-isoquinolyl, or 4-isoquinolyl), phenoxathiyl, dibenzoimidazolyl, dibenzofuranyl, or dibenzothienyl, and the like. The heteroaryl group is optionally substituted with one or more substituents described herein.
The term "alkylthio" includes C1-12A linear or branched alkyl group is attached to a divalent sulfur atom, wherein the alkyl group has the meaning as described herein. In some of these embodiments, the alkylthio group is lowerC1-6Alkylthio, in other embodiments, the alkylthio is lower C1-4Alkylthio, in other embodiments, the alkylthio is lower C1-3Alkylthio groups, and such examples include, but are not limited to, methylthio (CH)3S-), ethylthio, and the like.
Unless otherwise indicated, the structural formulae depicted herein include all isomeric forms (e.g., enantiomeric, diastereomeric, and geometric (or conformational) isomers): such as the R, S configuration containing an asymmetric center, the (Z), (E) isomers of the double bond, and the conformational isomers of (Z), (E). Thus, individual stereochemical isomers of the compounds of the present invention or mixtures of enantiomers, diastereomers, or geometric isomers (or conformers) thereof are within the scope of the present invention.
As used herein, "nitroxide" means that when a compound contains several amine functional groups, 1 or more than 1 nitrogen atom can be oxidized to form an N-oxide. Specific examples of N-oxides are N-oxides of tertiary amines or N-oxides of nitrogen-containing heterocyclic nitrogen atoms. The corresponding amines can be treated with an oxidizing agent, such as hydrogen peroxide or a peracid (e.g., peroxycarboxylic acid), to form the N-oxide (see Advanced Organic Chemistry, Wiley Interscience, 4 th edition, Jerry March, pages). In particular, the N-oxide may be prepared by the method of L.W.Deady (Syn.Comm.1977,7,509-514) in which an amine compound is reacted with m-chloroperoxybenzoic acid (MCPBA), for example, in an inert solvent such as methylene chloride.
The term "prodrug", as used herein, represents a compound that is converted in vivo to a compound of formula (I). Such conversion is effected by hydrolysis of the prodrug in the blood or by enzymatic conversion to the parent structure in the blood or tissue. The prodrug compound of the invention can be ester, and in the prior invention, the ester can be used as the prodrug and comprises phenyl ester and aliphatic (C)1-24) Esters, acyloxymethyl esters, carbonates, carbamates and amino acid esters. For example, a compound of the present invention contains a hydroxy group, i.e., it can be acylated to provide the compound in prodrug form. Other prodrug forms include phosphate esters, such as these phosphatesThe acid ester compound is obtained by phosphorylation of hydroxyl on a parent body. For a complete discussion of prodrugs, reference may be made to the following: T.Higuchi and V.Stella, Pro-drugs as Novel delivery systems, Vol.14of the A.C.S.Sympossium Series, Edward B.Roche, ed., Bioreverted arrays in Drug designs, American Pharmaceutical Association and PergammonPress, 1987, J.Rautio et al, Prodrugs: Design and Clinical Applications, Nature Review Drug Discovery,2008,7,255 and 270, and S.J.Herr et al, Prodrugs of pharmaceuticals and pharmaceuticals, Journal of chemical Chemistry,2008,51, 2328 and 2345.
Unless otherwise indicated, all tautomeric forms of the compounds of the invention are included within the scope of the invention. In addition, unless otherwise indicated, the structural formulae of the compounds described herein include isotopically enriched concentrations of one or more different atoms.
"metabolite" refers to the product of a particular compound or salt thereof obtained by metabolism in vivo. Metabolites of a compound can be identified by techniques well known in the art, and its activity can be characterized by assay methods as described herein. Such products may be obtained by administering the compound by oxidation, reduction, hydrolysis, amidation, deamidation, esterification, defatting, enzymatic cleavage, and the like. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a compound of the present invention with a mammal for a sufficient period of time.
The definition and convention of stereochemistry in the present invention is generally used with reference to the following documents: S.P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E.and Wilen, S., "stereoschemistry of Organic Compounds", John Wiley & Sons, Inc., New York,1994. All stereoisomeric forms of the compounds of the present invention, including, but in no way limited to, diastereomers, enantiomers, atropisomers, and mixtures thereof, such as racemic mixtures, form part of the present invention. Many organic compounds exist in optically active form, i.e., they have the ability to rotate the plane of plane polarized light. In describing optically active compounds, the prefix D, L or R, S is used to indicate the absolute configuration of the chiral center of the molecule. The prefixes d, l or (+), (-) are used to designate the sign of the rotation of plane polarized light of the compound, with (-) or l indicating that the compound is left-handed and the prefix (+) or d indicating that the compound is right-handed. The chemical structures of these stereoisomers are identical, but their stereo structures are different. A particular stereoisomer may be an enantiomer, and a mixture of isomers is commonly referred to as a mixture of enantiomers. 50: 50 is called a racemic mixture or racemate, which may result in no stereoselectivity or stereospecificity during the chemical reaction. The terms "racemic mixture" and "racemate" refer to a mixture of two enantiomers in equimolar amounts, lacking optical activity.
The term "tautomer" or "tautomeric form" means that isomers of structures of different energies may be interconverted through a low energy barrier. For example, proton tautomers (i.e., tautomers of proton transfer) include interconversion by proton migration, such as keto-enol and imine-enamine isomerizations. Valence (valence) tautomers include tautomers that recombine into bond electrons.
As used herein, "pharmaceutically acceptable salts" refer to organic and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as are: berge et al, descriptive acceptable salts in detail in J. pharmaceutical Sciences,66:1-19,1977. Pharmaceutically acceptable non-toxic acid salts include, but are not limited to, salts of inorganic acids formed by reaction with amino groups such as hydrochlorides, hydrobromides, phosphates, sulfates, perchlorates, and salts of organic acids such as acetates, oxalates, maleates, tartrates, citrates, succinates, malonates, or those obtained by other methods described in the literature above, such as ion exchange. Other pharmaceutically acceptable salts include adipatesMalate, 2-hydroxypropionate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, cyclopentylpropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumerate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, palmitate, pamoate, pectate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, stearate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. If the compounds of the invention are acidic, the desired salts can be prepared by suitable methods, e.g., using inorganic or organic bases, such as ammonia (primary, secondary, tertiary), alkali metal hydroxides, ammonium, N+(R14)4Salts and alkaline earth metal hydroxides, and the like. Suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, ammonia, such as primary, secondary and tertiary, N+(R14)4Salts, e.g. R14Is H, C1-4Alkyl radical, C6-10Aryl radical, C6-10Aryl radical C1-4Alkyl, etc., and cyclic amines such as piperidine, morpholine, piperazine, etc., and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Also included are suitable, non-toxic ammonium, quaternary ammonium salts and amine cations resistant to formation of counterions, e.g., halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C1-8Sulfonates and aromatic sulfonates.
"solvate" of the present invention refers to an association of one or more solvent molecules with a compound of the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, aminoethanol. The term "hydrate" refers to an association of solvent molecules that is water.
The term "protecting group" or "Pg" refers to a substituent that when reacted with another functional group, is typically used to block or protect a particular functionality. For example, "amino protecting group" refers to a substituent attached to an amino group to block or protect the functionality of the amino group in a compound, and suitable amino protecting groups include acetyl, trifluoroacetyl, t-Butoxycarbonyl (BOC), benzyloxycarbonyl (CBZ) and 9-fluorenylmethylenoxycarbonyl (Fmoc). Similarly, "hydroxyl protecting group" refers to the functionality of a substituent of a hydroxyl group to block or protect the hydroxyl group, and suitable protecting groups include acetyl and silyl groups. "carboxy protecting group" refers to the functionality of a substituent of a carboxy group to block or protect the carboxy group, and typical carboxy protecting groups include-CH2CH2SO2Ph, cyanoethyl, 2- (trimethylsilyl) ethyl, 2- (trimethylsilyl) ethoxymethyl, 2- (p-toluenesulfonyl) ethyl, 2- (p-nitrobenzenesulfonyl) ethyl, 2- (diphenylphosphino) ethyl, nitroethyl, and the like. General descriptions of protecting groups can be found in the literature: greene, Protective Groups in Organic Synthesis, John Wiley&Sons,New York,1991；and P.J.Kocienski,Protecting Groups,Thieme,Stuttgart,2005。
Description of the Compounds of the invention
The compound and the pharmaceutically acceptable composition thereof can effectively inhibit HBV infection.
In one aspect, the invention relates to a compound of formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (I), or a prodrug thereof, wherein:
Figure BDA0002214794320000141
each X1And X2Independently is CR7Or N;
R1is R1aO-or RaRbN-；
R2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4RxSubstituted by 1,2 or 3RxSubstituted;
or, R2Is C1-4Alkoxy radicals, in the meantime, R3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is1-4Alkoxy is unsubstituted or substituted by 1,2,3 or 4RwAnd (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
each RxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is8-C1-4C in alkylene1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
R8is F, Cl, Br, CN, ═ O, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-6Alkyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhSubstituted;
each RkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C1-6Alkyl radical、C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl or C3-7Cycloalkyl, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl and C3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, C1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach is independentThe radix is H, deuterium or C1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy or C1-6Substituted by alkylamino.
In another aspect, the present invention relates to a compound that is a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt, or a prodrug thereof of the compound of formula (II) or the compound of formula (II), wherein:
Figure BDA0002214794320000151
each X1And X2Independently is CR7Or N;
R1is R1aO-or RaRbN-；
R2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein the pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, and 6-10 ringsThe heteroaryl, phenyl or naphthyl radicals being independently of one another unsubstituted or substituted by 1,2,3 or 4RxSubstituted by 1,2 or 3RxSubstituted;
or, R2Is C1-4Alkoxy radicals, in the meantime, R3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is1-4Alkoxy is unsubstituted or substituted by 1,2,3 or 4RwAnd (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
each RxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is8-C1-4C in alkylene1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
R8is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-6Alkyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhSubstituted;
each RkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl or C3-7Cycloalkyl, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl and C3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, C1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently is H, deuterium, C1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy or C1-6Substituted by alkylamino.
In another aspect, the present invention relates to a compound that is a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt, or a prodrug thereof of the compound of formula (II) or the compound of formula (II), wherein:
Figure BDA0002214794320000161
each X1And X2Independently is CR7Or N;
R1is R1aO-or RaRbN-；
R2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4RxSubstituted;
or, R2Is C1-4Alkoxy radicals, in the meantime, R3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is1-4Alkoxy is unsubstituted or substituted by 1,2,3 or 4RwAnd (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
each RxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is8-C1-4C in alkylene1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
R8is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-6Alkyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhGet itGeneration;
each RkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl or C3-7Cycloalkyl, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl and C3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, C1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently is H, deuterium, C1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy or C1-6Substituted by alkylamino.
In some embodiments, R is as described herein2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein the pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, etc,Thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4RxSubstituted by 1,2 or 3RxSubstituted;
or, R2Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4RwAnd (b) said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
wherein each R isa，Rb，Rw，RxAnd Rx1Have the meaning as described in the present invention.
In some embodiments, R is as described herein2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl with 9 ring atoms, heteroaryl with 10 ring atoms, amino acid,phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4RxSubstituted;
or, R2Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4RwAnd (b) said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
wherein each R isa，Rb，Rw，RxAnd Rx1Have the meaning as described in the present invention.
In some embodiments, each R described hereinxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-3Alkylene, amino, C1-6Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein R is as defined above8-C1-3C in alkylene1-3Alkylene, amino, C1-6Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
wherein each R isa、Rb、R8And RkHave the meaning as described in the present invention.
In some embodiments, each R described hereinxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-CH2-、R8-(CH2)2-、R8-(CH2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is a radical selected from the group consisting of8-CH2-CH of (A-O-)2-、R8-(CH2)2In- (CH)2)2-、R8-(CH2)3In- (CH)2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazoleAlkyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently being unsubstituted or substituted with 1,2,3 or 4RkSubstituted;
wherein each R isa、Rb、R8And RkHave the meaning as described in the present invention.
In some embodiments, each R described hereinxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-CH2-、R8-(CH2)2-、R8-(CH2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is optionally substituted with one or more substituents selected from the group consisting of alkyl, aryl, heteroaryl, and heteroaryl, wherein R is optionally substituted with one or more substituents selected from the group consisting of alkyl, heteroaryl, and heteroaryl8-CH2-CH of (A-O-)2-、R8-(CH2)2In- (CH)2)2-、R8-(CH2)3In- (CH)2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl,Cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
wherein each R isa、Rb、R8And RkHave the meaning as described in the present invention.
In some embodiments, each R described herein8Is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C6-10Aryl, heteroaryl of 5 ring atoms or heteroaryl of 6 ring atoms, wherein said amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C6-10Aryl, heteroaryl of 5 ring atoms and heteroaryl of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-4Alkyl radical, C3-6Cycloalkyl or heterocyclyl consisting of 3 to 6 ring atoms, wherein said C is1-4Alkyl radical, C3-6Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhSubstituted;
wherein each R is8、Rc、RfAnd RhHave the meaning as described in the present invention.
In some embodiments, R is as described herein8Is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein said amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C.1-3Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl,Cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or 1,2,3, or 4RhSubstituted;
wherein each R is8、Rc、RfAnd RhHave the meaning as described in the present invention.
In some embodiments, each R described hereinkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-4Alkyl radical, C1-6Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein said amino, C1-4Alkyl radical, C1-6Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, Cl, Br, CN, OH, ═ O, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Haloalkoxy or C1-4Substituted by alkylamino;
each RhAnd RwIndependently is deuterium,F. Cl, Br, HO-, HOOC-, amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl or C3-6Cycloalkyl, wherein said amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl and C3-6Cycloalkyl is independently of one another unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, Cl, Br, CN, HO-, -O, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Haloalkoxy or C1-4Substituted by alkylamino;
wherein each R is10、R11And RcHave the meaning as described in the present invention.
In some embodiments, each R described hereinkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-3Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said amino, C, t-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl is substituted with one or more substituents selected from the group consisting of alkyl, alkoxy, pyridyl1-3Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-3Alkyl radical, C1-3Haloalkyl, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Haloalkoxy or C1-3Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-3Alkyl radical, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl or C3-6Cycloalkyl, wherein said amino, C1-3Alkyl radical, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl and C3-6Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-3Alkyl radical, C1-3Haloalkyl, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Haloalkoxy or C1-3Substituted by alkylamino;
wherein each R is10、R11And RcHave the meaning as described in the present invention.
In some embodiments, each R described herein4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl radical、C2-4Alkenyl radical, C3-6Cycloalkyl or heterocyclic group consisting of 3 to 6 ring atoms, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl radical, C3-6Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C-triazinyl, thiazolyl or pyrimidinyl is substituted with one or more substituents selected from the group consisting of alkyl, alkoxy, pyridyl, pyrimidinyl, pyridyl1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy or C1-4Substituted by alkylamino radicals；
Wherein each R iswHave the meaning as described in the present invention.
In some embodiments, each R described herein4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substituted by 1,2,3, or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thiophenylOr a pyrazinyl, pyridazinyl or pyrimidinyl group, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy or C1-4Substituted by alkylamino;
wherein each R iswHave the meaning as described in the present invention.
In some embodiments, the present invention relates to compounds, or stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof, of one of the following, but in no way limited to these compounds:
Figure BDA0002214794320000211
Figure BDA0002214794320000221
Figure BDA0002214794320000231
Figure BDA0002214794320000241
Figure BDA0002214794320000251
unless otherwise specified, stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof of the compounds of formula (I) are included within the scope of the present invention.
In another aspect, the present invention also provides a pharmaceutical composition comprising the compound of the present invention, optionally further comprising a pharmaceutically acceptable adjuvant or a combination of said adjuvants.
In some embodiments, the pharmaceutical composition of the present invention further comprises an additional anti-HBV agent.
In other embodiments, the pharmaceutical composition of the invention, wherein the anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator, or an interferon.
In some embodiments, the anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon interleukin, cladribine, emtricitabine, famciclovir, interferon, calamine CP, intefine, interferon α -1b, interferon α, interferon α -2a, interferon β -1a, interferon α -2, interleukin-2, mevoxil, nitazoxanide, peginterferon α -2a, ribavirin, roscovitine-a, cezopyran, Euforavac, ampril, Phosphazid, heplav, interferon α -2b, levamisole, or propafegermanium.
In another aspect, the invention also provides the use of the compound or the pharmaceutical composition in the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient.
In some embodiments, the use of the invention, wherein the viral disease is hepatitis b virus infection or a disease caused by hepatitis b virus infection.
In still other embodiments, the use of the present invention, wherein the disease caused by hepatitis b virus infection is liver cirrhosis or hepatocellular carcinoma.
In another aspect, the invention also provides the use of said compound or said pharmaceutical composition in the manufacture of a medicament for inhibiting HBsAg production or secretion, and/or for inhibiting HBV DNA production or replication.
In another aspect, the invention relates to the use of said compound or pharmaceutical composition in the manufacture of a medicament for the prevention, treatment or alleviation of hepatitis b disease in a patient.
Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a compound of the invention.
Another aspect of the invention relates to a method of preventing, treating or ameliorating HBV disorders in a patient, comprising administering to the patient a pharmaceutically acceptable effective amount of a pharmaceutical composition comprising a compound of the invention.
Another aspect of the invention relates to the use of a compound of the invention in the manufacture of a medicament for the prevention, treatment or treatment of HBV disorders in a patient and for lessening the severity thereof.
Another aspect of the present invention relates to the use of a pharmaceutical composition comprising a compound of the present invention in the manufacture of a medicament for preventing or treating HBV conditions in a patient and reducing the severity thereof.
Another aspect of the invention relates to a method of inhibiting HBV infection comprising contacting a cell with a compound or composition of the invention in an amount effective to inhibit HBV. In other embodiments, the method further comprises contacting the cell with an additional anti-HBV agent.
Another aspect of the present invention relates to a method of treating HBV disease in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.
Another aspect of the present invention relates to a method of inhibiting HBV infection in a patient, comprising administering to the patient a therapeutically effective amount of a compound of the present invention or a composition thereof. In other embodiments, the method further comprises administering an additional HBV treatment.
Another aspect of the invention relates to methods for the preparation, isolation and purification of compounds encompassed by formula (I).
The invention also encompasses the use of the compounds of the invention and pharmaceutically acceptable salts thereof for the manufacture of a pharmaceutical product effective in inhibiting HBV infection, including those described herein. The application of the compound of the invention in the production of the drugs for effectively inhibiting HBV infection. The compounds of the invention are also useful in the manufacture of a medicament for alleviating, preventing, controlling or treating a condition of hepatitis b in a patient. The present invention encompasses pharmaceutical compositions comprising a therapeutically effective amount of a compound represented by formula (I) in combination with at least one pharmaceutically acceptable excipient.
The invention also encompasses a method of effectively inhibiting HBV-infected diseases, or susceptibility to such conditions, which comprises treating a patient with a therapeutically effective amount of a compound represented by formula (I).
Unless otherwise indicated, all stereoisomers, tautomers, nitric oxides, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof, of the compounds of the invention are within the scope of the invention.
In particular, the salts are pharmaceutically acceptable salts. The term "pharmaceutically acceptable" includes materials or compositions which must be compatible chemically or toxicologically, with the other components comprising the formulation, and with the mammal being treated.
The salts of the compounds of the present invention also include intermediates used in the preparation or purification of the compounds of formula (I) or salts of formula (I) or isomers thereof, but are not necessarily pharmaceutically acceptable salts.
The term "pharmaceutically acceptable" refers to a substance that is acceptable from a toxicological standpoint for pharmaceutical use and does not adversely interact with the active ingredient.
If the compounds of the invention are basic, the desired salts may be prepared by any suitable method provided in the literature, for example, using inorganic acids such as hydrochloric, hydrobromic, sulfuric, nitric and phosphoric acids and the like, or using organic acids such as acetic, maleic, succinic, mandelic, fumaric, malonic, pyruvic, malic, 2-hydroxypropionic, citric, oxalic, glycolic and salicylic acids, pyranonic acids such as glucuronic and galacturonic acids, α -hydroxy acids such as citric and tartaric acids, amino acids such as aspartic and glutamic acids, aromatic acids such as benzoic and cinnamic acids, sulfonic acids such as p-toluenesulfonic, benzenesulfonic, methanesulfonic, ethanesulfonic, trifluoromethanesulfonic and the like, or combinations thereof.
If the compound of the invention is acidic, the desired salt can be prepared by a suitable method, and the inorganic base is lithium salt, sodium salt, potassium salt, calcium salt, magnesium salt, aluminum salt, ferric salt, ferrous salt, manganese salt, manganous salt, copper salt, zinc salt, ammonium salt and the like of the compound shown in the formula (I); organic bases, such as salts of compounds of formula (I) with methylamine, dimethylamine, trimethylamine, ethylamine, diethylamine, triethylamine, tromethamine, diethylaminoethanol, isopropylamine, 2-ethylamino ethanol, pyridine, picoline, ethanolamine, diethanolamine, ammonium, dimethylethanolamine, tetramethylammonium, tetraethylammonium, triethanolamine, piperidine, piperazine, morpholine, imidazolium salts, lysine, arginine, L-arginine, histidine, N-methylglucamine, dimethylglucamine, ethylglucamine, dicyclohexylamine, 1, 6-hexanediamine, ethylenediamine, glucamine, sarcosine, serinol, aminopropanediol, 1-amino-2, 3, 4-butanetriol, L-lysine, ornithine, and the like.
Pharmaceutical compositions, formulations, administration of the compounds of the invention and uses of the compounds and pharmaceutical compositions
The pharmaceutical composition comprises a compound with a structure shown in a formula (I) or a compound with a structure shown in an embodiment, or a stereoisomer, a tautomer, an oxynitride, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof, and pharmaceutically acceptable auxiliary materials. The compound in the composition can effectively inhibit the hepatitis B virus and is suitable for treating diseases caused by the virus, particularly acute and chronic persistent HBV virus infection.
For the compounds of the invention, mention may be made of the indicator regions, for example: treatment of acute and chronic viral infections, which may lead to infectious hepatitis, e.g., hepatitis B virus infection. The compounds of the invention are particularly suitable for the treatment of chronic hepatitis B virus infection and acute hepatitis B virus infection.
The invention encompasses pharmaceutical preparations which, in addition to nontoxic, inert, pharmaceutically suitable adjuvants, also contain one or more compounds (I) or compositions according to the invention.
The above pharmaceutical preparation may also contain other active pharmaceutical ingredients than compound (I).
The compounds of the invention exist in free form or, where appropriate, as pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adduct or derivative that can be administered directly or indirectly in accordance with the needs of the patient, compounds described in other aspects of the invention, metabolites thereof, or residues thereof.
As described herein, the pharmaceutical composition of the present invention comprises any one of the compounds of formula (I) of the present invention, and further comprises pharmaceutically acceptable excipients, which, for example, as used herein, include any solvent, solid excipient, diluent, binder, disintegrant, or other liquid excipient, dispersant, flavoring or suspending agent, surfactant, isotonic agent, thickening agent, emulsifier, preservative, solid binder or lubricant, and the like, suitable for the particular target dosage form. As described in the following documents: in Remington, The Science and Practice of Pharmacy,21stedition,2005, ed.D.B.Troy, Lippincott Williams & Wilkins, Philadelphia, and Endencyclopedia of Pharmaceutical Technology, eds.J.Swarbrick and J.C.Boylan, 1988. Anscholar 1999, Marcel Dekker, New York, taken together with The disclosure of this document, indicates that different adjuvants can be used In The preparation of pharmaceutically acceptable compositions and their well-known methods of preparation. Except insofar as any conventional adjuvant is incompatible with the compounds of the invention, e.g., any adverse biological effect produced or interaction in a deleterious manner with any other component of a pharmaceutically acceptable composition, their use is contemplated by the present invention.
Substances that may serve as pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum albumin; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; partial glyceride mixtures of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silica; magnesium trisilicate; polyvinylpyrrolidone; polyacrylate esters; a wax; polyethylene-polyoxypropylene-blocking polymers; lanolin; sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gum powder; malt; gelatin; talc powder; adjuvants such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic salt; ringer's solution; ethanol; phosphoric acid buffer solution; and other non-toxic suitable lubricants such as sodium lauryl sulfate and magnesium stearate; a colorant; a release agent; coating the coating material; a sweetener; a flavoring agent; a fragrance; preservatives and antioxidants.
Pharmaceutical compositions of the compounds of the invention may be administered in any of the following ways: oral administration, spray inhalation, topical administration, rectal administration, nasal administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrapulmonary, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or by means of a reservoir of external value. Preferred modes of administration are oral, intramuscular, intraperitoneal or intravenous.
Pharmaceutical compositions of the compounds of the present invention may be administered in any of the following ways: oral administration, spray inhalation, topical administration, rectal administration, nasal administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrapulmonary, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or administration via an explanted reservoir. Preferred modes of administration are oral, intramuscular, intraperitoneal or intravenous.
The compounds of the present invention or compositions containing them which are pharmaceutically acceptable may be administered in unit dosage form. The administration dosage form can be liquid dosage form or solid dosage form. The liquid dosage forms can be true solutions, colloids, microparticles, and suspensions. Other dosage forms such as tablet, capsule, dripping pill, aerosol, pill, powder, solution, suspension, emulsion, granule, suppository, lyophilized powder for injection, clathrate, implant, patch, liniment, etc.
Oral tablets and capsules may contain excipients such as binding agents, for example syrup, acacia, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example lactose, sucrose, corn starch, calcium phosphate, sorbitol, glycine; lubricants, such as magnesium stearate, talc, polyethylene glycol, silica; disintegrants, for example potato starch; or acceptable humectants such as sodium lauryl sulfate. The tablets may be coated by methods known in the art of pharmacy.
Oral liquids may be prepared as suspensions, solutions, emulsions, syrups or elixirs in water and oil, or as dry products, supplemented with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, sorbitol, cellulose methyl ether, glucose syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gelatin, hydrogenated edible fats and oils; emulsifying agents, for example lecithin, sorbitan monooleate, acacia; or non-aqueous vehicles (which may include edible oils), such as almond oil; fats and oils such as glycerin, ethylene glycol or ethanol; preservatives, e.g. methyl or propyl p-hydroxybenzoates, sorbic acid. Flavoring or coloring agents may be added if desired.
Suppositories may contain conventional suppository bases such as cocoa butter or other glycerides.
For parenteral administration, the liquid dosage form is usually prepared from the compound and a sterile excipient. The auxiliary material is preferably water. According to different selected adjuvants and drug concentrations, the compound can be dissolved in adjuvants or made into suspension solution, and can be dissolved in water for injection, filtered, sterilized and filled into sealed bottle or ampoule.
When applied topically to the skin, the compounds of the present invention may be formulated in the form of a suitable ointment, lotion, or cream in which the active ingredient is suspended or dissolved in one or more excipients which may be used in ointment formulations including, but not limited to: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; lotions and creams adjuvants that may be used include, but are not limited to: mineral oil, sorbitan monostearate, tween 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
In general, it has proven advantageous, both in human medicine and in veterinary medicine, to administer the active compounds according to the invention in a total amount of from about 0.01 to 500mg/kg of body weight, preferably from 0.01 to 100mg/kg of body weight, if appropriate in multiple single doses, per 24 hours in order to achieve the desired effect. The amount of active compound contained in a single dose is preferably about 1 to 80mg/kg body weight, more preferably 1 to 50mg/kg body weight, but may be varied from the above-mentioned dose, i.e., depending on the kind and body weight of the subject to be treated, the nature and severity of the disease, the type of preparation and the mode of administration of the drug, and the period or interval of administration.
The pharmaceutical composition provided by the invention also comprises an anti-HBV medicament. Wherein the anti-HBV drug is an HBV polymerase inhibitor, an immunomodulator, an interferon or other novel anti-HBV agent such as an HBV RNA replication inhibitor, an HBsAg secretion inhibitor, an HBV capsid inhibitor, an antisense oligomer, an siRNA, an HBV therapeutic vaccine, an HBV prophylactic vaccine, an HBV antibody therapy (monoclonal or polyclonal), and an agonist for treating or preventing HBV.
anti-HBV drugs include lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, alfafenone, Alloferon, simon interleukin, cladribine, emtricitabine, faprivir, interferon, calamine CP, intefine, interferon α -1b, interferon α, interferon α -2a, interferon β -1a, interferon α -2, interleukin-2, mefenate, nitazoxanide, peginterferon α -2a, ribavirin, roscovellin-A, cizopyran, Euforavac, anidol, fosphazid, heplisv, interferon α -2b, levamisole or propafege.
In one aspect, the compound or pharmaceutical composition of the invention is used for preparing a medicament for preventing, treating or alleviating hepatitis b disease in a patient. The hepatitis B disease refers to liver diseases caused by hepatitis B virus infection or hepatitis B virus infection, and comprises acute hepatitis, chronic hepatitis, liver cirrhosis and liver cancer. Acute hepatitis b virus infection may be asymptomatic or manifest as acute hepatitis symptoms. Patients with chronic viral infections have active disease and can develop cirrhosis and liver cancer.
The use of the compound or the pharmaceutical composition of the invention comprises inhibiting the production or secretion of HBsAg, and comprises administering to a patient a pharmaceutically acceptable effective dose of the compound or the pharmaceutical composition of the invention.
The use of the compound or the pharmaceutical composition of the present invention includes the use for inhibiting HBV DNA production, and further includes the administration of a pharmaceutically acceptable effective dose of the compound or the pharmaceutical composition of the present invention to a patient.
In one aspect, the use of a compound or pharmaceutical composition of the invention for inhibiting HBV gene expression comprises administering to a patient a pharmaceutically acceptable effective amount of a compound or pharmaceutical composition of the invention.
Other anti-HBV agents may be administered separately from compositions comprising compounds of the present invention as part of a multiple dosing regimen. Alternatively, those agents may be part of a single dosage form, mixed together with the compounds of the present invention to form a single composition. If administered as part of a multiple dosing regimen, the two active agents can be delivered to each other simultaneously, sequentially or over a period of time, to achieve the desired agent activity.
The amount of compound and composition that can be combined with an adjuvant material to produce a single dosage form (those containing a composition like that described herein) will vary depending on the indication and the particular mode of administration. The compound of the invention shows stronger antiviral effect. The compounds have unexpected antiviral activity on HBV, and are suitable for treating various diseases caused by viruses, especially diseases caused by acute and chronic persistent HBV infection. Chronic viral diseases caused by HBV can lead to a variety of syndromes of varying severity, and chronic hepatitis b virus infection is known to cause cirrhosis and/or liver cancer.
Examples of indications that can be treated with the compounds of the invention are: treatment of acute and chronic viral infections that can lead to infectious hepatitis, such as hepatitis b virus infection, with treatment of chronic hepatitis b virus infection and treatment of acute hepatitis b virus infection being particularly preferred.
The invention also relates to the use of the compounds and compositions of the invention for the preparation of medicaments for the treatment and prophylaxis of viral diseases, in particular hepatitis b.
General synthetic methods
To illustrate the invention, the following examples are set forth. It is to be understood that the invention is not limited to these embodiments, but is provided as a means of practicing the invention.
In general, the compounds of the present invention may be prepared by the methods described herein, wherein the substituents are as defined in formula (I), unless otherwise indicated. The following synthetic schemes and examples serve to further illustrate the context of the invention.
Those skilled in the art will recognize that: the chemical reactions described herein may be used to suitably prepare a number of other compounds of the invention, and other methods for preparing the compounds of the invention are considered to be within the scope of the invention. For example, the synthesis of those non-exemplified compounds according to the present invention can be successfully accomplished by those skilled in the art by modification, such as appropriate protection of interfering groups, by the use of other known reagents in addition to those described herein, or by some routine modification of reaction conditions. In addition, the reactions disclosed herein or known reaction conditions are also recognized as being applicable to the preparation of other compounds of the present invention.
The examples described below, unless otherwise indicated, all temperatures are in degrees Celsius (. degree. C.). Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, Arco Chemical Company and Alfa Chemical Company and were used without further purification unless otherwise indicated. General reagents were purchased from Shantou Wen Long chemical reagent factory, Guangdong Guanghua chemical reagent factory, Guangzhou chemical reagent factory, Tianjin HaoLiyu Chemicals Co., Ltd, Qingdao Tenglong chemical reagent Co., Ltd, and Qingdao Kaseiki chemical plant.
The NMR spectra were measured on a Bruker Avance 400 NMR spectrometer or a Bruker Avance IIIHD 600 NMR spectrometer using CDCl3, DMSO-d6, CD3OD or d 6-acetone as solvents (reported in ppm) and TMS (0 ppm) or chloroform (7.26 ppm) as reference standards. When multiple peaks occur, the following abbreviations will be used: s (singlets, singlet), s, s (singlets, singlet), d (doubtet, doublet), t (triplet ), m (multiplet, multiplet), br (broadened, broad), dd (doubtet of doubtets), ddd (doubtet of doubtets, doublet), dt (doubtet of triplets, doublet), ddt (doubtet of triplets, double triplet), td (triplet of doubtets, triplet), br. Coupling constant J, in Hertz (Hz).
Low resolution Mass Spectral (MS) data were measured by Agilent 6320 series LC-MS spectrometer equipped with G1312A binary pump and a G1316A TCC (column temperature maintained at 30 ℃), G1329A autosampler and G1315B DAD detector applied for analysis, ESI source applied to LC-MS spectrometer.
Low resolution Mass Spectral (MS) data were measured by Agilent 6120 series LC-MS spectrometer equipped with a G1311A quaternary pump and a G1316A TCC (column temperature maintained at 30 ℃), a G1329A autosampler and a G1315D DAD detector applied for analysis, and an ESI source applied to the LC-MS spectrometer.
Both spectrometers were equipped with an Agilent Zorbax SB-C18 column, 2.1X 30mm, 5 μm. The injection volume is determined by the sample concentration; the flow rate is 0.6 mL/min; peaks of HPLC were recorded by UV-Vis wavelength at 210 nm and 254 nm. The mobile phases were 0.1% formic acid in acetonitrile (phase a) and 0.1% formic acid in ultrapure water (phase B). Gradient elution conditions are shown in table 1:
table 1: gradient elution conditions
Time (min) A(CH3CN,0.1％HCOOH) B(H2O,0.1％HCOOH)
0-3 5-100 95-0
3-6 100 0
6-6.1 100-5 0-95
6.1-8 5 95
Compound purification was assessed by Agilent 1100 series High Performance Liquid Chromatography (HPLC) with UV detection at 210 nm and 254nm, a Zorbax SB-C18 column, 2.1X 30mm, 4 μm, 10min, flow rate 0.6 mL/min, 5-95% (0.1% formic acid in acetonitrile) in (0.1% formic acid in water), the column temperature was maintained at 40 ℃.
The following acronyms are used throughout the invention:
AcOK Potassium acetate
MeCN,CH3CN acetonitrile
MeOH methanol
DCM,CH2Cl2Methylene dichloride
DBU 1, 8-diazabicycloundec-7-enes
D2Heavy O water
DMSO dimethyl sulfoxide
DMF N, N-dimethylformamide
DMAP 4-dimethylaminopyridine
DIBAH diisobutylaluminum hydride
DMF-DMA N, N-dimethylformamide dimethyl acetal
CHCl3Chloroform, chloroform
dppf 1,1' -bis (diphenylphosphino) ferrocene
CDC13Deuterated chloroform
CCl4Carbon tetrachloride
Boc tert-butyloxycarbonyl group
Boc2Di-tert-butyl O dicarbonate
Bn benzyl group
PE Petroleum Ether
Pd(dba)2Bis (dibenzylideneacetone) palladium
Pd2(dba)3Tris (dibenzylideneacetone) dipalladium
Ph phenyl
PTSA para-toluenesulfonic acid
EtOAc, EA ethyl acetate
EtOH ethanol
HCl hydrochloric acid
K2CO3Potassium carbonate
NaHCO3Sodium bicarbonate
NH4OAc ammonium acetate
NaOH sodium hydroxide
NaBH3CN Cyanoborohydride sodium salt
NaCl sodium chloride
Na2SO4Sodium sulfate
n-Bu n-butyl
Et3N, TEA Triethylamine
NBS N-bromosuccinimide
H2O water
mL of
min for
m-CPBA m-chloroperoxybenzoic acid
h hours
RT, RT Room temperature
Rt Retention time
H2Hydrogen gas
HATU 2- (7-azobenzotriazol) -N, N, N ', N' -tetramethyluronium hexafluorophosphate
HCl/EtOAc hydrogen chloride in ethyl acetate
HOAt 1-hydroxy-7-azobenzotriazol
DIPEA N, N-diisopropylethylamine
DCC N, N' -dicyclohexylcarbodiimide
DMA N, N' dimethylacetamide
DME ethylene glycol dimethyl ether
THF tetrahydrofuran
TFA trifluoroacetic acid
Tf trifluoromethanesulfonyl
LiOH.H2O-lithium hydroxide monohydrate
IPA isopropyl alcohol
CuCN cuprous cyanide
CH3OH methanol
N2Nitrogen gas
NH4Cl ammonium chloride
NH4OAc ammonium acetate
Ac2O acetic anhydride
Xantphos 4, 5-bis diphenylphosphine-9, 9-dimethylxanthene
t1/2Half life
t-BuOH tert-butanol
AUC area under the time curve
Vss steady state apparent distribution volume
Clearance of CL, clearance
Bioavailability of F, absolute bioavailalability
Dose of Dose
TmaxTime to peak
CmaxMaximum concentration
hr*ng/mL blood concentration time
Synthesis method
The following synthetic schemes set forth the synthetic procedures for preparing the compounds disclosed in the present invention. Wherein each R is3、R4、R5、R6、X1And X2Having the meaning as described in the present invention, X is halogen and MS is methylsulfonyl. R1bIs C1-6Alkyl or C3-6A cycloalkyl group.
Synthesis scheme 1
Figure BDA0002214794320000321
Formula (II)(a-16)The compounds shown can be prepared by the methods described in scheme 1. First, the compound(a-1)Reacting with ethylene glycol to form a compound(a-2)Of a compound(a-2)And compounds(a-3)In the presence of a palladium catalyst (e.g. Pd (dba)2、Pd2(dba)3Etc.), ligand (such as Xantphos, etc.) and appropriate base (such as sodium tert-butoxide, etc.) and in appropriate solvent (such as THF, toluene, etc.) to produce compound(a-4). Compound (I)(a-4)And NH4OAc in reducing agents (e.g. NaBH)3CN, etc.) in a suitable solvent (such as methanol, etc.) to produce a compound(a-5). Compound (I)(a-5)With formic acid or ethyl formate in a suitable solvent (e.g., 1,4 dioxane, tetrahydrofuran, etc.) to form the compound(a-6). Then, the compound(a-6)With phosphorus oxychloride in a suitable solvent (e.g., DCM, etc.) to form the compound(a-7). Next, the compound(a-7)And compounds(a-8)Or a compound(a-9)Cyclizing in a suitable solvent (such as isopropanol, ethanol, DMSO, etc.) to give compound(a-10). Compound (I)(a-10)With chloranil, dehydrogenating in proper solvent (DME, etc.) to produce compound(a-11). Compound (I)(a-11)Removing benzyl protecting group to obtain compound(a- 12). Compound (I)(a-12)With N-phenylbis (trifluoromethanesulfonyl) imide under basic conditions (e.g. triethylamine, etc.) and where appropriateIn a solvent (e.g. dichloromethane, etc.) to produce a compound(a-13). Finally, the compounds(a-13)And compounds(a-14)Under the action of palladium catalyst (such as bis (triphenylphosphine) palladium dichloride, etc.) and in proper solvent (such as 1,4 dioxane, etc.), making coupling reaction to obtain the invented compound(a-16)Or a compound(a-13)And compounds(a-15)Under the action of palladium catalyst (such as tetratriphenylphosphine palladium, etc.), coupling reaction is carried out in proper solvent (such as 1,4 dioxane, etc.) and proper alkali (such as sodium carbonate, potassium phosphate, potassium carbonate, etc.) to generate compound(a-16)。
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Preparation examples
In the following preparation examples, the inventors described in detail the preparation of the compounds of the present invention by taking some of the compounds of the present invention as examples. Intermediate: 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester
Step 1: 1- (2- (benzyloxy) -4-bromophenyl) ethanone
Figure BDA0002214794320000331
In a single neck flask was added 4-bromo-2-hydroxyacetophenone (20g,93mmol), potassium carbonate (25.7g,186mmol), acetonitrile (100mL) and benzyl bromide (12.2mL,103 mmol). The reaction mixture was heated to 70 ℃ and stirred for 2h, then cooled to room temperature, filtered to remove solids, and the filtrate was concentrated under reduced pressure to give the title compound as a white solid (28g, 99%).
Step 2: 2- (2- (benzyloxy) -4-bromophenyl) -2-methyl-1, 3-dioxolane
Figure BDA0002214794320000332
To a reaction flask was added 1- (2- (benzyloxy) -4-bromophenyl) ethanone (28.1g,92mmol), ethylene glycol (10mL,184mmol), cyclohexane (200mL), triethyl orthoformate (31mL,190mmol), and p-toluenesulfonic acid (1.8g,9.2 mmol). The reaction mixture was heated to 40 ℃ and stirred for 24h, then concentrated under reduced pressure. The resulting residue was diluted with 100mL of saturated sodium bicarbonate solution, extracted with ethyl acetate (200 mL. times.2), and the organic phases were combined. The combined organic phases were washed with 30mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate and concentrated under reduced pressure to give the title compound as a pale yellow oil (32g, 99%).
MS(ESI,pos.ion)m/z:371.1[M+Na]+。
And step 3: 1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butanone
Figure BDA0002214794320000333
Into a single neck flask were added 2- (2- (benzyloxy) -4-bromophenyl) -2-methyl-1, 3-dioxolane (32.0g,91.6mmol), 3-methyl-2-butanone (19.7mL,184mmol), sodium tert-butoxide (17.6g,183mmol), tetrahydrofuran (400mL), tris (dibenzylideneacetone) dipalladium (3.76g,6.41mmol), and XantPhos (3.83g,6.42 mmol). The reaction mixture was replaced with nitrogen 3 times, heated to 60 ℃, stirred for 4h, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 10/1) to give the title compound as a pale yellow solid (23.34g, 72%).
MS(ESI,pos.ion)m/z:355.1[M+H]+。
And 4, step 4: 1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butanamine
Figure BDA0002214794320000334
1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butanone (30g,84.7mmol), methanol (150mL) and ammonium acetate (32.6g,423mmol) were added to a single-neck flask, the mixture was stirred at room temperature for 1h under nitrogen, NaBH was added at 0 deg.C3CN (8g,130mmol), held at 0 ℃ and stirred for a further 24 h. After the reaction, the mixture was concentrated under reduced pressure, and the obtained residue was added with 1 in order00mL of water and 30mL of 10% sodium hydroxide solution, followed by extraction with ethyl acetate (200 mL. times.3), and the organic phases were combined. The combined organic phases were washed with 50mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound as a colorless oil (30.0g, 99.7%).
MS(ESI,pos.ion)m/z:356.1[M+H]+。
And 5: n- (1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butane Yl) carboxamides
Figure BDA0002214794320000341
To a single-necked flask was added 1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butylamine (0.69g,1.9mmol) and ethyl formate (10 mL). The reaction mixture was stirred under reflux for 12h, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 1/1) to give the title compound as a colorless oil (0.3g, 40%).
MS(ESI,pos.ion)m/z:384.4[M+H]+。
Step 6:1- (6- (benzyloxy) -3-isopropyl-3, 4-dihydroisoquinolin-7-yl) ethanone
Figure BDA0002214794320000342
In a single-neck flask were added N- (1- (3- (benzyloxy) -4- (2-methyl-1, 3-dioxolan-2-yl) phenyl) -3-methyl-2-butyl) carboxamide (0.30g,0.78mmol) and dichloromethane (5 mL). The mixture was cooled to 0 ℃ in a cold bath and phosphorus oxychloride (0.36mL,3.9mmol) was added. The reaction was stirred at rt for 12h, then concentrated under reduced pressure and the residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 20/1) to afford the title compound as a tan viscous mass (0.20g, 80%).
MS(ESI,pos.ion)m/z:322.3[M+H]+。
And 7: 10-acetyl-9- (benzyloxy) -6-isopropyl-2-oxo-2, 6,7,11 b-tetrahydro-1H-pyrido [2,1-a]Isoquinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000343
To a single-necked flask were added 1- (6- (benzyloxy) -3-isopropyl-3, 4-dihydroisoquinolin-7-yl) ethanone (3.1g,9.6mmol), ethyl 2- (ethoxymethylene) -3-oxo-butyrate (3.6g,19.3mmol) and ethanol (30mL), and the reaction mixture was heated to 90 ℃ and stirred for 12 h. After completion of the reaction, the reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 1/1) to give the title compound as a brown solid (4.0g, 90%).
MS(ESI,pos.ion)m/z:462.4[M+H]+。
And 8: 10-acetyl-9- (benzyloxy) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a] Isoquinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000344
To a single-necked flask were added ethyl 10-acetyl-9- (benzyloxy) -6-isopropyl-2-oxo-2, 6,7,11 b-tetrahydro-1H-pyrido [2,1-a ] isoquinoline-3-carboxylate (4.50g,9.75mmol), tetrachlorobenzoquinone (4.53g,18.4mmol) and ethylene glycol dimethyl ether (50 mL). The reaction mixture was heated to 80 ℃ and stirred for 2h, then concentrated under reduced pressure and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 10/1) to afford the title compound as a grey solid (3.9g, 87%).
MS(ESI,pos.ion)m/z:460.1[M+H]+。
And step 9: 10-acetyl-9-hydroxy-6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ]]Isoquine Quinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000351
Ethyl 10-acetyl-9- (benzyloxy) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (3.1g) and methanol (30mL) were added to a single-neck flask, the mixture was replaced with hydrogen 3 times and stirred under a hydrogen balloon at room temperature for 8H, then the palladium/carbon was removed by filtration through celite, the filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 10/1) to afford the title compound as a tan solid (2.7g, 86%).
MS(ESI,pos.ion)m/z:370.1[M+H]+。
Step 10: 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro- 2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000352
In a two-necked flask DCM (10mL), 10-acetyl-9-hydroxy-6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester (0.50g,1.4mmol) and triethylamine (0.38mL,2.7mmol) were added. The mixture was cooled to 0 ℃, N-phenylbis (trifluoromethanesulfonyl) imide (0.53g,1.5mmol) was added portionwise and allowed to stir at room temperature for 12h, then concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 10/1) to afford the title compound as a yellow solid (0.65g, 95%).
Example 1: 10-acetyl-9- (2-isobutylthiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000353
Step 1: 2-isobutyl-4-bromothiazole
Figure BDA0002214794320000354
Isobutyl zinc chloride (10mL,5mmol,0.5mol/L) was added to a 25mL two-necked flask with nitrogen blanket and Pd was added slowly2(dba)3A solution of (50mg), dppf (60mg) and 2, 4-dibromothiazole (486mg,2.00mmol) in THF (10mL) was stirred at room temperature overnight after the addition. Quenching the reaction with 5mL of saturated aqueous ammonium chloride solution, extracting with EA (20 mL. times.3), combining the organic phases, concentrating, and separating the residue by silica gel column chromatographyPurification by (PE) gave the title compound as a colorless oil (260mg,1.18mmol, 59%).
MS(ESI,pos.ion)m/z：220.0[M+H]+。
Step 2: 2-isobutyl-4- (tri-n-butylstannyl) thiazole
Figure BDA0002214794320000361
4-bromo-2-isobutylthiazole (200mg,0.91mmol) was dissolved in THF (5mL), and after three nitrogen replacements, the temperature was lowered to-78 deg.C, stirring was carried out for 30min, n-butyllithium (0.47mL,1.2mmol,2.5mol/L) was added and stirring was carried out for 30min, then tri-n-butyltin chloride (0.30mL,1.09mmol) was added and stirring was carried out for 1 h. The solvent was concentrated, 10mL of petroleum ether was added, filtered, and the filter cake was washed with petroleum ether (30mL) and concentrated to give the title compound as a colorless oil (0.39g,0.91mmol, 100%).
MS(ESI,pos.ion)m/z：432.2[M+H]+。
And step 3: 10-acetyl-9- (2-isobutylthiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyri dine Pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000362
Ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (100mg,0.20mmol) was dissolved in 1, 4-dioxane (10mL) and 2-isobutyl-4- (tri-n-butylstannyl) thiazole (103mg,0.24mmol) and bis triphenylphosphine palladium dichloride (34mg,0.048mmol) were added, followed by warming to 100 ℃ and stirring overnight. The temperature was reduced to room temperature, then the solvent was concentrated, and the resulting residue was purified by thin layer chromatography to give the title compound as a white solid (23mg,0.050mmol, 25%).
MS(ESI,pos.ion)m/z：465.2[M+H]+；
1H NMR(400MHz,CDCl3)δ(ppm)15.672(b,1H),8.537(s,1H),7.919(s,1H),7.644(s,1H),7.419(s,1H),7.250(s,1H),4.053–3.958(m,1H),3.503–3.398(m,1H),3.331–3.240(m,1H),2.950(d,J＝6.8Hz,2H),2.350(s,3H),2.213–2.121(m,1H),1.835–1.713(m,1H),1.057(d,J＝6.8Hz,6H),0.998(d,J＝2.8,3H),0.874(d,J＝6.4,3H)。
Example 2: 10-acetyl-6-isopropyl-9- (2- (isopropylamino) thiazol-4-yl) -2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000371
Step 1: 4-bromo-N-isopropylthiazol-2-amine
Figure BDA0002214794320000372
To a reaction flask were added 2, 4-dibromothiazole (2g,8.23mmol), DMF (15mL), potassium carbonate (3.45g,24.70mmol) and isopropylamine (0.486g,8.22mmol), followed by heating to 70 ℃ for 24 h. Water (50mL) and ethyl acetate (50mL) were added to dilute, the solution was separated, the organic phase was washed with saturated brine (50mL × 1), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 1/4) to give the title compound as a brown solid (0.40g,1.82mmol, 22.1%). MS (ESI, pos. ion) m/z: 221.0[ M + H]+。
Step 2: (4-Bromothiazol-2-yl) (isopropyl) carbamic acid tert-butyl ester
Figure BDA0002214794320000373
4-bromo-N-isopropylthiazol-2-amine (1.32g,6.0mmol) was dissolved in dichloromethane (20mL), triethylamine (1.68mL,12.0mmol) and 4-dimethylaminopyridine (0.74g,5.98mmol) were added, di-tert-butyl dicarbonate (1.5mL,6.5mmol) was added dropwise while cooling on ice, and after completion of the dropwise addition, the mixture was allowed to warm to room temperature for 12 h. The TLC check reaction was complete, concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 10/1) to give the title compound as a yellow oily liquid (1.75g,5.45mmol, 91.0%).
MS(ESI,pos.ion)m/z：265.0[M+H]+。
And step 3: isopropyl (4- (tri-n-butylstannyl) thiazol-2-yl) carbamic acid tert-butyl ester
Figure BDA0002214794320000374
Tert-butyl (4-bromothiazol-2-yl) (isopropyl) carbamate (1.5g,4.7mmol) was dissolved in tetrahydrofuran (15mL), cooled to-78 deg.C, and n-butyllithium (3.5mL,5.6mmol) was added dropwise, and the reaction was allowed to incubate for 1h after the addition was complete. Tributyltin chloride (1.8mL,6.2mmol) was added dropwise and after completion of the addition, the reaction mixture was transferred to room temperature for 12 h. The reaction was monitored by TLC for completion, the solvent was dried by evaporation, diluted with petroleum ether (50mL), filtered to remove insoluble solids, and the filtrate was dried by evaporation to give the title compound as a brown oily liquid (2.5g,4.7mmol, 100%) which was used directly in the next step.
And 4, step 4: 10-acetyl-9- (2- ((tert-butoxycarbonyl) (isopropyl) amino) thiazol-4-yl) -6-isopropyl- 2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000381
To a reaction flask was added ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (0.2g,0.4mmol), tert-butyl isopropyl (4- (tri-n-butylstannyl) thiazol-2-yl) carbamate (0.4g,0.8mmol), palladium bis (triphenylphosphine) dichloride (0.05g,0.07mmol) and 1, 4-dioxane (20mL) and heated to 100 ℃ under nitrogen for 12H. The reaction was run to completion by TLC, the solvent was dried and the resulting residue was purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 8/1) to give the title compound as a dark brown solid (0.23g,0.41mmol, 100%) which was used directly in the next reaction.
MS(ESI,pos.ion)m/z：566.2[M+H]+。
And 5: 10-acetyl-6-isopropyl-9- (2- (isopropylamino) thiazol-4-yl) -2-oxo-6, 7-dihydro- 2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000382
A solution of hydrogen chloride in 1, 4-dioxane (20mL,80mmol,4.0mol/L) was added to the reaction flask and cooled to 0 ℃. 10-acetyl-9- (2- ((tert-butoxycarbonyl) (isopropyl) amino) thiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid (0.23g,0.41mmol) was dissolved in 5mL of an ethyl acetate solution, which was then added dropwise to a reaction flask, and after completion of the addition, the reaction mixture was warmed to room temperature and stirred for reaction for 12H. After the reaction is finished, a potassium carbonate solution is dripped in ice bath to adjust the pH value to be neutral, then 50mL of ethyl acetate is used for extraction, 100mL of water is added into the organic layer, and the pH value is adjusted to be more than 9 by potassium carbonate. The layers were separated and the aqueous phase was adjusted to neutral pH with 1M hydrochloric acid, extracted with ethyl acetate (100 mL. times.3), the organic phases combined, then dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give the title compound as a yellow solid (0.03g,0.06mmol, 20%).
MS(ESI,pos.ion)m/z：466.2[M+H]+；
1H NMR(600MHz,CD3OD)δ(ppm)8.79(s,1H),8.36(s,1H),7.65(s,1H),7.51(s,1H),7.37(s,1H),4.41(s,1H),3.91–3.80(m,1H),3.47(dd,J＝42.8,15.6Hz,2H),2.66(s,3H),1.78–1.67(m,1H),1.42–1.20(m,7H),0.99(d,J＝6.6Hz,3H),0.84(d,J＝6.6Hz,3H)。
Example 3: 10-acetyl-9- (2-N, N-dimethylaminothiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000383
Step 1: 4-bromo-N, N-dimethylthiazol-2-amine
Figure BDA0002214794320000391
2, 4-Dibromothiazole (2.6g,11mmol) and N-methylmethylamine hydrochloride (1.7g,21mmol) were added to a 100mL one-necked flask, DBU (4.8mL,32mmol) was added after cooling to 0 deg.C, and the mixture was stirred overnight at room temperature. The reaction system was diluted with water (100mL), followed by extraction with EA (50mL × 4), the organic phases were combined, washed with saturated brine (30mL × 3), the combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure, and the resulting residue was purified by thin layer chromatography (PE/EA (V/V) ═ 10/1) to give the title compound as a white solid (1.62g,7.82mmol, 73%).
MS(ESI,pos.ion)m/z：207.0[M+H]+。
Step 2: n, N-dimethyl-4- (tri-N-butylstannyl) thiazole
Figure BDA0002214794320000392
4-bromo-N, N-dimethylthiazol-2-amine (1.22g,5.89mmol) was dissolved in diethyl ether (8mL), cooled to-78 deg.C, and stirred for 20 min. N-butyllithium (4.8mL,7.7mmol,1.6mol/L) was added and stirred for 30 min. Tri-n-butyltin chloride (1.95mL,7.07mmol) was added, stirred for 30min, then warmed to room temperature and stirred overnight. KF (0.685g,11.8mmol) was added, stirred for 10min, then filtered, petroleum ether (50mL) was added to rinse the filter cake, and the filtrate was concentrated under reduced pressure to give the title compound as a light yellow oil (2.46g,5.90mmol, 100%).
MS(ESI,pos.ion)m/z：419.1[M+H]+
And step 3: 10-acetyl-9- (2-N, N-dimethylaminothiazol-4-yl) -6-isopropyl-2-oxo-6, 7-di hydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000393
Ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (0.20g,0.40mmol), N-dimethyl-4- (tri-N-butylstannyl) thiazole (500mg,1.198mmol), anhydrous 1, 4-dioxane (15mL), and bis triphenylphosphine palladium dichloride (84mg,0.119mmol) were added to a 50mL single vial, then nitrogen blanketed, warmed to 100 ℃ and stirred overnight. After the reaction was complete, the temperature was reduced to room temperature, the solvent was concentrated, and the resulting residue was separated by silica gel column chromatography (DCM/MeOH (V/V) ═ 10/1) and then by thin layer chromatography (DCM/MeOH (V/V) ═ 15/1) to give a crude product which was isolated by preparative chromatography to give the title compound as a yellow solid (10mg,0.022mmol, 5.6%).
MS(ESI,pos.ion)m/z：452.2[M+H]+；
1H NMR(400MHz,CDCl3)δ(ppm)15.77(b,1H),8.500(s,1H),7.826(s,1H),7.343(s,1H),7.210(s,1H),7.194(s,1H),3.980–3.914(m,1H),3.446–3.384(m,1H),3.287–3.238(m,1H),3.205(s,6H),2.431(s,3H),2.079–1.994(m,1H),0.992(d,J＝4.4Hz,3H),0.867(d,J＝4.0Hz,3H)。
Example 4: 10-acetyl-9- (2-chlorothiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000401
Step 1: 2-chloro-4- (tri-n-butylstannyl) thiazole
Figure BDA0002214794320000402
4-bromo-2-chlorothiazole (300mg,1.51mmol) was dissolved in THF (5mL), the temperature was then reduced to-78 deg.C, n-butyllithium (1.9mL,3.0mmol,1.6mol/L) was added, stirring was continued for 30min, tri-n-butyltin chloride (0.459mL,1.66mmol) was added, stirring was continued for 1h, and the mixture was transferred to 0 deg.C and stirred overnight. Added water (10mL) was diluted and extracted with EA (20mL × 3), the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound as a yellow oil (0.6176g,1.512mmol, 100.0%).
MS(ESI,pos.ion)m/z：410.0[M+H]+。
Step 2: 10-acetyl-9- (2-chlorothiazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000403
Ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (120mg,0.2393mmol), 2-chloro-4- (tri-n-butylstannyl) thiazole (508mg,1.243mmol), anhydrous 1, 4-dioxane (10mL), bis triphenylphosphine palladium dichloride (41mg,0.059mmol) was added to a 50mL single vial, then stirred under nitrogen, warmed to 110 ℃ for 2 days. Cool to rt and concentrate under reduced pressure, and the resulting residue is isolated by column chromatography (DCM/MeOH (V/V) ═ 10/1) to give the title compound as a pale yellow solid (19mg,0.043mmol, 18%).
MS(ESI,pos.ion)m/z：443.0[M+H]+；
1H NMR(400MHz,CDCl3)δ(ppm)15.694(b,1H),8.532(s,1H),7.860(s,1H),7.652(s,1H),7.405(s,1H),7.243(s,1H),4.088–3.907(m,1H),3.541–3.380(m,1H),3.351–3.218(m,1H),2.452(s,3H),2.065–1.964(m,1H),0.981–0.862(m,6H)。
Example 5: 10-acetyl 6-isopropyl-9- (2- (2-methoxyethyl) thiazol-4-yl) -2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000404
Step 1: 2- (4-Bromothiazol-2-yl) ethanol
Figure BDA0002214794320000411
2, 4-dibromothiazole (5.1g,21mmol) and diethyl ether (125mL) were added to a 250mL two-necked flask, cooled to-78 ℃ under nitrogen, and stirred for 30 min. N-butyllithium (8.4mL,21mmol,2.5mol/L) was then added by syringe, stirring was continued for another 20min, propylene oxide (7.0mL,21mmol,3mol/L) was slowly added by syringe, stirring was continued for 10min, a solution of boron trifluoride diethyl ether (2.6mL,21mmol) in diethyl ether (15mL) was added, and stirring was continued for another 20 min. The reaction was quenched with saturated ammonium chloride solution (15mL), after addition was complete, stirred for 10min, then warmed to room temperature, extracted with EA (100mL × 3), the organic phases combined, the combined organic phases dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the resulting residue chromatographed on silica gel (PE/EA (V/V) ═ 1/1) to give the title compound as a brown oil (1.25g,6.01mmol, 29%).
MS(ESI,pos.ion)m/z：208.0[M+H]+。
Step 2: 4-bromo-2- (2-methoxyethyl) thiazole
Figure BDA0002214794320000412
NaH (2.07g,51.75mmol) was added to a 100mL two-necked flask, the temperature was reduced to-10 deg.C, THF (30mL) was added, and stirring was continued for 10 min. Then a solution of 2- (4-bromothiazol-2-yl) ethanol (5.38g,25.87mmol) in THF (30mL) was added dropwise, stirred for 1h, and CH was added slowly3I (3.22mL,51.7mmol) and then stirred at-10 ℃ overnight. After completion of the reaction, the reaction solution was slowly quenched with 15mL of water, followed by extraction with EA (35mL × 3), the organic phases were combined, concentrated under reduced pressure, and the resulting residue was separated by silica gel column chromatography (PE/EA (V/V) ═ 10/1) to give the title compound as a pale yellow oil (3.23g,14.5mmol, 56.2%).
MS(ESI,pos.ion)m/z：222.0[M+H]+。
And step 3: 2- (2-methoxyethyl) -4- (tri-n-butylstannyl) thiazole
Figure BDA0002214794320000413
4-bromo-2- (2-methoxyethyl) thiazole (500mg,2.25mmol) was dissolved in diethyl ether (5mL), then cooled to-78 deg.C and stirred for 30 min. N-butyllithium (1.2mL,3.0mmol,2.5mol/L) was added and stirred for 1h, then tri-n-butyltin chloride (0.75mL,2.7mmol) was added and stirred for 1h, then stirred at room temperature overnight. 1g of KF was added, stirred for 10min, diluted with 10mL of petroleum ether, filtered, the cake was washed with 50mL of petroleum ether, and the filtrate was concentrated to give the title compound as a yellow oil (0.9730g,2.251mmol, 100.0%) which was directly charged into the next reaction.
MS(ESI,pos.ion)m/z：434.1[M+H]+。
And 4, step 4: 10-acetyl 6-isopropyl-9- (2- (2-methoxyethyl) thiazol-4-yl) -2-oxo-6, 7-di hydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000421
Ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (200mg,0.40mmol), 2- (2-methoxyethyl) -4- (tri-n-butylstannyl) thiazole (517mg,1.20mmol), anhydrous 1, 4-dioxane (10mL), and bis-triphenylphosphine palladium dichloride (69mg,0.10mmol) were added to a 50mL single vial, then stirred overnight at 100 ℃ under nitrogen blanket. The solvent was concentrated and the resulting residue was isolated by silica gel column chromatography (DCM/MeOH (V/V) ═ 15/1) to give crude product which was further isolated by preparative chromatography to give the title compound as a white solid (30mg,0.064mmol, 16.12%).
MS(ESI,pos.ion)m/z：467.2[M+H]+；
1H NMR(400MHz,CDCl3)δ(ppm)15.777(b,1H),8.524(s,1H),7.839(s,1H),7.636(s,1H),8.438(s,1H),8.241(s,1H),3.993–3.955(m,1H),3.813(t,J＝4.4Hz,4.0Hz,2H),3.477–3.449(m,1H),3.436(s,3H),3.338–3.297(m,3H),2.338(s,3H),1.822–1.751(m,1H),0.986(d,J＝4.4Hz,3H),0.866(d,J＝4.8Hz,3H)。
Example 6: 10-acetyl-6-isopropyl-9- (5- (morpholinomethyl) thiazol-2-yl) -2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000422
Step 1: 4- ((2-bromothiazol-5-yl) methyl) morpholine
Figure BDA0002214794320000423
2-bromo-5- (bromomethyl) thiazole (2g,7.78mmol), DMF (10mL), anhydrous potassium carbonate (1.63g,11.67mmol) and morpholine (0.68g,7.78mmol) were added sequentially to the reaction flask and reacted at 70 ℃ for 30 h. The reaction was completed by TLC, 100mL of water was added, followed by extraction with 100mL of ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE/EA (V/V) ═ 5/1) to give the title compound as a pale yellow oily liquid (1.17g,4.45mmol, 57.1%).
MS(ESI,pos.ion)m/z：263.0[M+H]+。
Step 2: 4- ((2- (tri-n-butylstannyl) thiazol-5-yl) methyl) morpholine
Figure BDA0002214794320000424
4- ((2-bromothiazol-5-yl) methyl) morpholine (1.17g,4.45mmol) was added to the reaction flask, dissolved in THF (10mL), cooled to-78 ℃ under nitrogen, and then a solution of n-butyllithium in n-hexane (3.3mL,5.3mmol,1.6mol/L) was slowly added dropwise, after completion of the addition, the reaction was stirred for 1 h. Then tri-n-butyltin chloride (1.88g,5.78mmol) was slowly added dropwise, and after completion of the addition, the reaction was transferred to room temperature for 12 hours. After the reaction, concentration under reduced pressure was carried out, 30mL of petroleum ether was added to precipitate solid impurities, and the filtrate was filtered and spin-dried to obtain the title compound as a yellow oily liquid (2.10g,4.44mmol, 99.8%) which was used in the next reaction.
And step 3: 10-acetyl-6-isopropyl-9- (5- (morpholinomethyl) thiazol-2-yl) -2-oxo-6, 7-dihydro- 2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000431
To a reaction flask was added ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate (0.3g,0.6mmol), 4- ((2- (tri-n-butylstannyl) thiazol-5-yl) methyl) morpholine (0.6g,1mmol), bis (triphenylphosphine) palladium dichloride (0.1g,0.1mmol) and 1, 4-dioxane (20mL) and heated to 100 ℃ under nitrogen for 12H. Concentrated under reduced pressure and the resulting residue purified by silica gel column chromatography (DCM/MeOH (V/V) ═ 5/1) to give the title compound as a light yellow solid (0.078g,0.15mmol, 20%).
MS(ESI,pos.ion)m/z：508.3[M+H]+；
1H NMR(400MHz,CDCl3)δ(ppm)15.72(s,1H),8.54(d,J＝19.0Hz,1H),7.80(s,1H),7.72(s,1H),7.64(s,1H),7.23(s,1H),4.06(dd,J＝9.7,4.5Hz,1H),3.80(s,2H),3.77–3.71(m,4H),3.49(dd,J＝16.3,5.0Hz,1H),3.31(d,J＝16.3Hz,1H),2.56(s,4H),2.43(s,3H),1.78–1.71(m,1H),0.99(d,J＝6.6Hz,3H),0.86(d,J＝6.7Hz,3H)。
Example 7: 10-acetyl-6-isopropyl-9- (1- (oxetan-3-yl) -1H-pyrazol-4-yl) -2-oxo-6-, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000432
Step 1: 10-acetyl-6-isopropyl-9- (1- (oxetan-3-yl) -1H-pyrazol-4-yl) -2-oxo- 6-, 7-dihydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid ethyl ester
Figure BDA0002214794320000441
10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2, 1-a) was added to the reaction flask]Isoquinoline-3-carboxylic acid ethyl ester (200mg,0.54mmol), 1- (oxetan-3-yl) -4- (4,4,5, 5-tetramethyl-1, 3, 2-dioxaborolan) -1H-pyrazole (0.27g,1.1mmol), Pd (PPh)3)4(65mg,0.056mmol)、K2CO3(0.23g,1.6mmol) and 1, 4-dioxane (10mL) were reacted under nitrogen at 110 ℃ for 12 h. LCMS detects that the raw materials are completely reacted, the reaction liquid is filtered, the filtrate is concentrated, and the next reaction is directly carried out.
MS(ESI,pos.ion)m/z：476.2[M+1]+。
And step 3: 10-acetyl-6-isopropyl-9- (1- (oxetan-3-yl) -1H-pyrazol-4-yl) -2-oxo- 6-, 7-dihydro-2H-pyrido [2,1-a ]]Isoquinoline-3-carboxylic acid
Figure BDA0002214794320000442
The crude ethyl 10-acetyl-6-isopropyl-9- (1- (oxetan-3-yl) -1H-pyrazol-4-yl) -2-oxo-6-, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate synthesized in the previous step was dissolved in 10mL of methanol and LiOH (0.11g,2.6mmol) was added and stirred at room temperature for 4H. The reaction was adjusted to pH 6-7 with 1M HCl, then extracted with DCM (30mL × 2), the organic phases were combined, concentrated under reduced pressure, the residue was chromatographed over silica gel (DCM/MeOH (V/V) ═ 15/1) to give crude product, which was slurried with 10mL methanol, filtered and dried to give the title compound as a white solid product (60mg,0.13mmol, 26%).
MS(ESI,pos.ion)m/z：448.2[M+1]+；
1H NMR(400MHz,CDCl3)δ(ppm)15.78(s,1H),8.54(s,1H),7.86(s,1H),7.78(s,1H),7.74(s,1H),7.38(s,1H),7.22(s,1H),5.58–5.44(m,1H),5.10(d,J＝6.7Hz,4H),4.09–3.89(m,1H),3.49–3.21(m,2H),2.41(s,3H),1.82–1.74(m,1H),0.98(d,J＝6.5Hz,3H),0.86(d,J＝6.6Hz,3H)。
Example 8: 10-acetyl-6-isopropyl-2-oxo-9- (thiazol-2-yl) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000443
Starting from 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester and 2- (tri-n-butylstannanyl) thiazole, the synthesis of step 3 referenced example 1 gave the title compound as a white solid.
MS(ESI,pos.ion)m/z：409.1[M+H]+；
1H NMR(400MHz,CDCl3)δ8.53(s,1H),7.95(d,J＝2.6Hz,1H),7.82(s,1H),7.66(s,1H),7.52(d,J＝2.5Hz,1H),7.23(s,1H),4.01(s,1H),3.83–3.56(m,1H),3.48(s,1H),3.32(s,1H),2.40(s,3H),0.98(d,J＝6.2Hz,3H),0.85(d,J＝6.2Hz,3H).
Example 9: 10-acetyl-9- (1- (difluoromethyl) -1H-pyrazol-4-yl) -6-isopropyl-2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000451
Starting from ethyl 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylate and 1-difluoromethyl-4- (4,4,5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) -1H-pyrazole, reference the synthesis of example 7 gave the title compound as a white solid.
1H NMR(400MHz,CDCl3)δ(ppm)15.80(s,1H),8.54(s,1H),8.02–7.62(m,3H),7.75(s,1H),7.39(s,1H),7.23(s,1H),4.01(s,1H),3.83–3.56(m,1H),3.48(s,1H),3.32(s,1H),2.40(s,3H),0.98(d,J＝6.2Hz,3H),0.85(d,J＝6.2Hz,3H)。
Example 10: 10-acetyl-6-isopropyl-9- (2-isopropylthiazol-4-yl) -2-oxo-6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid
Figure BDA0002214794320000452
Starting from 10-acetyl-6-isopropyl-2-oxo-9- (((trifluoromethyl) sulfonyl) oxy) -6, 7-dihydro-2H-pyrido [2,1-a ] isoquinoline-3-carboxylic acid ethyl ester and 2-isopropyl-4- (tributylstannyl) thiazole, the synthesis of step 3 of reference example 1 gave the title compound as a white solid.
MS(ESI,pos.ion)m/z：451.4[M+H]+；
1H NMR(400MHz,CDCl3)δ15.778(b,1H),8.517(s,1H),7.824(s,1H),7.628(s,1H),7.430(s,1H),7.239(s,1H),3.979–3.956(m,1H),3.473–3.438(m,1H),3.392–3.346(m,1H),3.334–3.283(m,1H),2.358(s,3H),1.817–1.767(m,1H),1.463(d,J＝4.8Hz,6H),0.989(d,J＝4.8Hz,3H),0.867(d,J＝4.4Hz,3H)。
Biological activity assay
HBV cell line
HepG2.2.15 cells (SELLS, PNAS,1987 and SELLS, JV,1988) have the entire HBV genome integrated into their chromosomes and stably express viral RNA and viral proteins. HepG2.2.15 cells secrete mature hepatitis B virus particles and HBsAg into the culture medium. Virion DNA and HBsAg secreted by hepg2.2.15 cells can be quantified by qPCR and ELISA methods and the effect of compounds on viral replication and HBsAg secretion is thereby detected.
Test 1: inhibition of HBV viral replication by Compounds of the invention
The experimental method comprises the following steps:
HepG2.2.15 cells 8,000 cells per well were seeded into 96-well cell culture plates in duplicate and cultured for 3 days until the cells grew to full well. Cells were treated with 4-fold serial dilutions of compounds for 10 days, dosed every other day with a final concentration of 0.5% DMSO in all wells and DMSO was used as no drug control. Supernatants were harvested on day 11 for quantitative detection of HBV DNA.
The qPCR method is used for detecting the virus genome DNA, and HBV primers are as follows:
HBV-For-202，CAGGCGGGGTTTTTCTTGTTGA(SEQ ID NO:1)；
HBV-Rev-315，GTGATTGGAGGTTGGGGACTGC(SEQ ID NO:2)。
using SYBR Premix Ex Taq II-Takara DRR081S kit, 1. mu.L of cell culture supernatant was used as a template, a standard curve was made with a plasmid containing HBV genome, and the virus copy number was calculated from the standard curve. Concentration-viral copy number was processed with Graphpad Prism 5 software and IC for compound inhibition of viral replication was calculated by a four-parameter non-linear regression model50。
And (4) conclusion: the inhibition experiment of the compound on HBV virus replication shows that the compound has good inhibition activity on HBV DNA replication, wherein the IC of the compound on the HBV DNA replication inhibition activity50Less than 0.1. mu.M, of most compounds on HBVDNAIC for replication inhibition activity50Less than 0.05. mu.M.
The inhibitory activity of some compounds of the present invention on HBV DNA replication is shown in Table 2.
Table 2: replication inhibitory Activity of partial Compounds of the present invention on HBV DNA
Examples DNA IC50(nM)
Example 1 4.9
Example 2 10.61
Example 3 5.24
Example 4 8.76
Example 6 11.3
And (3) testing 2: inhibition of HBsAg secretion by Compounds of the invention
The experimental method comprises the following steps:
HepG2.2.15 cells 8,000 cells per well were seeded into 96-well cell culture plates in duplicate and cultured for 3 days until the cells grew to full well. Cells were treated with 4-fold serial dilutions of compounds for 10 days, dosed every other day with a final concentration of 0.5% DMSO in all wells and DMSO was used as no drug control. Supernatants were harvested on day 11 for HBsAg quantification.
The level of HBsAg secreted by cells after compound treatment was measured using ELISA method using hepatitis B surface antigen diagnostic kit (Shanghai Kowa bioengineering, Inc. S10910113). 25 μ L of test supernatant (diluted to 75 μ L in PBS) was added to each well of the ELISA plate, and a positive control and a negative control of the kit were set. After blocking the ELISA plates with mounting paper, incubation was carried out at 37 ℃ for 60 minutes. The ELISA plate was removed, the mounting was removed and 50. mu.L of enzyme conjugate was added to each well. The plate was shaken on a shaker for 10 seconds, sealed with mounting paper and incubated at 37 ℃ for 30 minutes. The ELISA plate was removed, the mounting paper was torn off, and the washing was repeated 5 times: discarding liquid in the holes each time, adding washing liquid to fill each hole, standing for 60 seconds, spin-drying, and patting dry liquid residues on absorbent paper. Immediately after washing, a freshly prepared mixture of developer a and developer B was added to all wells: 100 μ L per well. After blocking the ELISA plates with mounting paper with shaking on a shaker for 10 seconds, incubation was carried out at 37 ℃ for 30 minutes. Add 50. mu.L stop solution to all wells. Read at a wavelength of 450nm on an Envision plate reader. The concentration-HBsAgOD 450 value data is processed by Graphpad Prism 5 software, and the IC of the compound on HBsAg secretion inhibition is calculated by a four-parameter nonlinear regression model50。
And (4) conclusion: the compound of the invention has an inhibition experiment on HBsAg secretion. The compound has good inhibitory activity to HBsAg secretion, wherein the IC of the compound has inhibitory activity to HBsAg secretion50IC of inhibitory Activity of most Compounds on HBsAg secretion less than 0.1. mu.M50Less than 0.05. mu.M.
The inhibitory activity of the partial compounds of the present invention against HBsAg secretion is the result shown in Table 3.
Table 3: inhibitory Activity of partial Compounds of the present invention against HBsAg secretion
Examples HBsAg IC50(nM)
Example 1 7.85
Example 3 9.54
And (3) testing: pharmacokinetic experiments of the compounds of the invention in beagle dogs, mice and rats
(1) Beagle PK test experiment
PK assay experiment of the compound of the present invention in beagle dogs (body weight 10-12kg, male, age 10-12 months, 3 per group orally, 3 per group intravenously)
The experimental method comprises the following steps:
beagle dogs were administered 2.5mg/kg or 5mg/kg by oral gavage or 1mg/kg or 2mg/kg by intravenous injection of the test compound.
Blood was collected intravenously at time points (0.083, 0.25, 0.5, 1,2,4, 6, 8 and 24 hours) after administration and collected at the time of EDTA-K addition2In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.
And (4) conclusion: experiments show that the compound has better pharmacokinetic property in beagle dogs and has good application prospect in the aspect of HBV resistance.
(2) Mouse PK test experiment
Experiments on the PK assay of the compounds of the invention in ICR mice (weight 20-25g, male, age 45-60 days, 3 per group orally, 3 per group intravenously)
The experimental method comprises the following steps:
ICR mice were orally gavaged with 10mg/kg or injected via the tail vein with 2mg/kg or 10mg/kg of the test compound. Blood was collected at time points (0.083, 0.25, 0.5, 1,2,4, 6, 8 and 24 hours) from the orbital vein after administration and collected by adding EDTA-K2In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.
And (4) conclusion: experiments show that the compound has better pharmacokinetic property in an ICR mouse body and has good application prospect in the aspect of anti-HBV virus.
(3) SD rat PK test experiment
PK assay experiment of the compound of the present invention in SD rats (body weight 200-
The experimental method comprises the following steps:
SD rats were dosed either 2.5mg/kg or 5mg/kg per oral gavage or 1mg/kg per intravenous injection of the test compound. Blood was collected intravenously at time points (0.083, 0.25, 0.5, 1,2,5, 7 and 24 hours) after administration and collected by adding EDTA-K2In the anticoagulation tube. Plasma samples were subjected to liquid-liquid extraction and then quantitatively analyzed by multiplex reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using a non-compartmental model using WinNonlin 6.3 software.
And (4) conclusion: experiments show that the compound has better pharmacokinetic property in SD rats and has good application prospect in the aspect of HBV resistance.
And (4) testing: stability testing of Compounds of the invention in liver microsomes of different species
The experimental method comprises the following steps:
30. mu.L of a mixed solution of the blank solution and the liver microsomes was added to a 96-well plate, and 15. mu.L of a buffer containing the compound to be detected was added to each well, and two samples were prepared in parallel. After pre-incubation at 37 ℃ for 10min, 15. mu.L of NADPH solution (8mM) was added at 0min, 15min, 20min and 60min, the final concentration of the test compound was 1. mu.M, the concentration of liver microsomes was 0.1mg/mL, and the final concentration of NADPH was 2 mM. Incubate for 0, 15, 30, 60min, respectively, and add 150 μ L acetonitrile (containing internal standard) to the mixed system after incubation. The acetonitrile diluted sample was centrifuged at 4000rpm for 5min and 150. mu.L of the supernatant was taken to LC-MS/MS for analysis.
And (4) conclusion: experiments show that the compound has better stability in liver microsomes of different species.

Claims (22)

1. A compound which is a compound of formula (I) or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (I) or a prodrug thereof, wherein:
Figure FDA0002214794310000011
each X1And X2Independently is CR7Or N;
R1is R1aO-or RaRbN-；
R2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4RxSubstituted by 1,2 or 3RxSubstituted;
or, R2Is C1-4Alkoxy radicals, in the meantime, R3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is1-4Alkoxy is unsubstituted or substituted by 1,2,3 or 4RwAnd (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
each RxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is8-C1-4C in alkylene1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
R8is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-6Alkyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhSubstituted;
each RkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein the amino group, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl or C3-7Cycloalkyl, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl and C3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6HalogenatedAlkoxy or C1-6Substituted by alkylamino;
each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, C1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently is H, deuterium, C1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy or C1-6Substituted by alkylamino.
2. A compound which is a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, a pharmaceutically acceptable salt of a compound of formula (II) or a prodrug thereof, wherein:
Figure FDA0002214794310000021
each X1And X2Independently is CR7Or N;
R1is R1aO-or RaRbN-；
R2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl consisting of 6 to 10 ring atoms, phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, heteroaryl of 6 to 10 ring atoms, phenyl or naphthyl are each independently unsubstituted or substituted by 1,2,3 or 4RxSubstituted;
or, R2Is C1-4Alkoxy radicals, in the meantime, R3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl or heteroaryl consisting of 6 to 10 ring atoms, wherein, the C is1-4Alkoxy is unsubstituted or substituted by 1,2,3 or 4RwAnd (b) substituted, said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl and heteroaryl of 6 to 10 ring atoms each independently being unsubstituted or substituted with 1,2,3 or 4Rx1Substituted;
each RxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein R is8-C1-4C in alkylene1-4Alkylene, amino, C1-12Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkSubstituted;
R8is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-6Alkyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhSubstituted;
each RkAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl or heteroaryl of 5 to 10 ring atoms, wherein the ammonia isBase, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-7Cycloalkyl, heterocyclic radical consisting of 3-10 ring atoms, C6-10Aryl and heteroaryl of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl or C3-7Cycloalkyl, wherein said amino, C1-6Alkyl radical, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Alkylamino radical, C2-6Alkenyl radical, C2-6Alkynyl and C3-7Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy radical, C1-6Alkylthio radical, C1-6Haloalkoxy or C1-6Substituted by alkylamino;
each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, C1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl or heterocyclyl consisting of 3 to 10 ring atoms, wherein said C is1-6Alkyl radical, C1-6Alkylamino radical, C1-6Alkoxy radical, C2-6Alkynyl, C2-6Alkenyl radical, C3-7Cycloalkyl and heterocyclyl consisting of 3 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently is H, deuterium, C1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl of 3 to 6 ring atoms or heteroaryl of 5 to 10 ring atoms, wherein C is1-6Alkyl radical, C1-6Alkoxy radical, C2-6Alkenyl radical, C2-6Alkynyl, C3-6Cycloalkyl radical, C6-10Aryl, heterocyclyl consisting of 3 to 6 ring atoms and heteroaryl consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-6Alkyl radical, C1-6Haloalkyl, C1-6Alkoxy or C1-6Substituted by alkylamino.
3. The compound of claim 1 or 2, wherein R is2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4RxSubstituted by 1,2 or 3RxSubstituted;
or, R2Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is3Is pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4RwAnd (b) said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4Rx1And (4) substituting.
4. The compound of claim 1 or 2, wherein R is2Is HO-, RaRbN-, methyl, ethyl, N-propyl, isopropyl, N-butyl or tert-butyl, wherein the methyl, ethyl, N-propyl, isopropyl, N-butyl and tert-butyl are each independently unsubstituted or substituted by 1,2 or 3RwSubstituted;
R3is furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms and heteroaryl of 10 ring atoms, phenyl or naphthyl; wherein said furyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4RxSubstituted;
or, R2Is methoxy, ethoxy, n-propoxy, isopropoxy or tert-butoxy, and R is3Is pyrroleA group selected from the group consisting of a phenyl group, a naphthyl group, a triazolyl group, a tetrazolyl group, an oxazolyl group, an isoxazolyl group, an oxadiazolyl group, a thiazolyl group, a thienyl group, a pyridyl group, a 1,3, 5-triazinyl group, a pyrazinyl group, a pyridazinyl group, a pyrimidinyl group, a heteroaryl group; wherein said methoxy, ethoxy, n-propoxy, isopropoxy and tert-butoxy are unsubstituted or substituted with 1,2,3 or 4RwAnd (b) said pyrrolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thienyl, pyridyl, 1,3, 5-triazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, heteroaryl of 9 ring atoms, heteroaryl of 10 ring atoms, phenyl and naphthyl are each independently unsubstituted or substituted with 1,2,3 or 4Rx1And (4) substituting.
5. The compound of claim 1 or 2, wherein each R isxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-C1-3Alkylene, amino, C1-6Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein R is as defined above8-C1-3C in alkylene1-3Alkylene, amino, C1-6Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, naphthyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RkAnd (4) substituting.
6. The compound of claim 1 or 2, wherein each R isxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-CH2-、R8-(CH2)2-、R8-(CH2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is a radical selected from the group consisting of8-CH2-CH of (A-O-)2-、R8-(CH2)2In- (CH)2)2-、R8-(CH2)3In- (CH)2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted with 1,2,3 or 4RkAnd (4) substituting.
7. The compound of claim 1 or 2, wherein each R isxAnd Rx1Independently is deuterium, F, Cl, Br, HO-, HOOC-, RaRbN-、R8-CH2-、R8-(CH2)2-、R8-(CH2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, or pyrimidinyl, wherein R is optionally substituted with one or more substituents selected from the group consisting of alkyl, aryl, heteroaryl, and heteroaryl, wherein R is optionally substituted with one or more substituents selected from the group consisting of alkyl, heteroaryl, and heteroaryl8-CH2-CH of (A-O-)2-、R8-(CH2)2In- (CH)2)2-、R8-(CH2)3In- (CH)2)3-, amino, methyl, ethyl, n-propyl, isopropyl, 3-methyl-1-butyl, 3-dimethyl-butyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4RkAnd (4) substituting.
8. The compound of claim 1 or 2, wherein each R is8Is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C6-10Aryl, heteroaryl of 5 ring atoms or heteroaryl of 6 ring atoms, wherein said amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclic radical consisting of 3-6 ring atoms, C6-10Aryl, heteroaryl of 5 ring atoms and heteroaryl of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently is C1-4Alkyl radical, C3-6Cycloalkyl or heterocyclyl consisting of 3 to 6 ring atoms, wherein said C is1-4Alkyl radical, C3-6Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RhAnd (4) substituting.
9. The compound of claim 1 or 2, wherein R is8Is F, Cl, Br, CN, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, pyridyl, thiazolyl, triazolyl, thiazolyl, and the like,Isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said amino, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl each independently unsubstituted or substituted by 1,2,3 or 4RfSubstituted;
each R10And R11Independently methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, and piperazinyl are each independently unsubstituted or substituted with 1,2,3, or 4RhAnd (4) substituting.
10. The compound of claim 1 or 2, wherein each R iskAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-4Alkyl radical, C1-6Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein said amino, C1-4Alkyl radical, C1-6Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, C3-6Cycloalkyl, heterocyclyl consisting of 3 to 6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, Cl, Br, CN, OH, ═ O, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Haloalkoxy or C1-4Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, HOOC-, amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl or C3-6Cycloalkyl, wherein said amino, C1-4Alkyl radical, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl and C3-6Cycloalkyl is independently of one another unsubstituted or substituted by 1,2,3 or 4 substituents selected from the group consisting of F, Cl, Br, CN, HO-, -O, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy radical, C1-4Alkylthio radical, C1-4Haloalkoxy or C1-4Substituted by alkylamino.
11. The compound of claim 1 or 2, wherein each R iskAnd RfIndependently is deuterium, F, Cl, Br, HO-, HOOC-, R10-(C＝O)-N(Rc)、R11-S(＝O)2-N(Rc) -, amino, C1-3Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said amino, C, t-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl is substituted with one or more substituents selected from the group consisting of alkyl, alkoxy, pyridyl1-3Alkyl, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, ═ O, amino, C1-3Alkyl radical, C1-3Haloalkyl, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Haloalkoxy or C1-3Substituted by alkylamino;
each RhAnd RwIndependently is deuterium, F, Cl, Br, HO-, ═ O, HOOC-, amino, C1-3Alkyl radical, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl or C3-6Cycloalkyl, wherein said amino, C1-3Alkyl radical, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Alkylamino radical, C2-4Alkenyl radical, C2-4Alkynyl and C3-6Cycloalkyl is each independently unsubstituted or substituted by 1,2,3 or 4 substituents selected from F, Cl, Br, CN, amino, C1-3Alkyl radical, C1-3Haloalkyl, C1-3Alkoxy radical, C1-3Alkylthio radical, C1-3Haloalkoxy or C1-3Substituted by alkylamino.
12. The compound of claim 1 or 2, each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl radical, C3-6Cycloalkyl or heterocyclic group consisting of 3 to 6 ring atoms, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl radical, C3-6Cycloalkyl and heterocyclyl consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted by 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, and the like,Thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy or C1-4Substituted by alkylamino.
13. The compound of claim 1 or 2, each R4、R5、R6、R7And R9Independently hydrogen, deuterium, F, Cl, Br, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, or piperazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, C1-4Alkylamino radical, C1-4Alkoxy radical, C2-4Alkynyl, C2-4Alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydronaphthylPyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl are each independently unsubstituted or substituted with 1,2,3 or 4RwSubstituted;
each R1a、Ra、RbAnd RcEach independently of the others is H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, C-triazinyl, thiazolyl or pyrimidinyl is substituted with one or more substituents selected from the group consisting of alkyl, alkoxy, pyridyl, pyrimidinyl, pyridyl1-4Alkoxy radical, C2-4Alkenyl radical, C2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxetanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3, 5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, and pyrimidinyl each independently unsubstituted or substituted by 1,2,3, or 4 substituents selected from F, Cl, Br, CN, HO-, amino, C1-4Alkyl radical, C1-4Haloalkyl, C1-4Alkoxy or C1-4Substituted by alkylamino.
14. A compound according to claim 1 or 2, comprising a compound of one of:
Figure FDA0002214794310000061
Figure FDA0002214794310000071
Figure FDA0002214794310000081
Figure FDA0002214794310000091
Figure FDA0002214794310000101
Figure FDA0002214794310000102
or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof.
15. A pharmaceutical composition comprising a compound of any one of claims 1-14; optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant or a combination of said adjuvants.
16. The pharmaceutical composition according to claim 15, further comprising an additional anti-HBV agent.
17. The pharmaceutical composition according to claim 16, wherein the other anti-HBV agent is an HBV polymerase inhibitor, an immunomodulator or an interferon.
18. The pharmaceutical composition of claim 17, wherein the other anti-HBV agent is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simon interleukin, cladribine, emtricitabine, famciclovir, interferon, calamin CP, intefine, interferon α -1b, interferon α, interferon α -2a, interferon β -1a, interferon α -2, interleukin-2, mevoxil, nitazoxanide, peginterferon α -2a, ribavirin, roscovitine-a, cezopyran, Euforavac, april, phosziphad, hepisiva, interferon α -2b, levamisole, or propafege.
19. Use of a compound of any one of claims 1-14 or a pharmaceutical composition of any one of claims 15-18 in the manufacture of a medicament for preventing, treating or ameliorating a viral disease in a patient.
20. The use of claim 19, wherein the viral disease is hepatitis b virus infection or a disease caused by hepatitis b virus infection.
21. The use of claim 20, wherein the disease caused by hepatitis b virus infection is cirrhosis or hepatocellular carcinoma.
22. Use of a compound according to any one of claims 1 to 14 or a pharmaceutical composition according to any one of claims 15 to 18 in the manufacture of a medicament for inhibiting the production or secretion of HBsAg, and/or for inhibiting the production of HBV DNA.
CN201910911197.7A 2018-09-26 2019-09-25 Fused tricyclic compound and application thereof in medicines Active CN110950860B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2018111211339 2018-09-26
CN201811121133 2018-09-26

Publications (2)

Publication Number Publication Date
CN110950860A true CN110950860A (en) 2020-04-03
CN110950860B CN110950860B (en) 2023-03-31

Family

ID=69976501

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910911197.7A Active CN110950860B (en) 2018-09-26 2019-09-25 Fused tricyclic compound and application thereof in medicines

Country Status (1)

Country Link
CN (1) CN110950860B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10966970B2 (en) * 2017-06-01 2021-04-06 Sunshine Lake Pharma Co., Ltd. Fused tricyclic compounds and uses thereof in medicine
US11447498B2 (en) 2018-09-30 2022-09-20 Sunshine Lake Pharma Co., Ltd. Fused tetracyclic compounds and uses thereof in medicine
CN115515595A (en) * 2020-05-15 2022-12-23 福建广生中霖生物科技有限公司 Combination for treating hepatitis B
US11938134B2 (en) 2017-03-10 2024-03-26 Eikonizo Therapeutics, Inc. Metalloenzyme inhibitor compounds
US12128044B2 (en) 2018-08-28 2024-10-29 Sunshine Lake Pharma Co., Ltd. Fused tricyclic compounds and uses thereof in medicine

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016071215A1 (en) * 2014-11-03 2016-05-12 F. Hoffmann-La Roche Ag Novel 6,7-dihydrobenzo[a]quinolizin-2-one derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2016128335A1 (en) * 2015-02-11 2016-08-18 F. Hoffmann-La Roche Ag Novel 2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid derivatives for the treatment and prophylaxis of hepatitis b virus infection
CN105899508A (en) * 2014-01-30 2016-08-24 豪夫迈·罗氏有限公司 Novel dihydroquinolizinones for the treatment and prophylaxis of hepatitis B virus infection
WO2017017043A1 (en) * 2015-07-28 2017-02-02 F. Hoffmann-La Roche Ag Novel 6,7-dihydropyrido[2,1-a]phthalazin-2-ones for the treatment and prophylaxis of hepatitis b virus infection
CN106810548A (en) * 2017-01-13 2017-06-09 上海爱科百发生物医药技术有限公司 A kind of dihydroisoquinoliness compound
CN107759585A (en) * 2016-07-29 2018-03-06 银杏树药业(苏州)有限公司 A kind of isoquinoline compound and its Pharmaceutical composition and the application as antiviral drugs
WO2018154466A1 (en) * 2017-02-21 2018-08-30 Glaxosmithkline Intellectual Property Development Limited Dihydroquinolizinones as antivirals
CN108976223A (en) * 2017-06-01 2018-12-11 广东东阳光药业有限公司 Fused tricyclic class compound and its application in drug
WO2019100735A1 (en) * 2017-11-22 2019-05-31 Sunshine Lake Pharma Co., Ltd. Fused tricyclic compounds and uses thereof in medicine
CN110066278A (en) * 2017-06-01 2019-07-30 广东东阳光药业有限公司 Fused tricyclic class compound and its application in drug

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105899508A (en) * 2014-01-30 2016-08-24 豪夫迈·罗氏有限公司 Novel dihydroquinolizinones for the treatment and prophylaxis of hepatitis B virus infection
WO2016071215A1 (en) * 2014-11-03 2016-05-12 F. Hoffmann-La Roche Ag Novel 6,7-dihydrobenzo[a]quinolizin-2-one derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2016128335A1 (en) * 2015-02-11 2016-08-18 F. Hoffmann-La Roche Ag Novel 2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2017017043A1 (en) * 2015-07-28 2017-02-02 F. Hoffmann-La Roche Ag Novel 6,7-dihydropyrido[2,1-a]phthalazin-2-ones for the treatment and prophylaxis of hepatitis b virus infection
CN107759585A (en) * 2016-07-29 2018-03-06 银杏树药业(苏州)有限公司 A kind of isoquinoline compound and its Pharmaceutical composition and the application as antiviral drugs
CN106810548A (en) * 2017-01-13 2017-06-09 上海爱科百发生物医药技术有限公司 A kind of dihydroisoquinoliness compound
WO2018130152A1 (en) * 2017-01-13 2018-07-19 苏州爱科百发生物医药技术有限公司 Dihydroisoquinoline compound
WO2018154466A1 (en) * 2017-02-21 2018-08-30 Glaxosmithkline Intellectual Property Development Limited Dihydroquinolizinones as antivirals
CN108976223A (en) * 2017-06-01 2018-12-11 广东东阳光药业有限公司 Fused tricyclic class compound and its application in drug
CN110066278A (en) * 2017-06-01 2019-07-30 广东东阳光药业有限公司 Fused tricyclic class compound and its application in drug
WO2019100735A1 (en) * 2017-11-22 2019-05-31 Sunshine Lake Pharma Co., Ltd. Fused tricyclic compounds and uses thereof in medicine

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11938134B2 (en) 2017-03-10 2024-03-26 Eikonizo Therapeutics, Inc. Metalloenzyme inhibitor compounds
US10966970B2 (en) * 2017-06-01 2021-04-06 Sunshine Lake Pharma Co., Ltd. Fused tricyclic compounds and uses thereof in medicine
US12128044B2 (en) 2018-08-28 2024-10-29 Sunshine Lake Pharma Co., Ltd. Fused tricyclic compounds and uses thereof in medicine
US11447498B2 (en) 2018-09-30 2022-09-20 Sunshine Lake Pharma Co., Ltd. Fused tetracyclic compounds and uses thereof in medicine
CN115515595A (en) * 2020-05-15 2022-12-23 福建广生中霖生物科技有限公司 Combination for treating hepatitis B

Also Published As

Publication number Publication date
CN110950860B (en) 2023-03-31

Similar Documents

Publication Publication Date Title
CN110066278B (en) Fused tricyclic compound and application thereof in medicines
AU2018351400B2 (en) Dihydropyrimidine compounds and uses thereof in medicine
CN110950860B (en) Fused tricyclic compound and application thereof in medicines
CN108976223B (en) Fused tricyclic compound and application thereof in medicines
KR102665544B1 (en) Dihydropyrimidine compounds and their use in medicine
CA3045371C (en) Inhibitors of influenza virus replication and uses thereof
EP3694856A1 (en) Fused tricyclic compounds and uses thereof in medicine
CN113166154B (en) Deuterated dihydropyrimidine compound and application thereof in medicines
CN111116577A (en) Fused tetracyclic compounds and application thereof in medicines
CN110964023B (en) Fused tetracyclic compounds and application thereof in medicines
CN107793409B (en) Dihydropyrimidine compound and application thereof in medicine
CN111848627B (en) Dihydropyrimidine compound and application thereof in medicine
CN111825676B (en) Dihydropyrimidine compounds and application thereof in medicines
CN110862390B (en) Fused tricyclic compounds and application thereof in medicines
CN111217811B (en) Fused tricyclic compounds and application thereof in medicines
CN111116588B (en) Fused tetracyclic compound and application thereof in medicines
CN113493441B (en) Novel spiro compound and application thereof in medicines
CN110903284B (en) Fused tricyclic compounds and application thereof in medicines
CN114685514A (en) Novel amide pyrrole compound and application thereof in medicines
CN114805362A (en) Novel amide pyrrole compound and application thereof in medicines
CN113831359A (en) Dihydropyrimidine compound and application thereof in medicine
US12128044B2 (en) Fused tricyclic compounds and uses thereof in medicine
CN113135937A (en) Fused tetracyclic compounds and application thereof in medicines
CN113444102A (en) Fused tetracyclic compounds and application thereof in medicines
CN117143109A (en) Fused tetracyclic compound and application thereof in medicines

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address
CP03 Change of name, title or address

Address after: 523808 No.1, Gongye North Road, Songshanhu Park, Dongguan City, Guangdong Province

Patentee after: Guangdong Dongyangguang Pharmaceutical Co.,Ltd.

Address before: 523808 No. 1 Industrial North Road, Songshan Industrial Park, Songshan, Guangdong, Dongguan, Hubei

Patentee before: SUNSHINE LAKE PHARMA Co.,Ltd.