CN111808820A - Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology - Google Patents
Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology Download PDFInfo
- Publication number
- CN111808820A CN111808820A CN202010485365.3A CN202010485365A CN111808820A CN 111808820 A CN111808820 A CN 111808820A CN 202010485365 A CN202010485365 A CN 202010485365A CN 111808820 A CN111808820 A CN 111808820A
- Authority
- CN
- China
- Prior art keywords
- myod1
- cells
- sequence
- mdbk
- crisprcas9
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000003209 gene knockout Methods 0.000 title claims abstract description 14
- 238000000034 method Methods 0.000 title claims abstract description 13
- 108091027544 Subgenomic mRNA Proteins 0.000 claims abstract description 12
- 239000013612 plasmid Substances 0.000 claims description 17
- 241000713666 Lentivirus Species 0.000 claims description 9
- 230000000694 effects Effects 0.000 claims description 8
- 230000004544 DNA amplification Effects 0.000 claims description 6
- 238000004806 packaging method and process Methods 0.000 claims description 6
- 238000012216 screening Methods 0.000 claims description 5
- 239000002502 liposome Substances 0.000 claims description 4
- 239000013598 vector Substances 0.000 claims description 4
- 108010043121 Green Fluorescent Proteins Proteins 0.000 claims description 3
- 238000012258 culturing Methods 0.000 claims description 3
- 238000003113 dilution method Methods 0.000 claims description 3
- 239000005090 green fluorescent protein Substances 0.000 claims description 3
- 108090000623 proteins and genes Proteins 0.000 abstract description 11
- 241000700605 Viruses Species 0.000 abstract 1
- 239000007788 liquid Substances 0.000 abstract 1
- 230000008844 regulatory mechanism Effects 0.000 abstract 1
- 241000283690 Bos taurus Species 0.000 description 26
- 108020004414 DNA Proteins 0.000 description 15
- 108091033409 CRISPR Proteins 0.000 description 4
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 3
- 238000001514 detection method Methods 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 2
- 238000010354 CRISPR gene editing Methods 0.000 description 2
- 108091028113 Trans-activating crRNA Proteins 0.000 description 2
- 230000009471 action Effects 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 238000007877 drug screening Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 208000021601 lentivirus infection Diseases 0.000 description 2
- 244000144972 livestock Species 0.000 description 2
- 230000007246 mechanism Effects 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 241000203069 Archaea Species 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 108020005004 Guide RNA Proteins 0.000 description 1
- 101150013833 MYOD1 gene Proteins 0.000 description 1
- 101710163270 Nuclease Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000003255 drug test Methods 0.000 description 1
- 231100000221 frame shift mutation induction Toxicity 0.000 description 1
- 230000037433 frameshift Effects 0.000 description 1
- 238000010362 genome editing Methods 0.000 description 1
- 230000007124 immune defense Effects 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000009126 molecular therapy Methods 0.000 description 1
- 239000013600 plasmid vector Substances 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 230000008685 targeting Effects 0.000 description 1
- 238000001890 transfection Methods 0.000 description 1
- 230000009261 transgenic effect Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0684—Cells of the urinary tract or kidneys
- C12N5/0686—Kidney cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for constructing a MyoD1 gene knockout MDBK cell line by using CRISPRCAS9 technology, wherein the method comprises the step of knocking out MyoD1 gene by infecting MDBK cells by sgRNA virus liquid carrying MyoD1 gene, and the MyoD1 gene knockout MDBK cells can be used for downstream research of MyoD1 gene function and relevant regulation mechanism or passage.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for constructing a MyoD1 gene knockout MDBK cell line based on an CRISPRCAS9 technology.
Background
CRISPRCAS9 the technology is a technology means for carrying out gene editing widely at present, compared with the prior editing means, the technology is high-efficient, accurate in targeting and easy to operate, the experimental period is shortened, and the experimental cost is reduced. CRISPRCAS9 is the immune defense mechanism formed by bacteria and archaea in long-term evolution, and the typical action mechanism is that crRNA (CRISPR-derivedRNA) is combined with tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA/crRNA complex, and the complex guides the nuclease Cas9 protein to cut double-stranded RNA at the sequence target site paired with the crRNA. By designing the two RNAs, sgRNA (short guide RNA) with guiding function is formed to guide the site-specific cleavage of the DNA by Cas9, and the action principle is shown in the figure. Us researchers published articles on molecular therapy of 2012 for editing DNA sequences of organisms using CRISPR technology and developed model-related studies for studying diseases and drug tests, and the CRISPR technology was widely used thereafter. CRISPRCAS 9-based technology has great significance in disease treatment, breeding transgenic livestock and the like.
Disclosure of Invention
The purpose of the invention is: the method for constructing the MyoD1 gene knockout MDBK cell line based on the CRISPRCAS9 technology is high in knockout success rate and easy to operate.
The invention is realized by the following steps: a method for constructing an MDBK cell line with Myod1 gene knockout based on CRISPRCAS9 technology comprises the steps of designing sgRNAs according to a CDS sequence (NM-001040478.2) of a MyoD1 gene of a cow, and inserting 4 groups of designed sgRNAs into a lentiCRISPR v2 vector; transferring the plasmid containing the green fluorescent protein gene GFP into MDBK cells by using liposome 2000 (Invitrogen); adopting a gradient dilution method to dilute the MDBK cells to 1/100/100 mu L, transferring the MDBK cells to a 96-well plate, and adding 100 mu L of MDBK cells into each well; monoclonal 1 × 96 wells were co-plated, and after a 12-day growth cycle, the core plasmid was grown up in a single clone and the obtained core plasmid was packaged into lentivirus to infect target cells.
The core plasmid packaging lentivirus infection target cell comprises the following steps:
(1) transfecting a 6-well plate 293T cell according to the ratio of a core plasmid lentiCRISPR v2-MyoD1-sgRNA to psPAX2 p to pMD2G which is 2: 1, and respectively packaging into lentiviruses containing the sgRNAs;
(2) mixing the packaged 4 lentiviruses and infecting MDBK cells of the same well twice;
(3) after 48 hours, 2 mug/mL puro is added for screening, cells which are successfully infected are obtained, and the culture is continued for 48 hours;
(4) adding puro with the concentration of 2 mu g/mL for secondary screening, and continuing culturing for 48 hours until the cells which are not successfully infected die basically;
(5) extracting a part of mixed cells to obtain a genome DNA amplification target spot, and detecting the integral knockout effect;
(6) and the rest cells are divided into 96-well plates according to the density of 1 cell per well, the cells are expanded into 24-well plates after full growth, the cells are expanded into 6-well plates after full growth, and each well takes part of cells to extract a genome DNA amplification target spot to detect the knockout effect.
The 4 sgRNAs are respectively as follows:
due to the adoption of the technical scheme, compared with the conventional gene knockout technology, the MyoD1 gene is knocked out at a fixed point by utilizing the CRISPRCAS9 technology, the MyoD1 gene can be knocked out quickly, accurately and specifically, the experiment period is shortened, and the experiment cost is reduced.
Description of the drawings:
fig. 1 is a drug-screening concentration of sgRNA recombinant plasmid in an example of the present invention, wherein 2 μ g/mL puro can be used as a subsequent drug-screening concentration;
FIG. 2 shows the transfection efficiency of liposomes 2000 in an example of the present invention;
FIG. 3 shows the efficiency of monoclonal vector production in examples of the present invention;
FIG. 4 is a graph showing the results of electrophoretic detection of lentivirus-infected MDBK monoclonal cells carrying the sgRNA of MyoD1 gene in examples of the present invention, wherein M denotes DNA Marker, and 1, 3, 4, 5, 6, 7, 8, 9, 11 and 12 denote lentivirus-infected MDBK cells;
FIG. 5 is a graph showing the results of electrophoretic detection for verifying the gene knockout effect of a target sequence in the example of the present invention, wherein M denotes a DNA Marker, and 5, 6, 7, and 8 denote lentivirus-infected MDBK cells;
fig. 6 is a graph showing the results of electrophoretic detection of sgRNA6 in the example of the present invention, wherein 21 lanes are #1, #3, # 4, # 5, # 6, # 9, # 10, 11, # Marker, # 13, # 14, 15, 17, 19, # 20, 21, 22, 25, 26, 27, and # 28 from left to right;
FIG. 7 is a diagram showing the result of cell sequencing identification in FIG. 6, wherein the coding regions of MyoD1 of the monoclonal # 3 and #22 target genes are both deleted in a way other than 3nbp, which can cause frame shift mutation during translation, and the 2 monoclonal MyoD1 genes are judged to be successfully knocked out from the genome level;
fig. 8 is a plasmid map of the plasmid vector lentiCRISPR v2 used in the examples of the present invention;
fig. 9 is a sequencing double-peak diagram of the product of example 5 of the present invention, in which an obvious set of peaks is observed near the sgRNA6 of the target gene, and the sgRNA6 is judged to have higher activity.
FIG. 10 is a schematic diagram of the present process.
Detailed Description
The embodiment of the invention comprises the following steps: a method for constructing a MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology comprises the steps of designing sgRNAs according to a CDS sequence (NM-001040478.2) of a MyoD1 gene of a cow, and inserting 4 groups of designed sgRNAs into a lentiCRISPR v2 vector; transferring the plasmid containing the green fluorescent protein gene GFP into MDBK cells by using liposome 2000 (Invitrogen); adopting a gradient dilution method to dilute the MDBK cells to 1/100/100 mu L, transferring the MDBK cells to a 96-well plate, and adding 100 mu L of MDBK cells into each well; monoclonal 1 × 96 wells were co-plated, and after a 12-day growth cycle, the core plasmid was grown up in a single clone and the obtained core plasmid was packaged into lentivirus to infect target cells.
The core plasmid packaging lentivirus infection target cell comprises the following steps:
(1) transfecting a 6-well plate 293T cell according to the ratio of a core plasmid lentiCRISPR v2-MyoD1-sgRNA to psPAX2 p to pMD2G which is 2: 1, and respectively packaging into lentiviruses containing the sgRNAs;
(2) mixing the packaged 4 lentiviruses and infecting MDBK cells of the same well twice;
(3) after 48 hours, 2 mug/mL puro is added for screening, cells which are successfully infected are obtained, and the culture is continued for 48 hours;
(4) adding puro with the concentration of 2 mu g/mL for secondary screening, and continuing culturing for 48 hours until the cells which are not successfully infected die basically;
(5) extracting a part of mixed cells to obtain a genome DNA amplification target spot, and detecting the integral knockout effect;
(6) and the rest cells are divided into 96-well plates according to the density of 1 cell per well, the cells are expanded into 24-well plates after full growth, the cells are expanded into 6-well plates after full growth, and each well takes part of cells to extract a genome DNA amplification target spot to detect the knockout effect.
The 4 sgRNAs are respectively as follows:
sequence listing
<110> Guizhou province breeding livestock and poultry germplasm determination center
<120> method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology
<160>12
<170>SIPOSequenceListing 1.0
<210>1
<211>23
<212>DNA
<213> cattle (cattle)
<400>1
gcatggtagc agccttgcgg ngg 23
<210>2
<211>24
<212>DNA
<213> cattle (cattle)
<400>2
caccgcatgg tagcagcctt gcgg 24
<210>3
<211>24
<212>DNA
<213> cattle (cattle)
<400>3
aaacccgcaa ggctgctacc atgc 24
<210>4
<211>24
<212>DNA
<213> cattle (cattle)
<400>4
aaacccgcaa ggctgctacc atgc 24
<210>5
<211>24
<212>DNA
<213> cattle (cattle)
<400>5
caccgccagg cgcgtaaaag gcag 24
<210>6
<211>24
<212>DNA
<213> cattle (cattle)
<400>6
aaacctgcct tttacgcgcc tggc 24
<210>7
<211>23
<212>DNA
<213> cattle (cattle)
<400>7
gactaacgcc gaccgccgca ngg 23
<210>8
<211>24
<212>DNA
<213> cattle (cattle)
<400>8
caccgactaa cgccgaccgc cgca 24
<210>9
<211>24
<212>DNA
<213> cattle (cattle)
<400>9
aaactgcggc ggtcggcgtt agtc 24
<210>10
<211>23
<212>DNA
<213> cattle (cattle)
<400>10
gcagcgtttg agcgtctcga ngg 23
<210>11
<211>24
<212>DNA
<213> cattle (cattle)
<400>11
caccgcagcg tttgagcgtc tcga 24
<210>12
<211>24
<212>DNA
<213> cattle (cattle)
<400>12
aaactcgaga cgctcaaacg ctgc 24
Claims (3)
1. A method for constructing a MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology, which is characterized by comprising the following steps: inserting designed 4 groups of sgRNAs into a lentiCRISPR v2 vector; transferring the plasmid containing the green fluorescent protein gene GFP into MDBK cells by using liposome 2000 (Invitrogen); adopting a gradient dilution method to dilute the MDBK cells to 1/100/100 mu L, transferring the MDBK cells to a 96-well plate, and adding 100 mu L of MDBK cells into each well; monoclonal 1 × 96 wells were co-plated, and after a 12-day growth cycle, the core plasmid was grown up in a single clone and the obtained core plasmid was packaged into lentivirus to infect target cells.
2. The method of claim 1 for constructing a MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology, wherein the step of packaging the core plasmid into a lentivirus-infected target cell comprises the steps of:
(1) according to the core plasmid lentiCRISPR v2-MyoD 1-sgRNA: psPAX2 p: pmd2.g ═ 2: 1: 1, transfecting a 6-well plate 293T cell, and respectively packaging into lentiviruses containing sgRNA;
(2) mixing the packaged 4 lentiviruses and infecting MDBK cells of the same well twice;
(3) after 48 hours, 2 mug/mL puro is added to screen successfully infected cells, and the culture is continued for 48 hours;
(4) adding puro with the concentration of 2 mu g/mL for secondary screening, and continuing culturing for 48 hours until the cells which are not successfully infected die basically;
(5) extracting a part of mixed cells to obtain a genome DNA amplification target spot, and detecting the integral knockout effect;
(6) and the rest cells are divided into 96-well plates according to the density of 1 cell per well, the cells are expanded into 24-well plates after full growth, the cells are expanded into 6-well plates after full growth, and each well takes part of cells to extract a genome DNA amplification target spot to detect the knockout effect.
3. The method for constructing the MyoD1 gene knockout MDBK cell line based on the CRISPRCAS9 technology, as claimed in claim 1, wherein: the 4 sgRNAs are respectively as follows: MyoD1-sgRNA5, MyoD1-sgRNA6, MyoD1-sgRNA7 and MyoD1-sgRNA8, wherein the target sequence of MyoD1-sgRNA5 is gcatggtagcagccttgcgg ngg, the MyoD1-5-up sequence is cacc gcatggtagcagccttgcgg, and the MyoD1-5-dn sequence is aaacccgcaaggctgctaccatgc; the target sequence of MyoD1-sgRNA6 is aaacccgcaaggctgctaccatgc, MyoD1-6-up sequence cacc gccaggcgcgtaaaaggcag, MyoD1-6-dn sequence aaac ctgccttttacgcgcctggc; the target sequence of MyoD1-sgRNA7 is gactaacgccgaccgccgca ngg, the sequence of MyoD1-7-up is cacc gactaacgccgaccgccgca, and the sequence of MyoD1-7-dn is aaac tgcggcggtcggcgttagtc; the target sequence of MyoD1-sgRNA8 is gcagcgtttgagcgtctcga ngg, the sequence of MyoD1-8-up is cacc gcagcgtttgagcgtctcga, and the sequence of MyoD1-8-dn is aaac tcgagacgctcaaacgctgc.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010485365.3A CN111808820A (en) | 2020-06-01 | 2020-06-01 | Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010485365.3A CN111808820A (en) | 2020-06-01 | 2020-06-01 | Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111808820A true CN111808820A (en) | 2020-10-23 |
Family
ID=72848616
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010485365.3A Pending CN111808820A (en) | 2020-06-01 | 2020-06-01 | Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111808820A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113278709A (en) * | 2021-05-27 | 2021-08-20 | 贵州省种畜禽种质测定中心 | Guizhou black goat multi-lamb major gene application, primer pair and kit |
| CN114874991A (en) * | 2022-04-25 | 2022-08-09 | 华中农业大学 | I-type interferon receptor gene knockout bovine kidney cell line and construction method and application thereof |
| CN116356431A (en) * | 2023-03-30 | 2023-06-30 | 内蒙古农业大学 | Bovine whole genome CRISPR-Cas9 knockout library, knockout cell bank and method for screening target genes |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820452A (en) * | 2014-02-27 | 2014-05-28 | 赛业（苏州）生物科技有限公司 | Single-guide RNA (sgRNA) fragment and application thereof |
| CN107312798A (en) * | 2017-06-16 | 2017-11-03 | 武汉大学 | The CRISPR/Cas9 recombined lentivirus vectors of the gRNA sequences of the genes of CCR5 containing special target and application |
| CN108135943A (en) * | 2015-06-30 | 2018-06-08 | 明尼苏达大学校董会 | The skeletal muscle of humanization |
-
2020
- 2020-06-01 CN CN202010485365.3A patent/CN111808820A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820452A (en) * | 2014-02-27 | 2014-05-28 | 赛业（苏州）生物科技有限公司 | Single-guide RNA (sgRNA) fragment and application thereof |
| CN108135943A (en) * | 2015-06-30 | 2018-06-08 | 明尼苏达大学校董会 | The skeletal muscle of humanization |
| CN107312798A (en) * | 2017-06-16 | 2017-11-03 | 武汉大学 | The CRISPR/Cas9 recombined lentivirus vectors of the gRNA sequences of the genes of CCR5 containing special target and application |
Non-Patent Citations (5)
| Title |
|---|
| ISKEN ET AL.: "CRISPR/Cas9-Mediated Knockout of DNAJC14 Verifies This Chaperone as a Pivotal Host Factor for RNA Replication of Pestiviruses" * |
| KIM ET AL.: "Myotube differentiation in clustered regularly interspaced short palindromic repeat/Cas9-mediated MyoD knockout quail myoblast cells" * |
| WANG ET AL.: "Loss of MyoD Promotes Fate Transdifferentiation of Myoblasts Into Brown Adipocytes" * |
| ZHOU ET AL.: "Study on the transcriptional regulatory mechanism of the MyoD1 gene in Guanling bovine" * |
| 张雯等: "关岭牛MyoDI基因启动子上转录因子结合位点的筛选" * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113278709A (en) * | 2021-05-27 | 2021-08-20 | 贵州省种畜禽种质测定中心 | Guizhou black goat multi-lamb major gene application, primer pair and kit |
| CN114874991A (en) * | 2022-04-25 | 2022-08-09 | 华中农业大学 | I-type interferon receptor gene knockout bovine kidney cell line and construction method and application thereof |
| CN114874991B (en) * | 2022-04-25 | 2024-03-19 | 华中农业大学 | Type I interferon receptor gene knockout bovine kidney cell line and construction method and application thereof |
| CN116356431A (en) * | 2023-03-30 | 2023-06-30 | 内蒙古农业大学 | Bovine whole genome CRISPR-Cas9 knockout library, knockout cell bank and method for screening target genes |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108642055B (en) | sgRNA capable of effectively editing pig miR-17-92 gene cluster | |
| CN107502608B (en) | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene | |
| CN104619848B (en) | Cell transfection method | |
| CN106047877A (en) | sgRNA and CRISPR/Cas9 lentivirus system for targeted knockout of FTO gene and application | |
| CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
| CN111808820A (en) | Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology | |
| CN114904003B (en) | Use of ionizable cationic lipid analog materials as nucleic acid drug delivery vehicles or transfection reagents | |
| CN113583876A (en) | Preparation of Eimeria tenella strain having EYFP knocked-in Et.Actin Gene | |
| CN108148866B (en) | HCBP6 gene knockout cell line and construction method thereof | |
| CN108611351A (en) | The knockout technique of sgRNA, ID1 gene of ID1 genes, BHK-21 cells and application thereof | |
| US20220298468A1 (en) | A method for developmentally activating a cell | |
| CN113226336B (en) | Method for delivering genes in cells | |
| CN106957857A (en) | A kind of method that utilization CRISPR/Cas9 systems knock out goat MSTN and FGF5 gene jointly | |
| CN100420749C (en) | Application of ShRNA pointed at HBV gene in inhibiting hepatitis B virus duplication | |
| CN107236763A (en) | A kind of method for building Knockout cells system based on flow cytometry | |
| CN114540309A (en) | Recombinant cell for efficiently amplifying RNA virus, and amplification method and application thereof | |
| CN106939317A (en) | It is a kind of to improve the method that plant resists the ability of RNA virus | |
| CN111349616B (en) | Method for screening target virus-related host factors and application | |
| EP0048470A2 (en) | Eucaryotically active recombinant DNA | |
| CN111662932A (en) | Method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing | |
| CN110272875A (en) | A kind of method for building up of suspension cell KBM5 high efficiency gene editor's stable cell lines | |
| CN104745635B (en) | A kind of method of OASL genes in silence DF-1 cell lines | |
| CN115537403B (en) | Construction of Endold sensitive cell strain and application thereof in Endold determination | |
| CN111254161A (en) | Method for establishing CRISPR-based gene-knocked-down lung cancer cell strain and cell strain | |
| CN117645998A (en) | ArRNA and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20201023 |