CN111808820A - Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology - Google Patents

Abstract

The invention discloses a method for constructing a MyoD1 gene knockout MDBK cell line by using CRISPRCAS9 technology, wherein the method comprises the step of knocking out MyoD1 gene by infecting MDBK cells by sgRNA virus liquid carrying MyoD1 gene, and the MyoD1 gene knockout MDBK cells can be used for downstream research of MyoD1 gene function and relevant regulation mechanism or passage.

Description

Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for constructing a MyoD1 gene knockout MDBK cell line based on an CRISPRCAS9 technology.

Background

CRISPRCAS9 the technology is a technology means for carrying out gene editing widely at present, compared with the prior editing means, the technology is high-efficient, accurate in targeting and easy to operate, the experimental period is shortened, and the experimental cost is reduced. CRISPRCAS9 is the immune defense mechanism formed by bacteria and archaea in long-term evolution, and the typical action mechanism is that crRNA (CRISPR-derivedRNA) is combined with tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA/crRNA complex, and the complex guides the nuclease Cas9 protein to cut double-stranded RNA at the sequence target site paired with the crRNA. By designing the two RNAs, sgRNA (short guide RNA) with guiding function is formed to guide the site-specific cleavage of the DNA by Cas9, and the action principle is shown in the figure. Us researchers published articles on molecular therapy of 2012 for editing DNA sequences of organisms using CRISPR technology and developed model-related studies for studying diseases and drug tests, and the CRISPR technology was widely used thereafter. CRISPRCAS 9-based technology has great significance in disease treatment, breeding transgenic livestock and the like.

Disclosure of Invention

The purpose of the invention is: the method for constructing the MyoD1 gene knockout MDBK cell line based on the CRISPRCAS9 technology is high in knockout success rate and easy to operate.

The invention is realized by the following steps: a method for constructing an MDBK cell line with Myod1 gene knockout based on CRISPRCAS9 technology comprises the steps of designing sgRNAs according to a CDS sequence (NM-001040478.2) of a MyoD1 gene of a cow, and inserting 4 groups of designed sgRNAs into a lentiCRISPR v2 vector; transferring the plasmid containing the green fluorescent protein gene GFP into MDBK cells by using liposome 2000 (Invitrogen); adopting a gradient dilution method to dilute the MDBK cells to 1/100/100 mu L, transferring the MDBK cells to a 96-well plate, and adding 100 mu L of MDBK cells into each well; monoclonal 1 × 96 wells were co-plated, and after a 12-day growth cycle, the core plasmid was grown up in a single clone and the obtained core plasmid was packaged into lentivirus to infect target cells.

The core plasmid packaging lentivirus infection target cell comprises the following steps:

(1) transfecting a 6-well plate 293T cell according to the ratio of a core plasmid lentiCRISPR v2-MyoD1-sgRNA to psPAX2 p to pMD2G which is 2: 1, and respectively packaging into lentiviruses containing the sgRNAs;

(2) mixing the packaged 4 lentiviruses and infecting MDBK cells of the same well twice;

(3) after 48 hours, 2 mug/mL puro is added for screening, cells which are successfully infected are obtained, and the culture is continued for 48 hours;

(4) adding puro with the concentration of 2 mu g/mL for secondary screening, and continuing culturing for 48 hours until the cells which are not successfully infected die basically;

(5) extracting a part of mixed cells to obtain a genome DNA amplification target spot, and detecting the integral knockout effect;

(6) and the rest cells are divided into 96-well plates according to the density of 1 cell per well, the cells are expanded into 24-well plates after full growth, the cells are expanded into 6-well plates after full growth, and each well takes part of cells to extract a genome DNA amplification target spot to detect the knockout effect.

The 4 sgRNAs are respectively as follows:

due to the adoption of the technical scheme, compared with the conventional gene knockout technology, the MyoD1 gene is knocked out at a fixed point by utilizing the CRISPRCAS9 technology, the MyoD1 gene can be knocked out quickly, accurately and specifically, the experiment period is shortened, and the experiment cost is reduced.

Description of the drawings:

fig. 1 is a drug-screening concentration of sgRNA recombinant plasmid in an example of the present invention, wherein 2 μ g/mL puro can be used as a subsequent drug-screening concentration;

FIG. 2 shows the transfection efficiency of liposomes 2000 in an example of the present invention;

FIG. 3 shows the efficiency of monoclonal vector production in examples of the present invention;

FIG. 4 is a graph showing the results of electrophoretic detection of lentivirus-infected MDBK monoclonal cells carrying the sgRNA of MyoD1 gene in examples of the present invention, wherein M denotes DNA Marker, and 1, 3, 4, 5, 6, 7, 8, 9, 11 and 12 denote lentivirus-infected MDBK cells;

FIG. 5 is a graph showing the results of electrophoretic detection for verifying the gene knockout effect of a target sequence in the example of the present invention, wherein M denotes a DNA Marker, and 5, 6, 7, and 8 denote lentivirus-infected MDBK cells;

fig. 6 is a graph showing the results of electrophoretic detection of sgRNA6 in the example of the present invention, wherein 21 lanes are #1, #3, # 4, # 5, # 6, # 9, # 10, 11, # Marker, # 13, # 14, 15, 17, 19, # 20, 21, 22, 25, 26, 27, and # 28 from left to right;

FIG. 7 is a diagram showing the result of cell sequencing identification in FIG. 6, wherein the coding regions of MyoD1 of the monoclonal #3 and #22 target genes are both deleted in a way other than 3nbp, which can cause frame shift mutation during translation, and the 2 monoclonal MyoD1 genes are judged to be successfully knocked out from the genome level;

fig. 8 is a plasmid map of the plasmid vector lentiCRISPR v2 used in the examples of the present invention;

fig. 9 is a sequencing double-peak diagram of the product of example 5 of the present invention, in which an obvious set of peaks is observed near the sgRNA6 of the target gene, and the sgRNA6 is judged to have higher activity.

FIG. 10 is a schematic diagram of the present process.

Detailed Description

The embodiment of the invention comprises the following steps: a method for constructing a MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology comprises the steps of designing sgRNAs according to a CDS sequence (NM-001040478.2) of a MyoD1 gene of a cow, and inserting 4 groups of designed sgRNAs into a lentiCRISPR v2 vector; transferring the plasmid containing the green fluorescent protein gene GFP into MDBK cells by using liposome 2000 (Invitrogen); adopting a gradient dilution method to dilute the MDBK cells to 1/100/100 mu L, transferring the MDBK cells to a 96-well plate, and adding 100 mu L of MDBK cells into each well; monoclonal 1 × 96 wells were co-plated, and after a 12-day growth cycle, the core plasmid was grown up in a single clone and the obtained core plasmid was packaged into lentivirus to infect target cells.

The core plasmid packaging lentivirus infection target cell comprises the following steps:

(1) transfecting a 6-well plate 293T cell according to the ratio of a core plasmid lentiCRISPR v2-MyoD1-sgRNA to psPAX2 p to pMD2G which is 2: 1, and respectively packaging into lentiviruses containing the sgRNAs;

(2) mixing the packaged 4 lentiviruses and infecting MDBK cells of the same well twice;

(3) after 48 hours, 2 mug/mL puro is added for screening, cells which are successfully infected are obtained, and the culture is continued for 48 hours;

(4) adding puro with the concentration of 2 mu g/mL for secondary screening, and continuing culturing for 48 hours until the cells which are not successfully infected die basically;

(5) extracting a part of mixed cells to obtain a genome DNA amplification target spot, and detecting the integral knockout effect;

(6) and the rest cells are divided into 96-well plates according to the density of 1 cell per well, the cells are expanded into 24-well plates after full growth, the cells are expanded into 6-well plates after full growth, and each well takes part of cells to extract a genome DNA amplification target spot to detect the knockout effect.

The 4 sgRNAs are respectively as follows:

sequence listing

<110> Guizhou province breeding livestock and poultry germplasm determination center

<120> method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>DNA

<213> cattle (cattle)

<400>1

gcatggtagc agccttgcgg ngg 23

<210>2

<211>24

<212>DNA

<213> cattle (cattle)

<400>2

caccgcatgg tagcagcctt gcgg 24

<210>3

<211>24

<212>DNA

<213> cattle (cattle)

<400>3

aaacccgcaa ggctgctacc atgc 24

<210>4

<211>24

<212>DNA

<213> cattle (cattle)

<400>4

aaacccgcaa ggctgctacc atgc 24

<210>5

<211>24

<212>DNA

<213> cattle (cattle)

<400>5

caccgccagg cgcgtaaaag gcag 24

<210>6

<211>24

<212>DNA

<213> cattle (cattle)

<400>6

aaacctgcct tttacgcgcc tggc 24

<210>7

<211>23

<212>DNA

<213> cattle (cattle)

<400>7

gactaacgcc gaccgccgca ngg 23

<210>8

<211>24

<212>DNA

<213> cattle (cattle)

<400>8

caccgactaa cgccgaccgc cgca 24

<210>9

<211>24

<212>DNA

<213> cattle (cattle)

<400>9

aaactgcggc ggtcggcgtt agtc 24

<210>10

<211>23

<212>DNA

<213> cattle (cattle)

<400>10

gcagcgtttg agcgtctcga ngg 23

<210>11

<211>24

<212>DNA

<213> cattle (cattle)

<400>11

caccgcagcg tttgagcgtc tcga 24

<210>12

<211>24

<212>DNA

<213> cattle (cattle)

<400>12

aaactcgaga cgctcaaacg ctgc 24

Claims (3)

1. A method for constructing a MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology, which is characterized by comprising the following steps: inserting designed 4 groups of sgRNAs into a lentiCRISPR v2 vector; transferring the plasmid containing the green fluorescent protein gene GFP into MDBK cells by using liposome 2000 (Invitrogen); adopting a gradient dilution method to dilute the MDBK cells to 1/100/100 mu L, transferring the MDBK cells to a 96-well plate, and adding 100 mu L of MDBK cells into each well; monoclonal 1 × 96 wells were co-plated, and after a 12-day growth cycle, the core plasmid was grown up in a single clone and the obtained core plasmid was packaged into lentivirus to infect target cells.

2. The method of claim 1 for constructing a MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology, wherein the step of packaging the core plasmid into a lentivirus-infected target cell comprises the steps of:

(1) according to the core plasmid lentiCRISPR v2-MyoD 1-sgRNA: psPAX2 p: pmd2.g ═ 2: 1: 1, transfecting a 6-well plate 293T cell, and respectively packaging into lentiviruses containing sgRNA;

(2) mixing the packaged 4 lentiviruses and infecting MDBK cells of the same well twice;

(3) after 48 hours, 2 mug/mL puro is added to screen successfully infected cells, and the culture is continued for 48 hours;

(4) adding puro with the concentration of 2 mu g/mL for secondary screening, and continuing culturing for 48 hours until the cells which are not successfully infected die basically;

(5) extracting a part of mixed cells to obtain a genome DNA amplification target spot, and detecting the integral knockout effect;

(6) and the rest cells are divided into 96-well plates according to the density of 1 cell per well, the cells are expanded into 24-well plates after full growth, the cells are expanded into 6-well plates after full growth, and each well takes part of cells to extract a genome DNA amplification target spot to detect the knockout effect.

3. The method for constructing the MyoD1 gene knockout MDBK cell line based on the CRISPRCAS9 technology, as claimed in claim 1, wherein: the 4 sgRNAs are respectively as follows: MyoD1-sgRNA5, MyoD1-sgRNA6, MyoD1-sgRNA7 and MyoD1-sgRNA8, wherein the target sequence of MyoD1-sgRNA5 is gcatggtagcagccttgcgg ngg, the MyoD1-5-up sequence is cacc gcatggtagcagccttgcgg, and the MyoD1-5-dn sequence is aaacccgcaaggctgctaccatgc; the target sequence of MyoD1-sgRNA6 is aaacccgcaaggctgctaccatgc, MyoD1-6-up sequence cacc gccaggcgcgtaaaaggcag, MyoD1-6-dn sequence aaac ctgccttttacgcgcctggc; the target sequence of MyoD1-sgRNA7 is gactaacgccgaccgccgca ngg, the sequence of MyoD1-7-up is cacc gactaacgccgaccgccgca, and the sequence of MyoD1-7-dn is aaac tgcggcggtcggcgttagtc; the target sequence of MyoD1-sgRNA8 is gcagcgtttgagcgtctcga ngg, the sequence of MyoD1-8-up is cacc gcagcgtttgagcgtctcga, and the sequence of MyoD1-8-dn is aaac tcgagacgctcaaacgctgc.

Images