CN114540309A

CN114540309A - Recombinant cell for efficiently amplifying RNA virus, and amplification method and application thereof

Info

Publication number: CN114540309A
Application number: CN202210047605.0A
Authority: CN
Inventors: 张部昌; 王昌; 徐昌志; 陆晓香; 曹诚
Original assignee: Anhui University
Current assignee: Anhui University
Priority date: 2022-01-17
Filing date: 2022-01-17
Publication date: 2022-05-27

Abstract

The invention discloses a recombinant cell for efficiently amplifying RNA virus, an amplification method and application thereof, and relates to the technical field of genetic engineering, wherein the recombinant cell is a eukaryotic cell with p53 gene expression deletion, which is prepared by inactivating a p53 gene in the eukaryotic cell.

Description

Recombinant cell for efficiently amplifying RNA virus, and amplification method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a recombinant cell for efficiently amplifying RNA virus, an amplification method and application thereof.

Background

Malignant infectious diseases caused by RNA viruses, such as coronavirus, influenza virus and the like, seriously harm human life health. The research on the infection mechanism and biological characteristics of the malignant infectious viruses and the research and development of high-efficiency antiviral drugs become research hotspots, and the separation and high-efficiency amplification of the viruses become the basis of scientific research, drug screening and vaccine development. Therefore, efficient propagation of viruses becomes an important key element. The amplified viruses mainly comprise: animal inoculation, chick embryo inoculation and cell culture methods. Animal vaccination is limited in scope and may be confused with potential viruses in animals; chick embryo inoculation often cannot produce specific infection indexes, and is also limited by the range and scale of the virus which can be inoculated; the culture of the cells can be artificially controlled, and the samples are relatively uniform and have strong probabilityof. At present, astrocyte cell lines DBT-1, Vero and human lung cancer cell lines A549 and the like are commonly used as platform cells for in vitro virus infection screening drug and vaccine development.

To further improve the virus amplification capacity of these cells, we can modify the platform cells by gene editing technology. Cells cultured in vitro also have an innate immune response, and the presence of this immunity affects further propagation of the virus; at the same time, the immune response can mediate cell death (mainly in the form of apoptosis), which also affects the ultimate viral replication. According to research, we found that the tumor suppressor gene p53 plays an important role and function in the infection process of viruses. The protein coded by the gene has wide and important biological effects, and regulates and controls the processes of cell cycle, apoptosis, genome stability maintenance, virus infection inhibition and the like. During the course of resisting viral infection, p53 can regulate various immune regulatory genes, including TLR3, IRF9, IRF5, PKR and ISG15, etc. Therefore, p53 becomes a potential target gene for efficient amplification of viruses.

At present, the gene editing technology is developed very rapidly, and particularly, the CRISPR-Cas9 nuclease system has the characteristics of high efficiency and high speed of gene editing. Under the action of the specific guide RNA, Cas9 nuclease can cleave DNA double strands at specific positions to form Double Strand Breaks (DSBs), and then edit the segment of interest using homologous directed repair or non-homologous end-joining repair methods, thereby generating gene knockouts or mutations.

Based on the above, the p53 gene in the virus amplification cell is knocked out by using the CRISPR-Cas9 technology, so as to construct a platform cell for further efficiently amplifying the virus. Therefore, a recombinant cell for efficiently amplifying RNA virus, an amplification method and application thereof are provided.

Disclosure of Invention

The invention aims to provide a method for efficiently amplifying viruses based on a CRISPR-Cas9 editing technology, and expands the application of the method in efficiently amplifying the viruses.

The invention realizes the purpose through the following technical scheme:

the invention provides a recombinant cell for efficiently amplifying RNA viruses, which is a eukaryotic cell with p53 gene expression deletion and is prepared by inactivating p53 gene in the eukaryotic cell.

The further improvement is that the eukaryotic cell is a Vero cell or a DBT-1 cell.

The further improvement is that the recombinant cell is characterized in that the 4 th exon sequence of the p53 gene is mutated, the 4 th exon sequence comprises a nucleotide sequence shown as SEQ ID NO.1, and the mutation is deletion or addition of at least 1 base in the nucleotide sequence shown as SEQ ID NO. 1.

The further improvement is that the mutation is the nucleotide sequence shown in SEQ ID NO.1 and is edited into a sequence shown in any one of SEQ ID NO. 2-4.

The further improvement is that p53 gene in eukaryotic cells is inactivated by gene knockout means, the gene knockout means adopts CRISPR-Cas9 technology, and the steps comprise:

(1) the coding region of an exon of a eukaryotic cell p53 gene is used as a template, and a specifically targeted sgRNA sequence is designed according to CRISPR-Cas9 technical requirements and sequence homology comparison analysis;

(2) synthesizing double-stranded DNA of knockout p53 according to the sgRNA sequence, and connecting the double-stranded DNA to pSpCas9(BB) -2A-Puro plasmid to obtain a recombinant plasmid;

(3) transfecting the recombinant plasmid into a eukaryotic cell, and screening a cell strain with significantly reduced expression of p 53;

(4) and (3) obtaining the monoclonal cell with p53 knocked out by a pressure screening and limiting dilution method, namely the recombinant cell.

In a further improvement, the eukaryotic cell is a DBT-1 cell, the sequence of sg RNA specifically targeted in step (1) is 5'-AGTGAAGCCCTCCGAGTGTC-3', and the sequence of the double-stranded DNA in step (2) is oligo 1: 5'-CACCGCCTCGAGCTCCCTCTGAGCC-3', respectively; oligo 2: 5'-AAACGGCTCAGAGGGAGCTCGAGGC-3' are provided.

The invention also provides a method for efficiently amplifying the RNA virus by using the recombinant cell, which is used for infecting the recombinant cell by using the virus so as to improve the titer of the virus and realize efficient amplification.

In a further improvement, the RNA virus is a lentivirus.

In a further improvement, the lentivirus is a VSV virus or NDV virus.

The invention also provides the application of the recombinant cell in high-efficiency amplification of RNA viruses and production and development of the RNA virus vaccines.

The invention has the following beneficial effects:

according to the invention, the p53 inactivated recombinant cell is obtained in the eukaryotic cell by a gene knockout means, the titer of the corresponding virus can be improved after the cell is infected with the virus, and the virus with the significantly improved titer can be VSV, NDV or other RNA viruses, and can be used for the research and development and production processes of corresponding vaccines.

Drawings

Fig. 1 shows the targeting positions of 4 sgrnas in the exon of p 53.

FIG. 2 shows the expression of p53 after 4 sgRNA expression plasmids were transfected into DBT-1 cells.

FIG. 3 shows the identification of knockout cells.

FIG. 4 shows the proliferation of a knockout cell.

FIG. 5 is a case of knockdown cells against apoptosis.

FIG. 6 is a fluorescence intensity analysis after infection of cells with lentivirus.

FIG. 7 shows the fluorescence expression level of NDV-GFP virus infected cells.

FIG. 8 shows the expression of GFP after infection of cells with NDV-GFP virus.

FIG. 9 shows VSV-G expression after infection of cells with VSV virus.

Detailed Description

The present application will now be described in further detail with reference to the drawings, it should be noted that the following detailed description is given for illustrative purposes only and is not to be construed as limiting the scope of the present application, as those skilled in the art will be able to make numerous insubstantial modifications and adaptations to the present application based on the above disclosure.

1. Material

The experimental procedures in the following examples are conventional biochemical procedures unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.

pSpCas9(BB) -2A-Puro vector was purchased from adddge (catalog number: PX 459);

DBT-1 cells: the product is a gift from military medical research institute of military science institute, and can be purchased through a market;

Opti-MEM I Medium: Gibco (Cat. No: 31985-;

liposomes (lipo 8000): biyuntian corporation (catalog number: C0533);

puromycin: gene Operation company (catalog number: ISY1130-0025 MG);

cisplatin: dalian Melam Biotechnology Ltd (catalog number: MB 1055);

psPAX2 vector, pCS-CG vector and pMD2.G vector: the product is offered by Qin light professor of the institute of Material science and information technology of Anhui university, and can also be purchased through a market approach;

newcastle disease virus NDV, vesicular stomatitis virus VSV: the product is a gift from military medical research institute of military science institute, and can be purchased from commercial sources.

The quantitative experiments in the following examples were set up in triplicate and the results averaged.

2. Method of producing a composite material

2.1 Effect of knockout cell lines on Lentiviral infection

2.1.1 sgRNA design

An open reading frame of a p53 gene [ NCBI accession number: 22059 ] in DBT-1 cells comprises 12 exons, 4 sgRNAs (sgRNAs 1-4) are screened and designed according to CRISPR-Cas9 technical requirements and sequence homology comparison analysis, the sgRNAs 1 target exon 1, the sgRNAs 2 and the sgRNAs 3 simultaneously target exon 4, and the sgRNAs 4 target exon 5. The target sequences of the four sgrnas are shown in table 1 below, and the positions on the p53 exon are shown in the results in fig. 1.

Table 1, 4 sgRNA target sequences

Name (R)	Sequence (5 '-3')
		sgRNA1	CCTCGAGCTCCCTCTGAGCC
sgRNA2	AGTGAAGCCCTCCGAGTGTC
		sgRNA3	TCCGAGTGTCAGGAGCTCCT
sgRNA4	CAGCGTGGTGGTACCTTATG

2.1.2 recombinant plasmid construction

The DNA sequences and their complementary mating sequences in table 1 were synthesized separately, and the oligonucleotide double-stranded DNA sequences for constructing sgrnas are shown in table 2. After annealing, a double-stranded DNA molecule with cohesive ends at both ends was formed, and ligated to the vector pSpCas9(BB) -2A-Puro after Bpil digestion to obtain 4 recombinant plasmids (pSpCas9(BB) -2A-Puro-sgRNA1, pSpCas9(BB) -2A-Puro-sgRNA2, pSpCas9(BB) -2A-Puro-sgRNA3 and pSpCas9(BB) -2A-Puro-sgRNA 4).

Table 2, 4 recombinant plasmid insert sequences

2.1.3 cell transfection and protein expression detection

The 4 recombinant plasmids are transfected into DBT-1 cells, and the transfection method can be as follows:

(1) seeding DBT-1 cells into 6-well plates (density 1X 10)⁶One/well), 37 ℃ and 5% CO₂The culture was carried out overnight in an incubator.

(2) The medium was discarded and replaced with fresh complete medium. 125. mu.l of Opti-MEM and 2.5. mu.g of the above 4 recombinant plasmids were added to each of 4 Ep tubes, and then gently pipetted and mixed. Mu.l of Lipo8000 transfection reagent was added and gently pipetted and mixed, and incubated at room temperature for 5 minutes. Finally, the mixture of plasmid and transfection reagent was added dropwise to the 6-well plate, and after 12 hours the incubation continued with fresh complete medium.

(3) After 24 hours, the medium was discarded and the cells were washed 3 times with PBS buffer, and the selection was performed by replacing the fresh medium containing puromycin. A portion of the cells collected after 1 week were subjected to immunoblotting to detect the expression of p53 protein and internal reference protein GAP DH, and the results are shown in FIG. 2. From the results, it can be seen that the expression of p53 in cells was significantly reduced after transfection of the plasmid pSpCas9(BB) -2A-Puro-sgRNA 2.

2.1.4 cell line screening and sequencing validation

The cell line stably expressing pSpCas9(BB) -2A-Puro-sgRNA2 was further screened. 3 knockout p53 monoclonal cells are finally obtained after 3 rounds of pressure screening and limiting dilution screening, and the immunoblotting result is shown in figure 3. After extracting cell genome, PCR amplifies p53 genome sequence containing sgRNA2 target region, PCR amplification primer 5 '-3' is:

F：CAGGGCAACTATGGCTTCCA；

R：AGGCACAAACACGAACCTCA。

after sequencing, the corresponding sequence in the 4 th exon of p53 is found to be edited into the sequences in the

sequences

2, 3 and 4 through comparison, and compared with the DBT-1 cell original sequence shown in SEQ ID NO.1, the deletion or the addition of the base occurs, and the

sequences

2, 3 and 4 are respectively shown as SEQ ID NO.2-4 in the sequence table.

2.1.5 identification of cell Activity and lentivirus infection

After obtaining the knockout cell, cell proliferation speed and anti-apoptosis detection are carried out. Inoculating 6000-8000 cells/well of control cells and knockout cells to a 96-well plate for normal culture, and performing MTT detection after 24 hours to obtain a result figure 4, wherein the proliferation speed of the knockout cells is higher; after counting the cells, the number of cells was 1X 10⁵cells/mL were seeded into 6-well plates for 24 hours, and the experimental groups were starved with 3. mu.g/mL cisplatin or serum-free DMEM. After 48 hours the cells were rinsed twice with pre-cooled PBS and then 100. mu.l of 1 XBinding Buffer was added to resuspend the cells. Then 5 mul FITC-annexin V and 5 mul PI are added for shading and staining for 15 minutes, and after 300 mul 1 × binding Buffer is added, flow cytometry is carried out to detect the apoptosis level and the result is obtained as a figure 5, and it can be seen that the knockout cell shows obvious anti-apoptosis effect no matter the apoptosis inducer is cisplatin treated or is starved without serum.

Further, infection detection was performed by infecting cells with lentivirus. The general method for packaging the lentivirus comprises the following steps: 293T cells were seeded in 10cm dishes and after 24 hours the complete medium was changed to basal medium. The plasmid is diluted by a basal medium according to the proportion (pCS-CG: psPAX2: pMD2.G ═ 4:3:1), then is slowly blown and uniformly mixed, and the lipo8000 transfection reagent is diluted by the basal medium, then is dripped into the plasmid mixed liquor, and is gently mixed, and is kept stand for 20 minutes. The solution is uniformly dripped into a cell culture dish, and after the culture is continued for 6 to 8 hours, the culture medium is replaced by a complete culture medium. After 48 and 72 hours, respectively, the green fluorescence intensity was observed under a fluorescence microscope and the culture broth was collected in a sterile centrifuge tube. And (3) carrying out centrifugal filtration on the collected cell culture solution, standing overnight, centrifuging, discarding supernatant, and then carrying out heavy suspension precipitation on the supernatant by using a basic culture medium to obtain concentrated virus solution.

The general steps for lentivirus infection of cells are: inoculation of 1X 10⁶DBT-1 cells were infected in 6-well plates, and the next day when cell density was observed to be around 70%. Virus liquid was cultured in complete medium at 1: 50 dilution is carried out for cell infection, liquid is changed after 24 hours, cells are collected under a fluorescence microscope after 48 hours, and the fluorescence intensity is detected by using a flow cytometer to obtain a result figure 6, and the result shows that the proliferation of lentivirus can be remarkably promoted after the gene p53 is knocked out.

2.2 Effect of knockout cell lines on amplification of NDV-GFP Virus

After a p53 knockout cell is obtained, NDV-GFP virus is used for infecting the cell, the virus is verified by detecting the expression condition of green fluorescent protein after Green Fluorescent Protein (GFP) gene is inserted into NDV virus genome to construct expression recombinant NDV, and the general steps are as follows: inoculation of 1X 10⁶Every well of DBT-1 cells was in 6-well plates, and the next day when cell density reached around 70%, the total culture medium was used at 1: the NDV-GFP virus solution was diluted 800 to infect cells. After infection for 6 hours, the liquid is changed, after 12 hours, the fluorescence expression condition is observed under a fluorescence microscope or the expression condition of GFP and internal reference protein beta-tubulin is detected by collecting cells through an immunoblotting experiment, and the results are shown in fig. 7 and 8, and the result shows that the proliferation of NDV-GFP virus can be remarkably promoted after p53 is knocked out.

2.3 Effect of knockout cell lines on VSV Virus amplification

As above, when cells are infected with VSV, since the G protein is the major surface antigen of the virus, it can be confirmed by detecting the expression of VSV-G protein, and the results are summarizedThe method comprises the following steps: inoculation of 1X 10⁶Individual/well DBT-1 cells in 6-well plates, next day cell density to around 70%, run out of whole medium as 1: VSV virus solution was diluted 1500 for cell infection. After infection for 3 hours, the cells were replaced, and 18 hours later, the expression of VSV-G protein and internal reference protein GAPDH was detected by immunoblotting, and FIG. 9 shows the results, from which it can be seen that the knock-out of p53 also promotes the proliferation of the virus.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is specific and detailed, but not to be understood as limiting the scope of the present invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention.

Sequence listing

<110> university of Anhui

<120> recombinant cell for efficiently amplifying RNA virus, and amplification method and application thereof

<141> 2022-01-17

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 261

<212> DNA

<213> mouse (Muridae)

<400> 1

ccatcacctc actgcatgga cgatctgttg ctgccccagg atgttgagga gttttttgaa 60

ggcccaagtg aagccctccg agtgtcagga gctcctgcag cacaggaccc tgtcaccgag 120

acccctgggc cagtggcccc tgccccagcc actccatggc ccctgtcatc ttttgtccct 180

tctcaaaaaa cttaccaggg caactatggc ttccacctgg gcttcctgca gtctgggaca 240

gccaagtctg ttatgtgcac g 261

<210> 2

<211> 231

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccatcacctc actccatgga cgatctgttg ctgccccagg atgttgagga gttttttgaa 60

ggcccaagtg aagccctcca atacttattg aaggtgtcag gagctcctgc agcacaggac 120

cctgtcactg agacccctgg gccagtggcc cctgccccag ctactccatg gcccccgtca 180

tcttttgccc cttctcaaaa aacttaccag gggaactatg gcttcaaggg c 231

<210> 3

<211> 236

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccatcacctc actccatgga cgatctgttg ctgccccagg atgttgagga gttttttgaa 60

ggcccaagtg aagccctcca agtcaggagc tcctgcagca caggaccctg tcactgagac 120

ccctgggcca gtggcccctg ccccagctac tccatggccc ccgtcatctt ttgtcccttc 180

tcaaaaaact taccagggca actatggctt caagggcgac acgcgattgc agtctt 236

<210> 4

<211> 274

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccatcacctc actccatgga cgatctgttg ctgccccagg atgttgagga gttttttgaa 60

ggcccaagtg aagccctcca agttgtcagg agctcctgca gcacaggacc ctgtcactga 120

gacccctggg ccagtggccc ctgccccagc tactccatgg cccccgtcat cttttgcccc 180

ttctcaaaaa acttaccagg gcaactatgg cttcaagggc gacacgcgat tgcagtcttg 240

agtccacctg aaggatgtca aacttggtca tagc 274

Claims

1. A recombinant cell for efficiently amplifying RNA viruses is a eukaryotic cell with deleted expression of a p53 gene, wherein the eukaryotic cell is prepared by inactivating the p53 gene in the eukaryotic cell.

2. The recombinant cell of claim 1, wherein the eukaryotic cell is a DBT-1 cell.

3. The recombinant cell according to claim 1, wherein the recombinant cell is characterized in that the 4 th exon sequence of the p53 gene is mutated, the 4 th exon sequence comprises the nucleotide sequence shown in SEQ ID No.1, and the mutation is deletion or addition of at least 1 base in the nucleotide sequence shown in SEQ ID No. 1.

4. The recombinant cell of claim 1, wherein the mutation is a nucleotide sequence as set forth in SEQ ID No.1 edited to a sequence as set forth in any one of SEQ ID nos. 2-4.

5. The recombinant cell of claim 1, wherein the p53 gene in the eukaryotic cell is inactivated by gene knockout using CRISPR-Cas9 technology, comprising the steps of:

6. The recombinant cell of claim 5, wherein the eukaryotic cell is a DBT-1 cell, the sequence of the sgRNA specifically targeted in step (1) is 5'-AGTGAAGCCCTCCGAGTGTC-3', and the sequence of the double-stranded DNA in step (2) is oligo 1: 5'-CACCGCCTCGAGCTCCCTCTGAGCC-3', respectively; oligo 2: 5'-AAACGGCTCAGAGGGAGCTCGAGGC-3' are provided.

7. A method for efficiently amplifying RNA viruses according to any one of claims 1 to 6, wherein the recombinant cells are infected with a virus to increase the titer of the virus, thereby achieving efficient amplification.

8. The method of claim 4, wherein the RNA virus is a lentivirus.

9. The method for highly amplifying an RNA virus of claim 4, wherein the lentivirus is VSV virus or NDV virus.

10. Use of the recombinant cell of claim 1 for the efficient amplification of RNA viruses and their use in the production and development of vaccines for said RNA viruses.