CN111662932A

CN111662932A - Method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing

Info

Publication number: CN111662932A
Application number: CN202010652378.5A
Authority: CN
Inventors: 俞家华; 丁伯洋; 刘芬菊; 张昊文
Original assignee: Suzhou University
Current assignee: Suzhou University
Priority date: 2020-07-08
Filing date: 2020-07-08
Publication date: 2020-09-15
Anticipated expiration: 2040-07-08
Also published as: CN111662932B

Abstract

The invention discloses a method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing, which is characterized in that a C6 amino group is modified at the 5 'end of a single-stranded DNA template, and the single-stranded DNA template with the C6 amino group modified at the 5' end and a CRISPR-Cas9 system are co-transfected to a cell to improve the homologous recombination repair efficiency in the gene editing. The single-stranded DNA modified by the 5' end C6 amino group and the CRISPR-Cas9 system are adopted to co-transfect the cell, so that the efficiency of homologous recombination repair can be obviously improved, and the success rate of gene editing is improved.

Description

Method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing

Technical Field

The invention relates to a method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing, belonging to the technical field of genetic engineering.

Background

Clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR-associated protein 9, CRISPR-Cas9) are currently the most commonly used gene editing tools. The CRISPR-Cas9 system cleaves at specific sites in the genome under the guidance of guide RNA (sgRNA) to form a DNA double-strand break (DSB), and Homologous Recombination (HR) repair can occur in the presence of a DNA template with homology to both ends of the DSB. By designing the sequence in the homologous DNA template, point mutation, insertion fragment and inserted gene can be induced in the region near the DSB, thereby achieving the purpose of gene editing. Another repair method is Non-homologous end joining (NHEJ), which does not require the presence of a template and results in gene mutation after repair.

The DNA templates commonly used in gene editing include single-stranded DNA, double-stranded DNA, plasmids, etc., of which the synthesis of single-stranded DNA is most convenient. The existing technical method for improving the homologous recombination repair efficiency in CRISPR-Cas9 gene editing by using different DNA templates mainly comprises the following steps:

(1) the length of the homologous sequence of the template is increased, and the homologous sequence at the two ends of the template can improve the homologous recombination efficiency by 2-4 times compared with the template of 100bp when the homologous sequence is more than 1000 bp. But has the disadvantages of high difficulty, low efficiency and high cost for synthesizing long-sequence templates;

(2) thio (phosphothioate) modified templates can improve the stability of the template and improve the efficiency of homologous recombination. But has the disadvantage that the thionated template has toxic reaction after transfecting cells;

(3) the attachment of the nuclear localization sequence to the template facilitates the transfer of the template to the nucleus, thereby increasing the efficiency of homologous recombination. But has the defects that the nuclear localization sequence is an amino acid sequence, and the modification process has high difficulty, large loss and high cost.

Disclosure of Invention

To solve the above problems. The single-stranded DNA modified by the 5' end C6 amino group and the CRISPR-Cas9 system are adopted to co-transfect the cell, so that the efficiency of homologous recombination repair can be obviously improved, and the success rate of gene editing is improved.

The first purpose of the invention is to provide a method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing, which is to modify a C6 amino group at the 5 'end of a single-stranded DNA template and co-transfect a cell by the single-stranded DNA template modified with a C6 amino group at the 5' end and a CRISPR-Cas9 system so as to improve the homologous recombination repair efficiency in gene editing.

Furthermore, the gene editing is to knock out, insert, mutate and randomly combine chromosome genes by using a gene editing tool.

Further, the cell is one of bacteria, fungi and animal and plant cells.

Further, the method specifically comprises the following steps:

s1, designing a sgRNA sequence according to the sequence of a target gene to be edited;

s2, designing a homologous single-stranded DNA template according to the purpose of gene editing;

s3, synthesizing a single-stranded DNA template modified by a 5' end C6 amino group;

s4, transferring the CRISPR-Cas9 system and the single-stranded DNA template modified by the 5' end C6 amino group into cells to obtain mutant cells.

Furthermore, the two ends of the DSB of the single-stranded DNA template are respectively provided with 50-60 bp DNA sequences.

Further, in step S2, an insert and/or a mutant sequence is present in the homologous single-stranded DNA template.

Further, the method for transferring the CRISPR-Cas9 system and the single-stranded DNA template into cells is a liposome transfection method, an electroporation transfection method or a microinjection method.

The second purpose of the invention is to provide a kit for gene editing, which comprises a CRISPR-Cas9 system and a single-stranded DNA template of which the 5' end is modified with C6 amino.

The third purpose of the invention is to provide the application of the method in constructing point mutation of the heparin-binding epidermal growth factor-like growth factor.

The fourth purpose of the invention is to provide the application of the method in the insertion sequence of the second exon of hypoxanthine phosphoribosyltransferase in HEK293T cells.

The invention has the beneficial effects that:

the single-stranded DNA modified by the 5' end C6 amino group and the CRISPR-Cas9 system are adopted to co-transfect the cell, so that the efficiency of homologous recombination repair can be obviously improved, and the success rate of gene editing is improved.

Drawings

FIG. 1 shows the molecular structure of amino modified at the 5' end C6;

FIG. 2 is a comparison of the sequencing results of PCR amplification products;

FIG. 3 shows that the insertion efficiency of the fragment is obviously improved by the unmodified template and the single-stranded DNA template modified by the 5' end C6 amino group.

Detailed Description

The present invention is further described below in conjunction with the following figures and specific examples so that those skilled in the art may better understand the present invention and practice it, but the examples are not intended to limit the present invention.

In the following examples, the CRISPR-Cas9 construction kit was purchased from Shangrid Biotechnology Ltd, primers and a modified single-stranded DNA template were limitedly synthesized by Biotechnology engineering (Shanghai), and prepared with distilled water at 10. mu. mol/L, the transfection reagent Lipofectamine 3000 was purchased from Invitrogen Shanghai, the genomic DNA extraction kit and DNA polymerase for PCR were purchased from Takara, and SYBR Green was purchased from Tiangen Biochemical technology (Beijing) for quantitative fluorescence PCR.

Example 1: construction of heparin-binding epidermal growth factor-like growth factor point-mutated HeLa cells

(1) Cas9/gRNA plasmid for HBEGF gene was constructed. HBEGF target primers are designed according to the design principle of gRNA, and a forward primer (SEQ ID NO. 1): AAACACCGTTCTCTCGG CACTGGTGAC, reverse primer (SEQ ID NO. 2): CTCTAAAACCTGACCAGTGC CGAGAGAA, annealing the primers to form dimers, inserting gRNA sequence primer dimers into Cas9/gRNA plasmids according to a method for constructing a kit by using CRISPR-Cas9, converting competent escherichia coli, coating the competent escherichia coli on an ampicillin resistant plate, selecting 3-5 monoclonal shake bacteria, extracting plasmids, sequencing, and comparing with a designed recognition sequence to obtain Cas9/gRNA plasmids with correct sequencing.

(2) Synthesizing a single-stranded DNA template modified by a 5' end C6 amino group. Obtaining DNA sequences (SEQ ID NO.3) of 50bp at the upstream and downstream of the target position of the Cas9/gRNA plasmid: TGTCTGATGCGGCCTG GCCTCTCGCCCGCAGTTCTCTCGGCACTGGTGACTGGCGAGAGCCTGGAG CGGCTTCGGAGAGGGCTAGCTGCTGGAACCAGCA, changing the sequence of the underlined part to ACCGCC, which changes the 23 rd amino acid of HBEGF from glycine to alanine. The sequence is submitted to the synthetic biology engineering (Shanghai) stock limited synthesis 5' end C6 amino modified single-stranded DNA template.

(3) The Cas9/gRNA plasmid co-transfected HeLa cells with the template. HeLa cells were seeded in 6cm dishes and when the cell density reached 70%, 5. mu.g of Cas9/gRNA plasmid was transfected with 10pmol of single stranded DNA template into HeLa cells using Lipofectamine 3000.

(4) Generating stable mutant cell clones. And culturing the transfected HeLa cells by adopting a limiting dilution method, culturing to form clones, and collecting the cells.

(5) Identification of cellular mutation sites. Selecting 10 cell clones, extracting the genome of the cell by using a genome DNA extraction kit, carrying out PCR amplification by using a forward primer (SEQ ID NO.4) TGGGCGGGTGTC TGATG and a negative primer (SEQ ID NO.5) CAGCTGGTCCGTGGATACAGT, sending PCR products to a sequencing company for sequencing, and comparing the sequencing results with that shown in figure 2, wherein the site mutation is successful, and compared with an unmodified single-stranded DNA template, the success rate of obtaining the mutant cell can be obviously improved by using the single-stranded DNA template modified by the 5' end C6 amino group.

Example 2: second exon insertion of hypoxanthine phosphoribosyltransferase in HEK293T cells

(1) Cas9/gRNA plasmids were constructed for the HPRT gene. Designing an HPRT target primer according to the design principle of gRNA, wherein a forward primer (SEQ ID NO. 6): AAACACCGAAAGGGTGTTTA TTCCTCA, reverse primer (SEQ ID NO. 7): CTCTAAAACTGAGGAATAAACAC CCTTT, annealing the primers to form a dimer, inserting the g RNA sequence primer dimer into a Cas9/gRNA plasmid according to a method for constructing a kit by using CRISPR-Cas9, converting competent escherichia coli, coating the competent escherichia coli on an ampicillin resistant plate, selecting 3-5 monoclonal shake bacteria, extracting the plasmid, sequencing, and comparing the plasmid with a designed recognition sequence to obtain a Cas9/gRNA plasmid with correct sequencing.

(2) Synthesizing a single-stranded DNA template modified by a 5' end C6 amino group. Obtaining DNA sequences of 50bp respectively at the upstream and downstream of the target position of the Cas9/gRNA plasmid, and placing the insertion sequence in the center to form a DNA template sequence (SEQ ID NO. 8): CTAATCATTATGCTGAGGATTTGGGTTTAATTGAGTTGT CATATGTTAATAACGGTATACTAATTATGGACAGGTAAGTAAGATCTTAAAA TGAGGTTTTTTAC, wherein the underlined part is the insertion sequence, the sequence was submitted to the synthetic bioengineering (Shanghai) limited synthesis of 5' C6 amino modified, C12 amino modified single stranded DNA template and unmodified template.

(3) The Cas9/gRNA plasmid was co-transfected with the template into HEK293T cells. Cells were seeded in 6cm dishes and when cell density reached 70%, HEK293T cells were transfected with 5 μ g Cas9/gRNA plasmid and 10pmol single stranded DNA template or unmodified template using Lipofectamine 3000.

(4) Efficiency of insertion of the sequence into the genome was tested. Extracting genome of cells by using a genome DNA extraction kit 2 days after transfection, taking a forward primer (SEQ ID NO.9) AGGTTATGACCT TGATTTATTTTGCA and a negative primer (SEQ ID NO.10) AACAGCTGCTGATGTTT GAAATTAA amplification targeting region as an internal reference, taking an insert sequence amplified by using a forward primer (SEQ ID NO.11) GAGT TGTCATATGTTAATAACGGTAT and a negative primer (SEQ ID NO.12) AACAGCTGCTGATGTTTGAAATTAA as a target fragment, and detecting the relative content of the insert sequence by using fluorescent quantitative PCR (polymerase chain reaction), wherein the result is shown in figure 3, and compared with an unmodified template and a single-stranded DNA template modified by a 5 'end C12 amino group, the template modified by a 5' end C6 amino group obviously improves the insert efficiency of the fragment.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Sequence listing

<110> Suzhou university

<120> method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing

<160>12

<170>PatentIn version 3.3

<210>1

<211>27

<212>DNA

<213> (Artificial sequence)

<400>1

aaacaccgtt ctctcggcac tggtgac 27

<210>2

<211>28

<212>DNA

<213> (Artificial sequence)

<400>2

ctctaaaacc tgaccagtgc cgagagaa 28

<210>3

<211>100

<212>DNA

<213> (Artificial sequence)

<400>3

tgtctgatgc ggcctggcct ctcgcccgca gttctctcgg cactggtgac tggcgagagc 60

ctggagcggc ttcggagagg gctagctgct ggaaccagca 100

<210>4

<211>17

<212>DNA

<213> (Artificial sequence)

<400>4

tgggcgggtg tctgatg 17

<210>5

<211>21

<212>DNA

<213> (Artificial sequence)

<400>5

cagctggtcc gtggatacag t 21

<210>6

<211>27

<212>DNA

<213> (Artificial sequence)

<400>6

aaacaccgaa agggtgttta ttcctca 27

<210>7

<211>28

<212>DNA

<213> (Artificial sequence)

<400>7

ctctaaaact gaggaataaa cacccttt 28

<210>8

<211>104

<212>DNA

<213> (Artificial sequence)

<400>8

ctaatcatta tgctgaggat ttgggtttaa ttgagttgtc atatgttaat aacggtatac 60

taattatgga caggtaagta agatcttaaa atgaggtttt ttac 104

<210>9

<211>26

<212>DNA

<213> (Artificial sequence)

<400>9

aggttatgac cttgatttat tttgca 26

<210>10

<211>25

<212>DNA

<213> (Artificial sequence)

<400>10

aacagctgct gatgtttgaa attaa 25

<210>11

<211>26

<212>DNA

<213> (Artificial sequence)

<400>11

gagttgtcat atgttaataa cggtat 26

<210>12

<211>25

<212>DNA

<213> (Artificial sequence)

<400>12

aacagctgct gatgtttgaa attaa 25

Claims

1. A method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing is characterized in that C6 amino is modified at the 5 'end of a single-stranded DNA template, and the single-stranded DNA template with the C6 amino modified at the 5' end and a CRISPR-Cas9 system transfect cells together to improve the homologous recombination repair efficiency in the gene editing.

2. The method of claim 1, wherein the gene editing is knockout, insertion, mutation, or any combination thereof of a chromosomal gene using a gene editing tool.

3. The method of claim 1, wherein the cell is one of a bacterial, fungal, animal or plant cell.

4. The method according to claim 1, characterized in that it comprises in particular the steps of:

5. The method of claim 4, wherein the DSB of the single-stranded DNA template has 50-60 bp DNA sequences at both ends.

6. The method according to claim 4, wherein in step S2, the insert and/or the mutant sequence are present in the homologous single-stranded DNA template.

7. The method according to claim 4, wherein the method for transferring the CRISPR-Cas9 system and the single-stranded DNA template into the cell is a lipofection method, an electroporation transfection method or a microinjection method.

8. A kit for gene editing comprising a CRISPR-Cas9 system and a single-stranded DNA template with a 5' end modified C6 amino group.

9. Use of the method of any one of claims 1 to 7 for constructing point mutations in heparin-binding epidermal growth factor-like growth factors.

10. Use of the method of any one of claims 1 to 7 in the insertion of the second exon of hypoxanthine phosphoribosyltransferase in HEK293T cells.