CN114874991A

CN114874991A - I-type interferon receptor gene knockout bovine kidney cell line and construction method and application thereof

Info

Publication number: CN114874991A
Application number: CN202210438460.7A
Authority: CN
Inventors: 郭爱珍; 耿元晨; 姜传文; 杨浩; 项志杰; 陈颖钰; 胡长敏; 陈曦; 陈建国; 徐肖文; 覃城皇
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-04-25
Filing date: 2022-04-25
Publication date: 2022-08-09
Anticipated expiration: 2042-04-25
Also published as: CN114874991B

Abstract

The invention discloses an I-type interferon receptor (IFNAR1) gene knockout bovine kidney cell line, which is obtained by performing gene editing on bovine kidney cells by using a CRISPR/Cas9 gene editing technology and performing monoclonal selection. The phenotype verification shows that the IFNAR1 knocked-out bovine kidney cell line does not express IFNAR1 and is infected by Bovine Viral Diarrhea Virus (BVDV), bovine infectious rhinotracheitis virus (IBRV) and 3-type bovine parainfluenza virus (BPIV-3), the virus titer can be obviously improved, and therefore the method can be used for separation and identification of bovine-derived virus clinical strains and improving the virus propagation efficiency.

Description

I-type interferon receptor gene knockout bovine kidney cell line and construction method and application thereof

Technical Field

The invention belongs to the field of biology, and relates to a bovine kidney cell line knocked out by an I type interferon receptor (IFNAR1), and also relates to application of the cell line in bovine virus separation, identification, replication and propagation and a construction method thereof.

Background

Interferon (IFN) is a cytokine with antiviral, antitumor and immunomodulatory functions. There are generally three main categories: type I interferons represented by IFN-alpha and IFN-beta, type II interferons represented by IFN-gamma, and type III interferons represented by IFN-lambda. Research has shown that IFN-I can inhibit I-type interferon signal and promote the control of persistent infectious virus. The antiviral effect of interferon is indirectly dependent on autocrine or paracrine path, after virus infects cells, target cells release interferon, the released interferon can combine with IFN receptor on the surface of downstream cells, activate signal transduction path in cells, and regulate the growth and differentiation of cells by activating protein molecules on multiple signal transduction paths in cells, so that the downstream cells are free from virus infection, thereby achieving the aim of antivirus, while the interferon itself does not play the role of directly 'killing' or 'neutralizing' virus, and the process of the interferon from generation to affecting the downstream cells to generate antiviral reaction can be called JAK-STAT-signal path. After a cell is infected with a virus, in a target cell, an interferon is combined with an interferon receptor of a downstream cell to transmit a signal to the downstream cell, and based on the signal, the invention provides a thought for blocking or reducing a JAK-STAT signal passage by knocking out the interferon receptor so as to increase virus replication.

Bovine Viral Diarrhea Virus (BVDV), Bovine Infectious rhinotracheitis virus (IBRV), and Bovine parainfluenza virus type 3 (BPIV-3) the most common pathogenic viruses of cattle are the major viral pathogens of the Bovine respiratory disease syndrome (BRD). Wherein, the BVDV belongs to the Flaviviridae and pestivirus, has high homology with classical swine fever virus and sheep boundary disease virus, and has a single-stranded RNA virus with envelope and spherical shape. BVDV, in addition to causing BRD, causes bovine viral diarrhea-a mucosal disease characterized clinically mainly by respiratory and intestinal diseases due to fever, cough, reproductive disorders, immunosuppression, persistent infection, thrombocytopenia and hemorrhage, and fatal mucosal diseases, and is worldwide distributed. Persistent infection individual symptoms are hidden, animal toxicity rate is high, and particularly propagation of infected animals is seriously influenced, so that the continuous infection individual symptoms are one of epidemic diseases causing great economic loss to cattle raising industry worldwide. However, BVDV proliferates slowly in bovine kidney cells (Madin-Darby bone kidney cells, MDBK cells) and has low virus titer, which causes great difficulty in clinical isolation and identification of viruses.

The CRISPR/Cas9 system composed of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated protein 9 (Cas 9) is a third-generation artificial endonuclease, has the advantages of simple and rapid construction method, low cost, high mutation efficiency, easy implementation and the like, is widely applied to the fields of animal and plant disease resistance breeding, genetic character improvement, human genetic disease research and the like, leads a huge leap in the field of genome engineering, and is the most commonly used gene editing technology at present.

Therefore, the IFNAR1 gene of the MDBK cell is mutated by using CRISPR/Cas9 gene editing technology. Further verifying the virus propagation efficiency of the mutant cell strain after infecting bovine-derived viruses, and providing excellent host cells for more efficiently separating and identifying the bovine-derived viruses.

Disclosure of Invention

The invention aims to solve the problems that BVDV is slow to proliferate in MDBK cells and virus titer is low, and provides a gene knockout bovine kidney cell line, which improves the proliferation efficiency of bovine viruses by knocking out type I interferon receptors, so that the MDBK cells can be better applied to clinical separation and identification of the bovine viruses.

In order to achieve the purpose, the applicant uses a CRISPR/Cas9 system as a research tool to perform gene knockout on an interferon type I receptor (IFNAR1) of an MDBK cell to obtain an IFNAR1 knockout MDBK cell line, and after cell phenotype verification, the MDBK cell after gene knockout does not express IFNAR1, so that the virus titers of Bovine Infectious rhinotracheitis viruses (IBRV), Bovine parainfluenza viruses type 3 (BPIV-3), and Bovine Viral Diarrhea Viruses (BVDV) can be increased, and the application prospect in Bovine-derived virus replication and propagation is better.

The invention further provides a method for constructing the gene knockout bovine kidney cell line, wherein the applicant designs 4 sgRNAs aiming at IFNAR1 gene sequences, then performs lentivirus packaging aiming at plasmids of the 4 sgRNAs respectively, resuscitates the cultured MDBK cell line containing Cas9 protein before infecting a laboratory with the packaged lentivirus, obtains the surviving MDBK polyclonal cell with IFNAR1 knockout through drug screening, and finally performs monoclonal selection. When the monoclonal cells are cultured to a certain number, the genome is extracted, and sequencing analysis is carried out to analyze the mutation type. Finally, the selected monoclonal cells are subjected to phenotype verification to obtain the MDBK cell line knocked out by IFNAR 1.

The method comprises the following specific steps:

(1) constructing bovine kidney cells containing Cas9 protein;

(2) designing a sgRNA sequence aiming at a bovine kidney cell type I interferon receptor gene and a primer thereof, and constructing a sgRNA expression plasmid;

(3) packaging an sgRNA expression plasmid by lentivirus;

(4) infecting bovine kidney cells containing Cas9 protein by using lentivirus packaging sgRNA expression plasmids to obtain a polyclonal bovine kidney cell line knocked out by type I interferon receptors;

(5) monoclonal cells were selected by cloning from a polyclonal bovine kidney cell line.

Preferably, the sgRNA sequence is shown in SEQ ID NO. 1.

Preferably, primers of the sgRNA sequences are shown as SEQ ID No.2 and SEQ ID No. 3.

Preferably, the vector of the sgRNA expression plasmid is a T vector.

The invention has the following advantages:

1. the gene knockout cell line constructed by the invention utilizes CRISPR/Cas9 gene editing technology and has the advantages of simple and quick construction method, low cost, high mutation efficiency and the like.

2. The gene knocked-out cell line constructed by the invention is a type I interferon receptor, so that the titer of bovine-derived viruses (BVDV, BPIV-3 and IBRV) can be remarkably improved compared with that of wild MDBK cells.

3. The gene knockout cell line constructed by the invention is MDBK cell, so that the gene knockout cell line can be used for clinical separation of bovine-derived virus, and solves the problems of clinical separation, virus identification and proliferation.

Refer to the specific embodiments for more detailed technical solutions.

Drawings

FIG. 1: according to the cleavage efficiency determination result of the MDBK cell containing the Cas9 protein, 5 strains of cells are selected for Cas9 activity detection, wherein the MDBK cell with the number I is highest in cleavage efficiency and strongest in activity.

FIG. 2: an experimental result of the T7E1 enzyme digestion knockout efficiency is detected through electrophoresis, and it is verified that 4 sgRNAs all cause effective cleavage.

FIG. 3: sequencing results of IFNAR1 knock-out MDBK cell line numbered sgRNA 2-10. In the figure: WT: wild type MDBK cell sequence, -represents a base deletion.

FIG. 4: sequencing results of IFNAR1 knock-out MDBK cell line numbered sgRNA 4-L. In the figure: the sgRNA sequence is represented in box, and the peak pattern of sgRNA4-L shows a double peak at the sgRNA position.

FIG. 5: TA clone sequencing of IFNAR1 knock-out MDBK cells numbered sgRNA 4-L. In the figure: WT: wild type MDBK cell sequence, -represents a base deletion. Wherein, the mutation type 1 accounts for 60 percent of the total number, the mutation type 2 accounts for 36.7 percent of the total number, the mutation type 3 accounts for 3.3 percent of the total number, and the mutation rate reaches 100 percent in 30 selected clones.

FIG. 6: IFNAR1 knockouts MDBK cell phenotype validation of sgRNA2-10, sgRNA 4-L. In the figure: WT is wild type MDBK, # p <0.05, # p <0.01, # p <0.001, mean ± SEM (n ═ 3).

FIG. 7: transcript level expression of IFNAR1 knockout MDBK cells numbered sgRNA4-L relative to quantitative PCR results. In the figure: WT is wild-type MDBK, # p <0.001, mean ± SEM (n ═ 3).

Detailed Description

The technical solution of the present invention will be further described in detail with reference to the following specific examples. It should be understood that the following examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. Various modifications and equivalents will be apparent to those skilled in the art based on the following examples and are intended to fall within the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions or the instruction book molecular cloning: the Laboratory Manual (New York: Cold Spring Harbor Laboratory,1989) or according to the method suggested in the manufacturer's manual. Materials of origin not noted in the examples, such as MDBK cells, Cas9 protein, 293T cells, packaging plasmids, MSTN lentiviruses, T vectors, and the like, are all commonly used materials well known in the art, and can be constructed per se according to literature reports or obtained commercially. The specific information of the plasmid in the experiment can be found in http:// www.addgene.org/query, Cas9 plasmid (#52962), and the information of the enzyme digestion plasmid is pKLV2-U6gRNA5(BbsI) -PGKkuro 2ABFP (#67991), packaging helper plasmids PMD2.G (#12259), and PSPAX2(# 12260).

Example 1: construction of MDBK cells containing Cas9 protein

The CRISPR/Cas9 gene knockout system is a new generation of sharps for gene knockout due to convenient construction and flexible design. The system consists of Cas9 protein with DNA cutting activity and guide RNA for identifying specific target spots, and the target spot identification can be realized only by editing the guide RNA in the system, so that the efficiency of constructing a gene knockout carrier is greatly improved. The construction of a stable transgenic cell line for stably expressing the Cas9 protein is a precondition for realizing gene knockout, and the construction method of the currently commonly used stable transgenic cell line for the Cas9 protein comprises the following steps: packaging a slow virus expressing the Cas9 protein, infecting a target cell by the Cas9 slow virus, screening a stable transfer cell line and verifying functions.

According to the experiment, a lentiviral expression vector of the Cas9 protein is constructed, an MDBK cell strain for stably expressing the Cas9 protein is constructed by utilizing the characteristics of high-efficiency transfection and stable expression of lentivirus, and the target gene knockout can be realized only by introducing small-molecule sgRNA in subsequent experiments. The specific method comprises the following steps:

1. lentiviral packaging Cas9 expression plasmid

Recovering and culturing: recovering 293T cells in a 10cm cell culture dish, carrying out passage after the cells grow full, taking 3 generations of 293T cells with good growth state (10cm cell culture dish, 90% -95% confluence, 10% FBS-containing fresh antibiotic-free DMEM culture medium), and packaging the lentiviruses.

Transfection: removing old culture medium before transfection, adding DMEM culture medium containing 5% FBS and 1% penicillin-streptomycin double antibody, and continuously returning to the incubator for culture (PBS is considered to be used for washing once when the number of floating cells is large); the total amount of plasmid at lentiviral packaging was 24 μ g for a 10cm cell culture dish, of which (pmd2. g: PSPAX 2: Cas plasmid ═ 1: 2: 3); sequentially adding plasmids with corresponding volumes into 500 mu L of Jetprime Buffer, slightly blowing, beating and uniformly mixing, adding 40 mu L of Jetprime Regent, slightly blowing, uniformly mixing, standing at room temperature for 10min, adding into a culture dish, slightly shaking uniformly, and returning to an incubator; replacing 10ml DMEM medium containing 5% FBS and 1% double antibody 4-6h after virus packaging, and placing back to the incubator for continuous culture; and after 24 hours of liquid replacement, adding 10ml of DMEM medium containing 5% FBS and 1% double antibody, mixing uniformly, and then putting back to the incubator.

Super separation: packaging the virus for 60-72 h, observing cell morphology, collecting cell supernatant (every 2 cell culture dishes with the size of 10cm are placed in a 50mL centrifuge tube), sealing by using a sealing film, centrifuging for 10min at 3000rpm/min at 4 ℃, filtering the supernatant by using a 0.45-micrometer filter to an ultracentrifuge tube, and then centrifuging for 2.5h at superhigh speed at 4 ℃ at 30000 rpm; pouring out the supernatant, reversing the supernatant on absorbent paper to suck out the residual liquid, adding 120 mu L of precooled PBS into each tube for resuspension, completely blowing out and uniformly mixing, transferring the same virus concentrated solution into the same collecting tube, and dispersing overnight at 4 ℃; subpackaging according to later experimental demand, and storing at-80 deg.C.

2. Obtaining MDBK polyclonal cell containing Cas9 protein

Firstly recovering MDBK in a six-hole plate, and after the plate grows full, performing the steps of 1:3, passage, when the cells grow to about 60%, discarding the old culture medium, adding 1mL of cell maintenance liquid (DMEM containing 2% FBS + 1% double antibody) into each well, then adding 1 uL of polybreme, adding 40 uL of Cas9 lentivirus, mixing uniformly, incubating for 24h, discarding the old culture medium, adding 2mL of DMEM culture liquid containing 5% FBS and 1% double antibody, incubating for 24h, and then replacing 2mL of DMEM culture liquid containing 5% FBS, 1% double antibody and 5 ug/mL blasticidin for drug screening. And (3) after all the negative control drug sieve holes die, carrying out passage on the positive control and the negative control (note: the positive control holes are carried out in a 1:2 passage six-hole plate, the negative control is carried out in two holes, and one negative control drug sieve group is used), and carrying out action on the positive control and the negative control drug sieve group for 7 days to obtain the MDBK polyclonal cell line containing the Cas9 protein.

3. MDBK (multidrug-resistant protein) monoclonal selection and protein verification of Cas9 protein

After the MDBK polyclonal cell line containing the Cas9 protein is subjected to expanded culture, cells are counted, 100 cells are taken to be paved into 1 96-well plate, and 2 96-well plates are paved together. Cell exchange was performed every 5 days (DMEM containing 10% FBS + 1% double antibody), cells grown in one well were digested and transferred to a six-well plate, a part of the cells were cultured in an expanded state and frozen, a part of the cells were extracted for cell protein, the extracted protein was subjected to Western Blot, and a total of 38 cells among the 49 cell lines that were verified contained Cas9 protein.

4. Cas9 activity assay for monoclonal cell lines determined to contain Cas9 protein

Selecting five MDBK-Cas9 cells (numbers are respectively I, P, O, 20 and 25) according to the state and the activity of the MDBK cells, recovering the cells to a six-well plate for culture, removing the original culture medium when the cells grow to about fifty percent, adding 1mL of cell maintenance solution (DMEM containing 2% FBS and 1% double antibody), adding 1 μ L of Polybrene Transfection reagent (action concentration is 10 μ g/μ L), adding 30 μ L of MSTN slow virus, shaking uniformly, placing the mixture into a constant temperature incubator for culture for 24h, changing 2mL of cell maintenance solution, changing for 36h, changing the drug sieve solution (DMEM containing 2% FBS, 1% double antibody and 2 μ g/mL puromycin), after the cells of the negative control drug sieve are dead, subculturing the cells of 1:3 of positive drug sieve holes after the negative control drug sieve holes are dead, acting for about ten days, utilizing TIANP kit (Genomic DNAkiki Co.), the goods number is: DP304-02) kit for cell DNA extraction.

The extracted genome concentration was uniformly adjusted to 300 ng/. mu.L (+ -10 ng/. mu.L), followed by PCR amplification. The sequences of the amplification primers are shown in Table 1, and the PCR reaction system is prepared according to Table 2. The procedure was pre-denaturation at 98 ℃ for 5min with a cycle number of 1; denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 15s, and extension at 72 ℃ for 30s, wherein the cycle number is 35; finally, extension is carried out for 5min at 72 ℃.

TABLE 1 amplification of MSTN primer sequence information

Primer name	Primer sequence information (5 '-3')
		MSTN-F	CACCCACAGCGATCTACTACCAT
MSTN-R	CAGGCATTCAGATACTCAAACGG

TABLE 2 PCR amplification reaction System

Composition (I)	System (mu L)
		2×preme STAR MAX premix	25
Primer-F	2.5
		Primer-R	2.5
DNA Sample	0.5
		ddH ₂ O	19.5
Total up to	50

The band and size of interest were determined by electrophoresis on a 2% agar gel. The PCR product was purified using the Universal DNA Purification Kit (Inc.: Tiangen Biochemical technology Co., Ltd.; Cat. No.: DP214-03), the concentration was uniformly adjusted to 20 ng/. mu.L (+ -2 ng/. mu.L), and the T7E1 digestion reaction system was prepared according to Table 3 to perform the T7E1 digestion experiment. The procedure was to denature at 95 ℃ for 5min without adding T7E1 enzyme, reduce the temperature from 95 ℃ to 85 ℃ by 2 ℃ per second and from 85 ℃ to 25 ℃ by 0.1 ℃ per second, then add 1. mu.L of T7E1 enzyme, mix well and react at 37 ℃ for 30 min. The final 2% agar gel electrophoresed the band of interest and size. As shown in FIG. 1, the MDBK cell with the number I has the highest cleavage efficiency and the strongest activity, so that the MDBK-Cas9-I is selected for subsequent experiments.

TABLE 3T 7E1 digestion system

Example 2: IFNAR1 knockout MDBK monoclonal cell construction

1. Resuscitating and subculturing MDBK cells containing Cas9 protein selected in early stage of laboratory

The previously preserved MDBK cells containing Cas9 protein (MDBK-Cas9-I) were first removed from liquid nitrogen and quickly placed in a 37 ℃ water bath with constant shaking to thaw the cells. The thawed cells were placed in a sterile operating table, and 5mL of cell culture medium (DMEM containing 5% FBS and 2% diabody) was first pipetted, followed by aspiration of the cell suspension, repeated pipetting several times, and injection into a centrifuge tube. 1000r/min, centrifuging for 5min, and discarding the supernatant. Adding 2mL of cell culture medium into a centrifuge tube, repeatedly blowing and beating uniformly, transferring the cells into a six-hole plate, placing at 37 ℃ and 5% CO ₂ Culturing in a constant temperature incubator.

Subculture was performed when the six well plates were approximately 95% to 100% confluent with cells. The specific operation steps comprise taking out the six-hole plate which is fully paved with MDBK-Cas9-I cells from a constant temperature incubator, discarding the old culture solution, adding 1mL PBS for cleaning, discarding the PBS, adding 1mL trypsin, placing at 37 ℃, and keeping 5% CO ₂ Incubating in a constant temperature incubator for 3min, observing whether cells fall off, adding a proper amount of cell culture medium, repeatedly beating for 10 times, transferring into a 15mL centrifuge tube, centrifuging for 5min at 1000r/min, and discarding the supernatant. 6mL of fine powder was addedAnd (3) uniformly mixing the cell culture medium by blowing, transferring the cell culture medium to 3 holes of a six-hole plate, and putting the cell culture medium back to the incubator for continuous culture.

2. Design sgRNA sequence for IFNAR1 gene, construct plasmid

2.1 design of sgRNA sequence for IFNAR1 Gene

As shown in Table 4, 4 sgRNAs were designed based on the IFNAR1(Gene ID:282257) sequence in NCBI, and 4 pairs of primers were designed for each of the 4 sgRNAs for plasmid construction.

TABLE 4 sgRNA sequences and plasmid construction primer sequence information

2.2sgRNA plasmid construction

And (3) annealing: and respectively taking 5 mu L of forward and reverse primers of each sgRNA, and carrying out an annealing program. Namely: denaturation at 95 deg.C for 10 min; annealing at 65 deg.C for 60 min.

The target fragment is connected with a T vector: then, a reaction system was prepared according to Table 5 to carry out ligation reaction of the target fragment with T vector (company: Takara; cat # 6013) at 25 ℃ for 30 min; 10min at 65 ℃.

TABLE 5T 4 ligase reaction System

Composition (I)	System (mu L)
		T4 Buffer	2
Enzyme digestion plasmid	4
		Insert DNA	10
T4 Ligase	2
		ddH ₂ O	2
Total up to	20

And (3) transformation: adding the ligation product into 50 μ L of competent cells (company: Beijing holotype Jinbiol; Cat. No.: CD201) melted on ice bath, flicking uniformly, and standing in ice bath for 30 min; heat shock in a 42 ℃ water bath for 45s, then rapidly transfer the tube to ice for 2min, taking care not to shake the centrifuge tube; adding 500 mu L of sterile LB culture medium into each centrifuge tube, uniformly mixing, placing on a shaker at 37 ℃ and 200rpm for 1h, and recovering bacteria; followed by centrifugation at 4000rpm for 5min, discarding 350. mu.L of the supernatant, leaving 200. mu.L of the resuspended transformed competence, adding to ampicillin-containing LB agar plates, spreading the cells evenly, after the liquid was absorbed, inverting the plates, and incubating overnight at 37 ℃.

Monoclonal detection: selecting single clone, adding into LB liquid culture medium containing ampicillin resistance, placing on shaker at 37 deg.C and 200rpm for amplification culture for about 4-5 hr, and mixing. 200 μ L of the bacterial solution was taken and sent to the department of Oncology for sequencing.

Extraction of sgRNA expression plasmid: the sequencing-successful monoclonal bacterial solution was used to extract sgRNA expression plasmid according to a plasmid miniprep kit (company: Omega Bio-Tek; cat # D6950-02).

Obtaining of IFNAR1 knockout MDBK polyclonal cell line

Lentiviral packaging of sgRNA expression plasmids was performed in analogy to example 1, step 1, followed by resuscitation of MDBK-Cas9-I in six-well plates, followed by 1:3, passage, when the cells grow to about 60%, discarding the old culture medium, adding 1mL of cell maintenance liquid (DMEM containing 2% FBS + 1% double antibody) into each hole, then adding 1 uL of polybreme, then respectively adding 40 uL of sgRNA slow viruses, mixing uniformly, incubating for 24h, discarding the old culture medium, adding 2mL of culture medium containing 5% FBS and 1% double antibody, incubating for 24h, and then replacing 2mL of DMEM culture medium containing 5% FBS, 1% double antibody and 2 ug/mL puromycin to carry out drug screening. And (3) after all the negative control drug screening holes die, carrying out passage on the positive control and the negative control (note: the positive control holes are carried out in a 1:2 passage six-hole plate, the negative control is carried out in two holes, and one negative control drug screening group is used as the negative control drug screening group), and carrying out the action on the positive control and the negative control drug screening groups for 7 days to obtain the MDBK cell line with the IFNAR1 knockout. One part is frozen by expanding culture, and the other part is used for extracting cell DNA by using a TIAnmp Genomic DNAkit kit.

T7E1 enzyme digestion verification knockout efficiency

The concentration of the genome extracted in step 3 was uniformly adjusted to 300 ng/. mu.L (+ -10 ng/. mu.L), followed by PCR amplification. The PCR reaction system was prepared according to the following Table 2, with the sequences of the amplification primers shown in Table 6. The procedure was pre-denaturation at 98 ℃ for 5min with a cycle number of 1; denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 15s, and extension at 72 ℃ for 30s, with the cycle number being 35; finally, extension is carried out for 5min at 72 ℃.

TABLE 6 amplification of primer sequence information of target fragments

Primer name	Primer sequence information (5 '-3')
		sgRNA1-F	CACAGCTCAGATTGGTCCCC
sgRNA1-R	GCAAAACTTCCTTCTTACCTGTGG
		sgRNA2,3-F	CTGGCCTATTACAGGTGCTCA
sgRNA2,3-R	ACACAGTCTTTTTACCTCAGCAT
		sgRNA4-F	GTGCCTCAGTCTCCGTCGC
sgRNA4-R	GTGCCTCAGTCTCCGTCGC

The band and size of interest were determined by electrophoresis on a 2% agar gel. The PCR product was purified using the Universal DNA Purification Kit, the concentration was uniformly adjusted to 20 ng/. mu.L (+ -2 ng/. mu.L), and the T7E1 enzyme digestion reaction system was prepared according to Table 3 for the T7E1 enzyme digestion experiment. The procedure was to denature at 95 ℃ for 5min without adding T7E1 enzyme, reduce the temperature from 95 ℃ to 85 ℃ by 2 ℃ per second and from 85 ℃ to 25 ℃ by 0.1 ℃ per second, then add 1. mu.L of T7E1 enzyme, mix well and react at 37 ℃ for 30 min. The final 2% agar gel was electrophoresed to confirm the band and size of interest. Results as shown in fig. 2, all 4 sgrnas caused effective knockouts.

Selection of IFNAR1 knockout MDBK monoclonal cells

Recovering the MDBK polyclonal cell line knocked out by IFNAR1 in a six-well plate, counting cells after the cells are full, respectively paving 1 96-well plate for 100 cells, and paving 2 96-well plates for each sgRNA knocked-out cell line. Cell change was performed every 5 days (DMEM containing 10% FBS + 1% double antibody), observed day by day, cells grown from one well were digested and transferred to a six-well plate, a portion was cultured and frozen, and a portion was extracted with the tiamamp Genomic DNAKit.

The extracted DNA was subjected to PCR amplification, the PCR product was subjected to Daphniphyllaceae sequencing, and the mutation type was determined as compared with that of wild-type MDBK, and the sequencing results of IFNAR 1-knocked-out MDBK cell line with the number of sgRNA2-10, as shown in FIG. 3, had 7-base deletion, and the sequencing results of IFNAR 1-knocked-out MDBK cell line with the number of sgRNA4-L, as shown in FIG. 4, had a double peak at the sgRNA position. IFNAR1 knockout MDBK monoclonal cells numbered sgRNA1 and sgRNA3 no longer displayed monoclonal selection results because late stage validation found no difference in phenotype from wild type MDBK cells.

TA clone validation of mutation types

The IFNAR1 knockout MDBK cell genome with the serial number of sgRNA4-L extracted in step 5 was subjected to PCR amplification. The PCR reaction system was prepared as shown in Table 7 and Table 8, based on the sequence information of the primers. The procedure was pre-denaturation at 95 ℃ for 3min with a cycle number of 1; denaturation at 95 ℃ for 15s, annealing at 59.5 ℃ for 15s, and extension at 72 ℃ for 30s, with cycle number of 45; finally, extension is carried out for 5min at 72 ℃.

TABLE 7 TA cloning primer sequence information

Primer name	Primer sequence information (5 '-3')
		sgRNA4-Fn	AGTGGGTGGCCGAAAGATGT
sgRNA4-Rn	GTCTCCCAATGAGGGCGTCT

TABLE 8 TA cloning PCR reaction System

Composition (I)	System (mu L)
		2×Taq Master Mix	25
Primer-F	2
		Primer-R	2
DNA Sample	1
		ddH ₂ O	20
Is totaled	50

The band and size of interest were determined by electrophoresis on a 2% agar gel. The PCR product was purified using the Universal DNA Purification Kit, and the T-vector ligation system was prepared according to Table 9, followed by 16 ℃ ligation for 30 min.

TABLE 9T Carrier ligation reaction System

Composition (I)	System (mu L)
		PMD19T Vector	1
Insert DNA	1.5
		ddH ₂ O	2.5
Solution I	5
		Total up to	10

And (3) transformation: adding the connecting product into the competent cells melted on 50 mu L of ice bath, flicking uniformly, and placing in the ice bath for 30 min; heat shock in a 42 ℃ water bath for 45s, then rapidly transfer the tube to ice for 2min, taking care not to shake the centrifuge tube; adding 500 mu L of sterile LB culture medium into each centrifuge tube, uniformly mixing, placing on a shaker at 37 ℃ and 200rpm for 1h, and recovering bacteria; followed by centrifugation at 4000rpm for 5min, discarding 350. mu.L of the supernatant, leaving 200. mu.L of the resuspended transformed competence, adding to ampicillin-containing LB agar plates, spreading the cells evenly, after the liquid was absorbed, inverting the plates, and incubating overnight at 37 ℃.

Monoclonal detection: selecting 30 monoclonals, adding into LB liquid culture medium containing ampicillin resistance, placing on a shaker at 37 deg.C and 200rpm for amplification culture for about 4-5h, and mixing. 200 mu L of bacterial liquid is taken and sent to the department of Oncology for sequencing, the result is shown in figure 5, all 30 selected monoclonals are knock-out cells, and the mutation rate is 100%.

Example 3: monoclonal cell phenotype verification of IFNAR1 knockout MDBK cells

Respectively recovering wild MDBK and two IFNAR1 knockout MDBK cell lines with the serial numbers of sgRNA2-10 and sgRNA4-L in a T25 cell bottle, counting cells after the bottle is full, and respectively taking 3.5 multiplied by 10 ⁶ Plating a T25 cell bottle, carrying out cell counting after 24h of adherence, then inoculating BVDV according to 0.1MOI, carrying out inoculation after the cytopathic effect is complete, and respectively measuring TCID of BVDV obtained by 3 strains of wild MDBK, sgRNA2-10 and sgRNA4-L ₅₀ And observing the phenotypic difference.

The above process is repeated, and IBRV and BPIV-3 are respectively connected to verify whether the phenotypes are different. The results are shown in FIG. 6, where there was a significant increase in viral titer in IFNAR1 knockout MDBK cell line numbered sgRNA4-L, whether BVDV, IBDV, or BPIV-3.

Example 4: IFNAR1 knockout MDBK cell transcription level verification

RNA was extracted from wild-type MDBK and IFNAR1 knock-out MDBK cell line numbered sgRNA4-L by Trizol method, and RNA was reverse transcribed into cDNA by reverse transcription kit (Nanjing Novodax Biotech Co., Ltd.; cat # R223-01), and then verified by relative quantitative PCR, in which IFNAR1 transcription level expressed primer sequences of relative quantitative PCR as shown in Table 10, and an absolute quantitative PCR reaction system was prepared according to Table 11. The procedure was pre-denaturation at 95 ℃ for 5min with a cycle number of 1; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, default melting curve of the instrument. The results are shown in fig. 7, where IFNAR1 knockout MDBK numbered sgRNA4-L was significantly reduced in expression at the transcriptional level compared to wild-type MDBK cells.

TABLE 10 relative quantitative PCR primer sequence information

Primer name	Primer sequence information (5 '-3')
		GAPDH-F	ACCCAGAAGACTGTGGATGG
GAPDH-R	CAACAGACACGTTGGGAGTG
		IFNAR1-F	TTCCTCCAGTCATCAGCGTG
IFNAR1-R	GCGGGTAGAGCTGATTCACA

TABLE 11 relative quantitative PCR amplification reaction System

Composition (I)	System (mu L)
		2×AceQ Qpcr SYBR Green Master Mix	10
Primer-F	0.4
		Primer-R	0.4
Template cDNA	2
		ddH ₂ O	7.2
Total up to	20

Finally, the obtained gene knockout cell is named as bovine kidney cell 4-L, and the cell is preserved in China Center for Type Culture Collection (CCTCC) of Wuhan university in Wuhan, China at 4 months and 1 day 2022, with the preservation number of CCTCC NO: C202287. the skilled person will be able to obtain such cells reproducibly following the procedures described in the specific examples of the description.

Sequence listing

<110> university of agriculture in Huazhong

<120> I-type interferon receptor gene knockout bovine kidney cell line, and construction method and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gggcgcgacg accctgatgc 20

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caccggcatc agggtcgtcg cgccc 25

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaacgggcgc gacgaccctg atgcc 25

Claims

1. A knockout bovine kidney cell line, characterized by: the knocked-out gene of the bovine kidney cell line is type I interferon receptor (IFNAR 1).

2. The use of the knockout bovine kidney cell line of claim 1 for replicating and propagating bovine-derived viruses.

3. Use according to claim 2, characterized in that: the Bovine-derived virus is Infectious Bovine Rhinotracheitis Virus (IBRV), Bovine parainfluenza virus type 3 (BPIV-3), and Bovine Viral Diarrhea Virus (BVDV).

4. A method for constructing a knockout bovine kidney cell line according to claim 1, which comprises the steps of:

(1) constructing bovine kidney cells containing Cas9 protein;

(3) packaging an sgRNA expression plasmid by lentivirus;

(4) infecting a bovine kidney cell containing Cas9 protein by using a lentivirus for packaging sgRNA expression plasmids to obtain a polyclonal bovine kidney cell line knocked out by a type I interferon receptor;

5. The method for constructing a knockout bovine kidney cell line according to claim 4, wherein: the sequence of the sgRNA is shown in SEQ ID NO. 1.

6. The method for constructing a knockout bovine kidney cell line according to claim 5, wherein: the primers of the sgRNA sequences are shown in SEQ ID NO.2 and SEQ ID NO. 3.

7. The method for constructing a knockout bovine kidney cell line according to claim 4, wherein: the vector of the sgRNA expression plasmid is a T vector.