CN111733292A - Primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof - Google Patents
Primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof Download PDFInfo
- Publication number
- CN111733292A CN111733292A CN202010707560.6A CN202010707560A CN111733292A CN 111733292 A CN111733292 A CN 111733292A CN 202010707560 A CN202010707560 A CN 202010707560A CN 111733292 A CN111733292 A CN 111733292A
- Authority
- CN
- China
- Prior art keywords
- ciav
- anv
- viruses
- primers
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer group for identifying avian nephritis viruses and chicken infectious anemia viruses, which comprises a primer pair I and a primer pair II, wherein the primer pair I consists of primers ANV-F and ANV-R, and the primer pair II consists of primers CIAV-F and CIAV-R; primers ANV-F, ANV-R, CIAV-F and CIAV-R have base sequences of sequence tables SEQ.ID.NO.1 to SEQ.ID.NO.4 respectively. Accordingly, the inventor also establishes a corresponding detection and identification method and develops a corresponding kit. The duplex PCR established by the invention can be used for quickly detecting the mixed infection of the avian nephritis virus and the chicken infectious anemia virus, is suitable for large-scale detection, can save cost and time, can reduce pollution, and has high practical value.
Description
Technical Field
The invention belongs to the technical field of detection of avian nephritis viruses and chicken infectious anemia viruses, and particularly relates to a primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof.
Background
Avian Nephritis Virus (ANV) is an enterovirus, mainly infects chickens at all ages, but mainly affects chickens, and can be detected in turkeys, ducks and pigeons. The virus mainly causes a typical sub-clinical symptom, has weak pathogenicity but strong infectivity, can be rapidly spread in chicken flocks, is firstly discovered in Japan in 1976, then occurs in other countries, is widely seen in all over the world, can be seriously expressed as enteritis, kidney injury, growth and development failure and the like, and is related to the short and small chicken syndrome. Infectious anemia of chicken is an infectious disease caused by infectious anemia virus (CIAV), which can cause atrophy of bone marrow and systemic lymphoid tissue of chickens within 3 weeks of age, resulting in severe anemia and bleeding, and further leading to immunosuppression of the chickens. The first discovery and report of CIAV in 1979 by Yuasa et al, Japan, followed by a report demonstrating that the disease is distributed worldwide, and that CIAV is now widespread among various chickens, and its presence has been detected even in certain SPF chickens. As the resistance of the chickens to the CIAV is enhanced along with the increase of the age of the chickens, no clinical symptoms appear after adult chickens are infected, but the breeding chickens can vertically transmit the CIAV to offspring so as to cause the offspring to have infectious anemia, and other diseases are frequently accompanied or secondary to the clinical CIAV infected chickens, so that the monitoring of CIAV pollution by various methods is extremely important for preventing and controlling the CIAV in breeding farms.
At present, the methods for diagnosing and detecting the two pathogens in a laboratory mainly comprise traditional virus separation, agar diffusion tests, indirect fluorescence tests, enzyme-linked immunosorbent assays (ELISA) and the like, but the detection methods have the defects of long time consumption, low sensitivity, difficult standardization and the like and have certain limitations in practical application, so more and more learners are dedicated to PCR detection methods.
In clinical detection, mixed infection of various pathogens often appears, and in order to be used for differential diagnosis of various pathogens, a high-throughput, low-cost and high-efficiency detection method for rapid batch detection is urgently needed. The dual (or multiplex) PCR employs multiple pairs of primers to amplify multiple templates simultaneously, overcoming the deficiencies of conventional PCR. However, in duplex (or multiplex) PCR, a plurality of templates and primers are present in the same system, and competitive inhibition may occur between primers, between templates, and between primers and templates in multiplex amplification. Therefore, it is necessary to optimize various conditions, and it is necessary to prevent nonspecific binding between the primer and the template, to avoid occurrence of nonspecific bands, and to avoid the generation of primer dimers as much as possible. In addition, the desired fragment should have a suitable gradient, with the conditions under which the primers anneal being as consistent as possible, to ensure a relative balance between the amounts of the two (or more) amplified products.
Compared with the conventional PCR, the multiplex PCR has the characteristics of simultaneously detecting and identifying a plurality of pathogens, has unique advantages and high clinical practical value in differential diagnosis of mixed infection of a plurality of pathogens, but at present, a multiplex PCR detection method for rapidly carrying out differential diagnosis on ANV and CIAV does not exist.
Disclosure of Invention
The invention aims to provide a primer group for rapidly, efficiently and accurately identifying the avian nephritis viruses and the chicken infectious anemia viruses, which is suitable for large-scale detection, can save cost and time, can reduce pollution and has high practical value.
In order to solve the technical problems, the invention adopts the following technical scheme:
the primer group for identifying the avian nephritis viruses and the chicken infectious anemia viruses comprises a primer pair I and a primer pair II, wherein the primer pair I consists of primers ANV-F and ANV-R, and the primer pair II consists of primers CIAV-F and CIAV-R; primers ANV-F, ANV-R, CIAV-F and CIAV-R have base sequences of sequence tables SEQ.ID.NO.1 to SEQ.ID.NO.4 respectively.
The molar ratio of the primers ANV-F, ANV-R, CIAV-F and CIAV-R is 1:1:1: 1.
The primer group is applied to PCR amplification, and the annealing temperature is 60.0 ℃.
The reaction system and the reaction procedure of the PCR amplification are respectively as follows:
reaction procedure: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 95 ℃ for 1min, 60.0 ℃ for 1min, and 72 ℃ for 1 min; extending for 10min at 72 ℃;
the reaction system comprises 2 XPCR Mix 12.5 uL, wherein each ANV-F, ANV-R is 1 uL, each CIAV-F, CIAV-R is 1 uL, the template is 2.0 uL, ddH2O is complemented to 25.0 mu L; the concentrations of the primers were: 0.5 pmol/. mu.L ANV-F, 0.5 pmol/. mu.L ANV-R, 0.5 pmol/. mu.L CIAV-F, 0.5 pmol/. mu.L CIAV-R.
The template is from virus DNA and virus cDNA in a sample to be tested. The virus can be Avian Nephritis Virus (ANV), Chicken Infectious Anemia Virus (CIAV), avian adenovirus type 4 (FadV-4), chicken parvovirus (ChPV), Marek's Disease Virus (MDV), infectious laryngotracheitis virus (AILTV), Newcastle Disease Virus (NDV), subtype H9 avian influenza virus (AIV-H9), subtype J avian leukemia virus (ALV-J) or Infectious Bronchitis Virus (IBV).
The sample to be detected is chicken disease material, such as chicken oral cavity swab, chicken cloaca swab, fresh chicken viscera, chicken processed product, chicken viscera processed product and the like.
The primer group is applied to the preparation of a kit for identifying the avian nephritis viruses and the chicken infectious anemia viruses.
The kit for identifying the avian nephritis virus and the chicken infectious anemia virus contains a primer group for detection; the primer group comprises a primer pair I and a primer pair II, wherein the primer pair I consists of primers ANV-F and ANV-R, and the primer pair II consists of primers CIAV-F and CIAV-R; primers ANV-F, ANV-R, CIAV-F and CIAV-R have base sequences of sequence tables SEQ.ID.NO.1 to SEQ.ID.NO.4 respectively.
Primers ANV-F, ANV-R, CIAV-F and CIAV-R were packaged separately.
The molar ratio of the primers ANV-F, ANV-R, CIAV-F and CIAV-R is 1:1:1: 1.
Aiming at the problems existing in the identification and detection of the Avian Nephritis Virus (ANV) and the Chicken Infectious Anemia Virus (CIAV), the inventor designs a primer group for identifying the avian nephritis virus and the chicken infectious anemia virus, wherein the primer group comprises a primer pair I and a primer pair II, the primer pair I consists of a primer ANV-F and an primer ANV-R, and the primer pair II consists of a primer CIAV-F and a primer CIAV-R; primers ANV-F, ANV-R, CIAV-F and CIAV-R have base sequences of sequence tables SEQ.ID.NO.1 to SEQ.ID.NO.4 respectively. Accordingly, the inventor also establishes a corresponding detection and identification method and develops a corresponding kit. The duplex PCR established by the invention can be used for quickly detecting the mixed infection of the avian nephritis virus and the chicken infectious anemia virus, is suitable for large-scale detection, can save cost and time, can reduce pollution, and has high practical value.
Drawings
FIG. 1 is an electrophoretogram corresponding to the optimization of primer concentration in example 2, in which: lanes 1-9 correspond in sequence to the double PCR amplification product obtained when reaction systems I-IX are employed, M corresponds to a 100bp DNA Marker, and N corresponds to a negative control.
FIG. 2 is an electropherogram corresponding to the optimization of annealing temperature in example 2, in which: lanes 1-8 correspond in sequence to the duplex PCR amplification products obtained at annealing temperatures I-VIII, M corresponds to a 100bp DNA Marker, and N corresponds to a negative control duplex PCR amplification product.
FIG. 3 is an electrophoretogram corresponding to the specific detection in example 3, in which: m corresponds to 100bp DNA Marker, N corresponds to negative control, P is positive control, i.e., amplification product of double PCR of mixed sample, 1 is amplification product of double PCR of DNA of CIAV, 2 is amplification product of double PCR of genomic cDNA of ANV, 3 is amplification product of double PCR of genomic DNA of FadV-4, 4 is amplification product of double PCR of DNA of ChPV, 5 is amplification product of double PCR of DNA of MDV, 6 is amplification product of double PCR of genomic DNA of ILTV, 7 is amplification product of double PCR of genomic cDNA of NDV, 8 is amplification product of double PCR of cDNA of AIV-H9, 9 is amplification product of double PCR of genomic DNA of ALV-J, and 10 is amplification product of double PCR of cDNA of IBV.
FIG. 4 is an electrophoretogram corresponding to the sensitivity test in example 4, in which: m corresponds to 100bp DNA Marker, N corresponds to the amplification product of the double PCR of the negative control, and the lanes 1-8 correspond to the amplification product of the double PCR when the reaction systems 1-8 are adopted in sequence.
FIG. 5 is an electrophoretogram corresponding to the detection of clinical samples in example 5, in which: m corresponds to 100bp DNA Marker, N corresponds to the amplification product of the double PCR of the negative control, P corresponds to the amplification product of the double PCR of the positive control, and lanes 1-21 sequentially correspond to the detection results of 21 parts in 50 parts of chicken morbid material.
Detailed Description
The invention is further illustrated by the following examples. Wherein, the experimental methods in the examples are conventional methods unless otherwise specified; the test materials used, unless otherwise specified, were purchased from conventional biochemical stores. In the quantitative tests in the examples, three repeated experiments are set, and the results are averaged. Wherein, Avian Nephritis Virus (ANV), Chicken Infectious Anemia Virus (CIAV), avian adenovirus type 4 (FadV-4), chicken parvovirus (ChPV), chicken Newcastle Disease Virus (NDV), Marek's virus (MDV), H9 subtype avian influenza virus (AIV-H9), Infectious Bronchitis Virus (IBV), J subtype avian leukemia (ALV-J), infectious laryngotracheitis virus (ILTV) materials are retained by the applicant, and the public can be obtained from autonomous research institute of Zhuang nationality of Guangxi.
Example 1 primer design
Through a large amount of sequence analysis and comparison, a plurality of primers for identifying the avian nephritis viruses and a plurality of primers for identifying the chicken infectious anemia viruses are obtained. And performing a preliminary experiment on each primer, comparing the performances of sensitivity, specificity and the like, and finally obtaining a primer pair I and a primer pair II for identifying the avian nephritis virus and the chicken infectious anemia virus, wherein the primer combination consists of the primer pair I and the primer pair II.
ANV-F(SEQ.ID.NO.1)：GACTGGATAAGCGTGTTAGGA；
ANV-R(SEQ.ID.NO.2)：TATCATCTCCGTAGCAAAGAA；
CIAV-F(SEQ.ID.NO.3)：ACCACTACTCCCAGCCGACCC；
CIAV-R(SEQ.ID.NO.4)：CGTACCGGGGCGGGGGTTGTG。
Example 2 double PCR reaction Condition optimization
Firstly, preparation of template
1. And extracting the genomic DNA of the avian nephritis virus to obtain a sample A.
2. And extracting DNA of the chicken infectious anemia virus to obtain a sample B.
3. And mixing the sample A and the sample B to obtain a mixed sample.
Second, optimization of primer concentration
taking the mixed sample obtained in the first step as a template, and carrying out double PCR using the primer combination prepared in example 1. mu.L of a reaction system (25.0. mu.L) containing 12.5. mu.L of the 2 XPCR Mix, 2.0. mu.L of the mixed sample obtained in the first step (1.0 ng of the genomic cDNA of the avian nephritis virus and 1.0ng of the DNA of the avian infectious anemia virus in the 2.0. mu.L mixed sample), the primer pair I and the primer pair II, and finally using ddH2Make up to 25.0. mu.L of O. According to the concentration of the primer pair in the reaction system, different reaction systems are designed, and the specific details are as shown in table 1:
TABLE 1 primer concentration optimization reaction System
Reaction procedure for duplex PCR: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 95 ℃ for 1min, 60.0 ℃ for 1min, and 72 ℃ for 1 min; extension at 72 ℃ for 10 min.
The amplification products of the duplex PCR were subjected to 1.5% agarose gel electrophoresis and photographed.
Setting a negative control for replacing the mixed sample with equal volume of water; in the reaction system corresponding to the negative control, the concentration of ANV-F and ANV-R was 0.5 pmol/. mu.L, and the concentration of CIAV-F and CIAV-R was 0.5 pmol/. mu.L.
As shown in FIG. 1, the optimal primer concentration combination considering the amplification effect of primer pair I and primer pair II is: the concentrations of ANV-F and ANV-R were 0.5 pmol/. mu.L, and the concentrations of CIAV-F and CIAV-R were 0.5 pmol/. mu.L, respectively.
Thirdly, optimization of annealing temperature
taking the mixed sample obtained in the first step as a template, and carrying out double PCR using the primer combination prepared in example 1. the reaction system (25.0. mu.L) for double PCR, which contained 2 XPCR Mix 12.5. mu.L, 2.0. mu.L of the mixed sample obtained in the first step (in the 2.0. mu.L mixed sample, the content of the genomic cDNA of avian nephritis Virus was 0.64ng, and the content of the DNA of infectious anemia Virus of Chicken was 0.48ng), primer pair I and primer pair II, and finally ddH was used2Make up to 25.0. mu.L of O. In the reaction system of the duplex PCR, the concentrations of ANV-F and ANV-R were 0.5 pmol/. mu.L, and the concentrations of CIAV-F and CIAV-R were 0.5 pmol/. mu.L, respectively.
Reaction procedure for duplex PCR: pre-denaturation at 95 ℃ for 5 min; annealing at 95 deg.C for 1min, annealing at 60.0 deg.C for 1min, and annealing at 72 deg.C for 1min for 35 cycles; extension at 72 ℃ for 10 min. The following annealing temperatures were set, respectively:
annealing temperature I: 50.0 ℃; and (3) annealing temperature II: 50.7 ℃; annealing temperature III: 51.9 ℃;
and (4) annealing temperature IV: 53.8 ℃; annealing temperature V: 56.1 ℃; annealing temperature VI: 58.0 ℃;
annealing temperature VII: 59.2 ℃; annealing temperature viii: 60.0 ℃.
The amplification products of the duplex PCR were subjected to 1.5% agarose gel electrophoresis and photographed.
A negative control with an equal volume of water instead of the mixed sample was set, with a corresponding annealing temperature of 60.0 ℃.
As a result, as shown in FIG. 2, the optimal annealing temperature was 60.0 ℃ in consideration of the amplification effect of the primer set I and the primer set II.
And integrating the second step and the third step to obtain the following conclusion: in the double PCR reaction system, the preferable concentration of ANV-F and ANV-R is 0.5 pmol/mu L, and the preferable concentration of CIAV-F and CIAV-R is 0.5 pmol/mu L; the preferred reaction procedure for duplex PCR is: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 95 ℃ for 1min, 60.0 ℃ for 1min, and 72 ℃ for 1 min; extension at 72 ℃ for 10 min.
Example 3 specificity
1. And extracting the genome DNA of the sample to be detected. The samples to be tested are respectively as follows: chicken Infectious Anemia Virus (CIAV), avian adenovirus type 4 (FadV-4), chicken parvovirus (ChPV), marek's virus (MDV), subtype J avian leukemia virus (ALV-J), infectious laryngotracheitis virus (ILTV).
2. Extracting total RNA of a sample to be detected, and performing reverse transcription to obtain cDNA. The samples to be tested are respectively as follows: avian Nephritis Virus (ANV), Newcastle Disease Virus (NDV), H9 subtype avian influenza virus (AIV-H9), Infectious Bronchitis Virus (IBV).
3. The genomic DNA samples obtained in step 1, the cDNA samples obtained in step 2, and the mixed sample obtained in step one of example 2 were used as templates, and the primer combinations prepared in example 1 were used to perform duplex PCR.
the double PCR reaction system (25.0. mu.L) contained 2 XPCR Mix 12.5. mu.L, template 2.0. mu.L, primer set I and primer set II, and finally ddH2Make up to 25.0. mu.L of O. In the reaction system of the duplex PCR, the concentrations of ANV-F and ANV-R were 0.5 pmol/. mu.L, and the concentrations of CIAV-F and CIAV-R were 0.5 pmol/. mu.L, respectively. A negative control was set up with an equal volume of water instead of the mixed sample.
When the template is each genomic DNA sample obtained in step 1, the DNA content in 2.0. mu.L of the template is 0.64 ng;
when the template is each cDNA sample obtained in the step 2, the cDNA content in 2.0 mu L of the template is 0.48 ng;
when the template was the mixed sample obtained in the first step of example 2, the amount of avian nephritis virus genomic cDNA in 2.0. mu.L of the template was 0.64ng, and the amount of chicken anemia virus DNA was 0.48 ng.
Reaction procedure for duplex PCR: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 95 ℃ for 1min, 60.0 ℃ for 1min, and 72 ℃ for 1 min; extension at 72 ℃ for 10 min.
The amplification products of the duplex PCR were subjected to 1.5% agarose gel electrophoresis and photographed.
The results are shown in FIG. 3, and show that ANV amplified a specific band of 405bp (SEQ. ID. NO.5), CIAV amplified a specific band of 220bp (SEQ. ID. NO.6), and that none of FadV-4, ChPV, MDV, ILTV, NDV, AIV-H9, ALV-J and IBV appeared.
Example 4 sensitivity
Firstly, preparing a template
1. Genomic cDNA of the avian nephritis virus was extracted to obtain a DNA solution with a DNA concentration of 100.0 ng/. mu.L.
2. The genomic DNA of the chicken infectious anemia virus was extracted to obtain a DNA solution having a DNA concentration of 100.0 ng/. mu.L.
3. Mixing the cDNA solution obtained in the step 1 and the DNA solution obtained in the step 2.
4. By ddH2And (4) diluting the mixed solution obtained in the step (3) by an O10-fold gradient to obtain each diluted solution.
Second, detection of sensitivity
The dilution obtained in step one was used as a template for duplex PCR using the primer combination prepared in example 1.
the reaction system (25.0. mu.L) for the duplex PCR contained 2 XPCR Mix 12.5. mu.L, the dilution obtained in step one, 1. mu.L, primer pair I and primer pair II, and finally ddH2Make up to 25.0. mu.L of O. In the reaction system of the duplex PCR, the concentrations of ANV-F and ANV-R were 0.5 pmol/. mu.L, and the concentrations of CIAV-F and CIAV-R were 0.5 pmol/. mu.L, respectively. A negative control was set up with an equal volume of water instead of the mixed sample. Due to the different dilutions of the dilutions used, different reaction systems as in table 2 were formed.
TABLE 2 sensitive detection reaction System
Reaction procedure for duplex PCR: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 95 ℃ for 1min, 60.0 ℃ for 1min, and 72 ℃ for 1 min; extension at 72 ℃ for 10 min.
Products of the duplex PCR were subjected to 1.5% agarose gel electrophoresis and photographed.
The results are shown in FIG. 4, and show that at the lowest, 64fg ANV and 0.48pg CIAV were detected simultaneously.
Example 5 clinical sample testing
Collecting 50 parts of chicken diseased material (oral cavity + cloaca double-cotton swab) in 10-2020 in 2019, and identifying according to the following steps:
1. collecting pathological material, extracting total RNA/DNA, and reverse transcribing RNA into cDNA.
2. The genomic DNAs (DNA content: Xng) obtained in step 1 were mixed (DNA content: Xng) to obtain a mixed sample.
3. The mixed sample obtained in step 2 was used as a template, and the primer combination prepared in example 1 was used to perform duplex PCR.
the reaction system (25.0. mu.L) for the duplex PCR contained 2 XPCR Mix 12.5. mu.L, template 2.0. mu.L (DNA content 0.5-2ng), primer set I and primer set II, and finally ddH2Make up to 25.0. mu.L of O. In the reaction system of the duplex PCR, the concentrations of ANV-F and ANV-R were 0.5 pmol/. mu.L, and the concentrations of CIAV-F and CIAV-R were 0.5 pmol/. mu.L, respectively. A negative control was set up with an equal volume of water instead of the mixed sample. The positive control of the pooled sample obtained in step 2 was replaced with an equal volume of the pooled sample obtained in step 1 of example.
Reaction procedure for duplex PCR: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 95 ℃ for 1min, 60.0 ℃ for 1min, and 72 ℃ for 1 min; extension at 72 ℃ for 10 min.
Products of the duplex PCR were subjected to 1.5% agarose gel electrophoresis and photographed.
Part of the detection results are shown in FIG. 5, wherein M corresponds to a 100bp DNA Marker, N corresponds to a double PCR amplification product of a negative control, P corresponds to a double PCR amplification product of a positive control, and in the detection results of the disease material of 1-21 chickens, a lane 7 is an ANV + CIAV positive result; lanes 5, 9 and 17 show positive results for ANV; lanes 3, 4, 6, 11, 12, 14, 16, 19 and 21 show positive results for CIAV. According to the statistical result, 4 parts of ANV + CIAV mixed infection is detected out of 50 parts of chicken diseased material, 6 parts of ANV positive is detected out, and 25 parts of CIAV positive is detected out.
And the detection is repeated for three times, and the results are consistent.
Specific bands in lanes showing positive results for ANV and CIAV were recovered and sequenced, with sequencing results up to 92% -100% homologous to sequence 5 and sequence 6.
The results of identifying the 50 samples by adopting the traditional virus isolation culture method are completely consistent with the results of the method established by the invention.
Sequence listing
<110> Guangxi Zhuang nationality autonomous region veterinary research institute
<120> primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gactggataa gcgtgttagg a 21
<210>2
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tatcatctcc gtagcaaaga a 21
<210>3
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
accactactc ccagccgacc c 21
<210>4
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cgtaccgggg cgggggttgt g 21
<210>5
<211>405
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
gactggataa gcgtgttagg agaatcacgt cctgtggcag gacccaagtc ttagaacttg 60
attggacgcg gttcgacggt accattccag ttcagctttt ccaaagagtg cgtgctatgc 120
gcaaattctt cctcactagg cgttcgcgaa agaggtatgg gaaattgcta gactggtaca 180
atgcccagtt aactgatagg attaccctcc taacaacagg agaggtcact catgtcaaga 240
aagttaatcc atctggacaa ttttcaacaa ctgttgataa caatattgtc aatgagtggt 300
tgactgcctt tgagtttgct taccaacatt tggaaaacca tggcatgatt ccaacagaca 360
aagactaggg ggcaaatgtt gactttcttt gctacggaga tgata 405
<210>6
<211>220
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
accactactc ccagccgacc ccgaaccgca agaaggtgta taagactgta agatggcaag 60
acgagctcgc agaccgagag gccgatttta cgccttcaga agaggacggt ggcaccacct 120
caagcgactt cgacgaagat ataaatttcg acatcggagg agacagcggt atcgtagacg 180
agcttttagg aaggcctttc acaacccccg ccccggtacg 220
Claims (10)
1. The primer group for identifying the avian nephritis viruses and the chicken infectious anemia viruses is characterized by comprising a primer pair I and a primer pair II, wherein the primer pair I consists of primers ANV-F and ANV-R, and the primer pair II consists of primers CIAV-F and CIAV-R; the primers ANV-F, ANV-R, CIAV-F and CIAV-R have base sequences of sequence tables SEQ.ID.NO.1 to SEQ.ID.NO.4 respectively.
2. The primer set for identifying avian nephritis viruses and chicken infectious anemia viruses according to claim 1, wherein: the molar ratio of the primers ANV-F, ANV-R, CIAV-F to CIAV-R is 1:1:1: 1.
3. Use of a primer set according to claim 1 for PCR amplification, wherein the annealing temperature is 60.0 ℃.
4. The use according to claim 3, wherein the reaction system and the reaction procedure of the PCR amplification are respectively: reaction procedure: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 95 ℃ for 1min, 60.0 ℃ for 1min, and 72 ℃ for 1 min; extending for 10min at 72 ℃;
the reaction system comprises 2 XPCR Mix 12.5 uL, wherein each ANV-F, ANV-R is 1 uL, each CIAV-F, CIAV-R is 1 uL, the template is 2.0 uL, ddH2O is complemented to 25.0 mu L; the concentrations of the primers are respectively as follows: 0.5 pmol/. mu.L ANV-F, 0.5 pmol/. mu.L ANV-R, 0.5 pmol/. mu.L CIAV-F, 0.5 pmol/. mu.L CIAV-R.
5. The use according to claim 4, wherein said template is derived from viral DNA, viral cDNA in a sample to be tested.
6. The use of claim 5, wherein the sample to be tested is a chicken feed.
7. Use of the primer set of claim 1 for preparing a kit for identifying avian nephritis viruses and chicken infectious anemia viruses.
8. The kit for identifying the avian nephritis virus and the chicken infectious anemia virus is characterized by comprising a primer group for detection; the primer group comprises a primer pair I and a primer pair II, wherein the primer pair I consists of primers ANV-F and ANV-R, and the primer pair II consists of primers CIAV-F and CIAV-R; the primers ANV-F, ANV-R, CIAV-F and CIAV-R have base sequences of sequence tables SEQ.ID.NO.1 to SEQ.ID.NO.4 respectively.
9. The kit for identifying avian nephritis viruses and chicken infectious anemia viruses according to claim 8, wherein: the primers ANV-F, ANV-R, CIAV-F and CIAV-R are packaged separately.
10. The kit for identifying avian nephritis viruses and chicken infectious anemia viruses according to claim 4, wherein: the molar ratio of the primers ANV-F, ANV-R, CIAV-F to CIAV-R is 1:1:1: 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010707560.6A CN111733292A (en) | 2020-07-21 | 2020-07-21 | Primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010707560.6A CN111733292A (en) | 2020-07-21 | 2020-07-21 | Primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111733292A true CN111733292A (en) | 2020-10-02 |
Family
ID=72656100
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010707560.6A Pending CN111733292A (en) | 2020-07-21 | 2020-07-21 | Primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111733292A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2481403C1 (en) * | 2011-11-07 | 2013-05-10 | Государственное научное учреждение Институт экспериментальной ветеринарии Сибири и Дальнего Востока Российской академии сельскохозяйственных наук (ГНУ ИЭВСиДВ Россельхозакадемии) | Synthetic oligonucleotide primers and method to detect dna of virus of infectious anaemia of chickens with synthetic oligonucleotide primers in polymerase chain reaction in real-time mode |
| CN110241263A (en) * | 2019-07-02 | 2019-09-17 | 广西壮族自治区兽医研究所 | Identify the primer sets and its application of chicken parvovirus and fowl ephritis virus |
| CN110564896A (en) * | 2019-09-26 | 2019-12-13 | 广西壮族自治区兽医研究所 | Primer group for identifying avian adenovirus type 4 and chicken infectious anemia viruses and application thereof |
| CN110628943A (en) * | 2019-08-07 | 2019-12-31 | 山东省农业科学院家禽研究所 | Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit |
| CN110684866A (en) * | 2019-10-11 | 2020-01-14 | 佛山科学技术学院 | Primer pair, kit and method for detecting chicken infectious anemia virus |
-
2020
- 2020-07-21 CN CN202010707560.6A patent/CN111733292A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2481403C1 (en) * | 2011-11-07 | 2013-05-10 | Государственное научное учреждение Институт экспериментальной ветеринарии Сибири и Дальнего Востока Российской академии сельскохозяйственных наук (ГНУ ИЭВСиДВ Россельхозакадемии) | Synthetic oligonucleotide primers and method to detect dna of virus of infectious anaemia of chickens with synthetic oligonucleotide primers in polymerase chain reaction in real-time mode |
| CN110241263A (en) * | 2019-07-02 | 2019-09-17 | 广西壮族自治区兽医研究所 | Identify the primer sets and its application of chicken parvovirus and fowl ephritis virus |
| CN110628943A (en) * | 2019-08-07 | 2019-12-31 | 山东省农业科学院家禽研究所 | Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit |
| CN110564896A (en) * | 2019-09-26 | 2019-12-13 | 广西壮族自治区兽医研究所 | Primer group for identifying avian adenovirus type 4 and chicken infectious anemia viruses and application thereof |
| CN110684866A (en) * | 2019-10-11 | 2020-01-14 | 佛山科学技术学院 | Primer pair, kit and method for detecting chicken infectious anemia virus |
Non-Patent Citations (1)
| Title |
|---|
| 杨丽聪等: "鸡传染性贫血病毒SYBR GreenⅠ实时荧光定量PCR检测方法的建立" * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110628943B (en) | Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit | |
| CN107236825B (en) | Nucleic acid and method for rapidly detecting and distinguishing PRV (porcine reproductive and respiratory syndrome) wild virus and vaccine virus by real-time RPA (RPA) | |
| CN112094953A (en) | Kit, primer and probe for simultaneously detecting bovine viral diarrhea virus, bovine rotavirus and bovine coronavirus | |
| CN111926116A (en) | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof | |
| CN110564896A (en) | Primer group for identifying avian adenovirus type 4 and chicken infectious anemia viruses and application thereof | |
| CN106947834B (en) | Multiplex PCR method for detecting six duck susceptibility viruses | |
| CN108048600B (en) | Fluorescent quantitative PCR detection method for infectious bovine rhinotracheitis virus | |
| CN107904326B (en) | Nucleic acid for RT-PCR rapid typing detection of avian metapneumovirus subtype and application | |
| CN108998575B (en) | Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus | |
| CN116479174A (en) | Dual TB Green real-time fluorescent quantitative PCR (polymerase chain reaction) universal primer group for identifying avian adenovirus DAdV-3 and FAdV-4 and kit thereof | |
| CN114634996B (en) | Primer probe combination and kit for detecting bovine respiratory disease and application of primer probe combination and kit | |
| CN107326103B (en) | Triple RT-PCR specific amplification primer group and triple-identification RT-PCR detection method | |
| CN111719020B (en) | Kit, primer and probe for detecting bovine rotavirus | |
| CN110592281A (en) | Primer group for identifying chicken parvovirus and chicken infectious anemia virus and application thereof | |
| CN111733292A (en) | Primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof | |
| Yu et al. | TaqMan-probe-based multiplex real-time RT-qPCR for simultaneous detection of GoAstV, GPV, and GoCV | |
| CN113337643A (en) | RT-LAMP primer group and kit for detecting bluetongue virus, animal epidemic hemorrhagic disease virus and paliyama virus | |
| CN110257560B (en) | Reagent for bluetongue virus type 8 detection, detection method and application | |
| CN108384889B (en) | Multiple RT-PCR kit for genotyping and identifying bluetongue virus and detection method thereof | |
| Ji et al. | Simple and visible detection of novel astroviruses causing fatal gout in goslings using one-step reverse transcription polymerase spiral reaction method | |
| CN113322350B (en) | Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application | |
| CN115852043B (en) | Multiplex fluorescence PCR primer probe set for detecting four cat diarrhea related viruses, kit and application | |
| CN112575122B (en) | Dual PCR primer set for rapidly detecting duck type 2 adenovirus and duck circovirus, and detection method and application thereof | |
| CN114480737B (en) | FAdV-4 NP strain specific primer and application thereof in recombinase-mediated isothermal nucleic acid amplification detection | |
| CN114592088B (en) | Multiplex PCR (polymerase chain reaction) kit for detecting or distinguishing 4 different genotypes of avian reovirus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |