CN110628943B - Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit - Google Patents
Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit Download PDFInfo
- Publication number
- CN110628943B CN110628943B CN201910726472.8A CN201910726472A CN110628943B CN 110628943 B CN110628943 B CN 110628943B CN 201910726472 A CN201910726472 A CN 201910726472A CN 110628943 B CN110628943 B CN 110628943B
- Authority
- CN
- China
- Prior art keywords
- chicken
- circovirus
- ciav
- gyv3
- novel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific primer for identifying a novel chicken circovirus and a novel chicken infectious anemia virus, which comprises a detection primer GyV3-1/GyV3-2 for detecting the novel chicken circovirus and a detection primer CIAV-5/CIAV-6 for detecting the novel chicken infectious anemia virus; the nucleotide sequence is shown in SEQ ID NO. 1-4. A novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit comprises the specific primers and positive plasmids. A method for identifying novel chicken circovirus and chicken infectious anemia virus comprises the following steps: extracting the genome DNA of the sample to be detected, amplifying by using the specific primer, carrying out electrophoresis on the amplified product and observing whether an amplified band exists or not, thereby judging. The invention has the advantages of low minimum detection amount of DNA of two viruses below 100 copies, no detection of other common chicken-derived viruses, high sensitivity, good specificity and the like.
Description
Technical Field
The invention relates to a novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit and application thereof, belonging to the technical field of biological detection.
Background
Infectious proventriculitis (TVP) of chicken is an infectious disease caused by pathogen and causing glandular stomach lesion, and takes feces passing, poor growth and extreme emaciation as main clinical symptoms, and takes glandular stomach swelling such as globus, glandular stomach wall thickening, glandular stomach mucous membrane bleeding or ulcer as main anatomical lesion. The disease is a common disease in the production of broiler chickens in China, seriously affects the production performance of the broiler chickens and causes great economic loss to the chicken raising industry in China every year.
The chicken new circovirus (Gyrovirus 3, GyV3) is a pathogen which is newly found in recent years and can cause chicken proventriculitis; besides causing Chicken aplastic Anemia, Chicken Infectious Anemia Virus (CIAV) is also one of the etiological agents of Chicken proventriculitis. The two viruses are very similar in gene structure, are single-stranded circular DNA viruses, are only two circular viruses which are known to cause chicken diseases at present, and are all pathogenic agents of the infectious proventriculitis of the chicken, so that a method for quickly identifying the two pathogenic agents is urgently needed in production so as to improve the pertinence of disease treatment.
Disclosure of Invention
Aiming at the prior art, the invention provides a novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit to rapidly identify two pathogens which can cause chicken proventriculitis.
The invention is realized by the following technical scheme:
specific primers for identifying novel chicken circovirus and chicken infectious anemia virus comprise detection primers GyV3-1/GyV3-2 for detecting the novel chicken circovirus and detection primers CIAV-5/CIAV-6 for detecting the chicken infectious anemia virus; the nucleotide sequences of the detection primers GyV3-1/GyV3-2 are shown as follows, and are shown as SEQ ID NO.1 and SEQ ID NO.2, and the size of the amplified fragment is 337 bp;
GyV3-1：5'-CTGGTCGTGCGTGGAAA-3'(SEQ ID NO.1)；
GyV3-2：5'-GGTATGAATACGAGCCCTTG-3'(SEQ ID NO.2)。
the nucleotide sequence of the detection primer CIAV-5/CIAV-6 is shown as follows, as shown in SEQ ID NO.3 and SEQ ID NO.4, and the amplified fragment size is 665 bp;
CIAV-5：5'-CGCTGGAATTACAATCACTC-3'(SEQ ID NO.3)；
CIAV-6：5'-GTCCGCAATCAACTCACC-3'(SEQ ID NO.4)。
the primer is applied to the preparation of a novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit.
A kit for differential diagnosis of chicken novel circovirus and chicken infectious anemia virus comprises the specific primer for differential diagnosis of chicken novel circovirus and chicken infectious anemia virus, positive plasmids and reagents necessary for PCR reaction; the positive plasmids are recombinant plasmids T-GyV3 and T-CIAV.
Further, the kit comprises the following components in 100 times of dosage: 4800. mu.L of PCR reaction solution, 200. mu.L of positive plasmid; the PCR reaction solution contains the specific primer for identifying the novel chicken circovirus and the chicken infectious anemia virus; the positive plasmid is a mixture of recombinant plasmids T-GyV3 and T-CIAV with the final concentration of 0.1 ng/. mu.L.
Further, the PCR reaction solution system consists of the following components:
the recombinant plasmid T-GyV3 or T-CIAV can be prepared by the following method: GyV3 or CIAV DNA is extracted, a target strip is subjected to PCR amplification by using a primer GyV3-1/GyV3-2 or CIAV-5/CIAV-6, the target strip is recovered and is connected with a vector pMD18-T, the target strip is transformed into DH5 alpha competent cells, a plasmid is extracted, and sequencing is carried out after positive PCR identification; the plasmid with the correct sequence is marked as T-GyV3 or T-CIAV and is used as a positive control for GyV3 and CIAV detection respectively.
The GyV3 or CIAV positive PCR amplification reaction system (50 μ L) consists of the following components: ddH 2 O38.5. mu.L, 10 XPCR buffer 5. mu.L, 2.5mM dNTP 3. mu.L, 5U/. mu.L Taq DNA polymerase 0.5. mu.L, 20 pmol/. mu.L upstream and downstream primers 0.5. mu.L each, and sample nucleic acid 2. mu.L.
The GyV3 or CIAV positive PCR amplification reaction program comprises the following steps: pre-denaturation at 95 ℃ for 5 min; 30 cycles of denaturation at 94 ℃ for 20sec, annealing at 53 ℃ for 20sec, and elongation at 72 ℃ for 40 sec; extension at 72 ℃ for 5 min.
The kit for differential diagnosis of the novel chicken circovirus and chicken infectious anemia virus is applied to differential diagnosis of the novel chicken circovirus and the chicken infectious anemia virus.
A method for identifying novel chicken circovirus and chicken infectious anemia virus comprises the following steps:
(1) extracting nucleic acid of a sample: taking 200 mu L of a sample to be detected, and extracting sample nucleic acid by using a virus nucleic acid extraction kit for later use;
(2) and (3) PCR reaction: carrying out PCR amplification on a sample to be detected by using the primers GyV3-1/GyV3-2 and CIAV-5/CIAV-6;
further, the reaction conditions of the PCR are as follows: taking 48 mu L of PCR reaction solution, adding 2 mu L of sample nucleic acid of a sample to be detected, mixing uniformly, and reacting according to the following procedures: pre-denaturation at 95 ℃ for 5 min; 30 cycles of denaturation at 94 ℃ for 20sec, annealing at 53 ℃ for 20sec, and elongation at 72 ℃ for 40 sec; extending for 5min at 72 ℃;
(3) positive control: carrying out PCR amplification on the positive plasmid by using primers GyV3-1/GyV3-2 and CIAV-5/CIAV-6;
further, the reaction conditions of the PCR are as follows: adding positive plasmid 2 μ L into PCR reaction solution 48 μ L, mixing, and reacting according to the following procedure: pre-denaturation at 95 ℃ for 5 min; 30 cycles of denaturation at 94 ℃ for 20sec, annealing at 53 ℃ for 20sec, and elongation at 72 ℃ for 40 sec; extending for 5min at 72 ℃;
(4) negative control: by ddH 2 O as a negative control;
further, the reaction conditions of the negative control were: taking 48 mu L of PCR reaction solution, adding ddH 2 O2. mu.L, mixed and reacted according to the following procedure: pre-denaturation at 95 ℃ for 5 min; 30 cycles of denaturation at 94 ℃ for 20sec, annealing at 53 ℃ for 20sec, and elongation at 72 ℃ for 40 sec; extending for 5min at 72 ℃;
(5) and (3) electrophoretic observation: taking the PCR product, the positive control product and the negative control product of the sample, carrying out agarose gel electrophoresis, and observing: under the condition that negative and positive control is established, if a single band with the size of 337bp appears, the chicken novel ring virus can be judged to be positive; if a single band with the size of 665bp appears, the chicken infectious anemia virus is judged to be positive; if bands with the sizes of 337bp and 665bp appear at the same time, judging that the two are infected in a mixed way; if the bands with the sizes of 337bp and 665bp are not present, the chicken is judged to be negative for the chicken novel circovirus and negative for the chicken infectious anemia virus.
The invention compares all gene sequences of the novel chicken circovirus and the infectious chicken anemia virus which are registered in GenBank with the gene sequence of the isolated strain in the laboratory, respectively designs 5 pairs of primers according to conserved regions, utilizes positive viruses to compare and screen the primers in various aspects of sensitivity, specificity, use concentration, matching use ratio and the like through a large number of tests, and finally screens the two pairs of specific primers which have good specificity and sensitivity and do not influence each other, can quickly identify two pathogenies of the novel chicken circovirus and the infectious chicken anemia virus which cause infectious chicken proventriculitis in the same system, is clinically reported for the first time, has the advantages of time saving, labor saving, low cost and the like, and has important application value.
The kit for differential diagnosis of the chicken novel circovirus and the chicken infectious anemia virus has the advantages of high sensitivity, good specificity and the like, the minimum detection amount of DNA of the two viruses is lower than 100 copies, and the DNA of the two viruses cannot be detected by other common chicken-derived viruses.
The various terms and phrases used herein have the ordinary meaning as is well known to those skilled in the art. To the extent that the terms and phrases are not inconsistent with known meanings, the present invention will be described in connection with the specific meaning of the term.
Drawings
FIG. 1: the kit of the invention has a specific detection result; wherein M is DNA Marker DL2000, and the viruses corresponding to 1-14 are respectively chicken infectious anemia virus, novel chicken circovirus and chicken infectious anemia virus mixture, H9 subtype avian influenza virus, Newcastle disease virus, infectious bronchitis virus, infectious laryngotracheitis virus, infectious bursal disease virus, avian adenovirus serotype 4, egg drop syndrome virus, chicken reovirus, avian leukemia virus, reticuloendotheliosis virus and negative control.
FIG. 2: the kit disclosed by the invention has a sensitivity detection result on the novel chicken circovirus; wherein M is DNA MarkThe copy numbers of the positive plasmids (T-GyV3) corresponding to erDL2000, 1-6 were 9.5X 10 4 、9.5×10 3 、9.5×10 2 、9.5×10 1 、9.5、0.95。
FIG. 3: the kit disclosed by the invention has a sensitivity detection result on the chicken infectious anemia virus; wherein, M is DNA MarkerDL2000, the copy number of the positive plasmid (T-CIAV) corresponding to 1-6 is 6.0 multiplied by 10 respectively 4 、6.0×10 3 、6.0×10 2 、6.0×10 1 、6、0.6。
FIG. 4: the kit provided by the invention has a repeatability test result on the novel chicken circovirus; wherein, M is DNA MarkerDL2000, and 1-3 corresponds to three times of repeated detection results.
FIG. 5: the kit provided by the invention has a repeatability test result on the chicken infectious anemia virus; wherein, M is DNA MarkerDL2000, and 1-3 corresponds to three times of repeated detection results.
Detailed Description
The present invention will be further described with reference to the following examples. However, the scope of the present invention is not limited to the following examples. It will be understood by those skilled in the art that various changes and modifications may be made to the invention without departing from the spirit and scope of the invention.
The present invention has been described generally and/or specifically with respect to materials used in testing and testing methods. Although many materials and methods of operation are known in the art for the purpose of carrying out the invention, the invention is nevertheless described herein in as detail as possible.
The instruments, reagents, materials and the like used in the following examples are conventional instruments, reagents, materials and the like in the prior art and are commercially available in a normal manner unless otherwise specified. Unless otherwise specified, the experimental methods, detection methods, and the like described in the following examples are conventional experimental methods, detection methods, and the like in the prior art.
Example 1 design of detection primers
By comparing all gene sequences of the registered chicken novel circovirus and chicken infectious anemia virus in GenBank with gene sequences of isolated strains in the laboratory, 5 pairs of primers are designed according to conserved regions.
The 5 pairs of primer sequences for detecting the novel chicken circovirus are as follows:
GyV3-1 (upstream primer): 5'-CTGGTCGTGCGTGGAAA-3';
GyV3-2 (downstream primer): 5'-GGTATGAATACGAGCCCTTG-3';
the amplified fragment size was 337 bp.
GyV3-3 (upstream primer): 5'CAATATCGGGACAACCACC 3';
GyV3-4 (downstream primer): 5'TGGGTATGTTGAGCGTGAA 3's;
the amplified fragment size is 230 bp.
GyV3-5 (upstream primer): 5'CAGACTGCGACGAAGACG 3';
GyV3-6 (downstream primer): 5'TGTGGGTTGTGGCTATGC 3's;
the amplified fragment size is 374 bp.
GyV3-7 (upstream primer): 5'TGGTCGTGCGTGGAAAC 3';
GyV3-8 (downstream primer): 5'GGTATGAATACGAGCCCTTG 3';
the amplified fragment was 336bp in size.
GyV3-9 (upstream primer): 5'GCCACTAGACGCAAGGTC 3';
GyV3-10 (downstream primer): 5'TTGGTGGTTGTCCCGATA 3's;
the amplified fragment size is 413 bp.
The 5 pairs of primer sequences for detecting the chicken infectious anemia virus are as follows:
CIAV-1 (upstream primer): 5'GAGGAGACAGCGGTATCGTA 3';
CIAV-2 (downstream primer): 5'TCTGGTGATCGCTGCTGTA 3';
the amplified fragment has a size of 638 bp.
CIAV-3 (upstream primer): 5'CTCGAAGAAGCGATCCTG 3';
CIAV-4 (downstream primer): 5'GTCCGCAATCAACTCACC 3's;
the amplified fragment is 524bp in size.
CIAV-5 (upstream primer): 5'CGCTGGAATTACAATCACTC 3's;
CIAV-6 (downstream primer): 5'GTCCGCAATCAACTCACC 3's;
the amplified fragment size is 665 bp.
CIAV-7 (upstream primer): 5'CGACATCGGAGGAGACAG 3';
CIAV-8 (downstream primer): 5'ATTCTTAGTGGCAAGGAGCT 3';
the amplified fragment size was 555 bp.
CIAV-9 (upstream primer): 5'ATTCCGAGTGGTTACTATTCC 3';
CIAV-10 (downstream primer): 5'CGTGAACTTGTTGSTGGC 3's;
the amplified fragment is 530bp in size.
Through many experiments, the primers are compared and screened in many aspects such as sensitivity, specificity, use concentration, matching use ratio and the like, and finally 1 pair of optimal primers (the experiment results are very large) are screened respectively and used for detecting the novel chicken circovirus and the chicken infectious anemia virus, and the method comprises the following steps:
the primer for detecting the novel chicken circovirus is recorded as GyV3-1/GyV3-2, the size of the amplified fragment is 337bp, and the sequence structure is shown as follows:
GyV3-1 (upstream primer): 5'-CTGGTCGTGCGTGGAAA-3';
GyV3-2 (downstream primer): 5'-GGTATGAATACGAGCCCTTG-3' are provided.
The primer for detecting the chicken infectious anemia virus is marked as CIAV-5/CIAV-6, the size of the amplified fragment is 665bp, and the sequence structure is shown as follows:
CIAV-5 (upstream primer): 5'-CGCTGGAATTACAATCACTC-3', respectively;
CIAV-6 (downstream primer): 5'-GTCCGCAATCAACTCACC-3' is added.
Although the primers of the invention are designed by software, the selection of the conserved regions is obtained by comparison of the inventors, and creative work is performed. And the principle of primer design is set by the inventors (such as primer length) based on the characteristics of the conserved region (such as base distribution ratio). After obtaining a plurality of groups of primers through design software, how specific and how sensitive the primers are, can not be predicted (design software does not consider the balance of specificity and sensitivity when designing primers), which can only be used as a reference to assist the inventor to preliminarily determine the approximate position of primer design, but in order to obtain primers with strong specificity and high sensitivity (the longer the length of the primer is, the higher the specificity is, but the lower the sensitivity is; the shorter the length of the primer is, the higher the sensitivity is, but the worse the specificity is; both aspects need to have a balance point), the inventor needs creative work, carries out a great deal of and complicated design, screening and verification work (the workload is extremely large), and selects primers with proper length to realize the unification of specificity and sensitivity. Therefore, the design software plays a role as an aid, and the inventors are required to take creative efforts to obtain mature primers and probes which can be practically used.
EXAMPLE 2 specificity of Dual PCR
Respectively extracting nucleic acids of chicken infectious anemia viruses, novel chicken circoviruses and chicken infectious anemia virus mixtures, H9 subtype avian influenza viruses, Newcastle diseases viruses, infectious bronchitis viruses, infectious laryngotracheitis viruses, infectious bursal diseases viruses, serum type 4 avian adenoviruses, egg drop syndrome viruses, chicken reoviruses, avian leukemia viruses and reticuloendotheliosis viruses according to the description of the virus nucleic acid extraction kit, and respectively carrying out the following PCR reaction by taking the nucleic acids as templates.
The reaction system (50. mu.L) included: ddH 2 O37.5. mu.L, 10 XPCR buffer 5. mu.L, 2.5mM dNTP 3. mu.L, 5U/. mu.L of DNA polymerase, 20 pmol/. mu.L of primer GyV 3-10.5. mu.L, 20 pmol/. mu.L of primer GyV 3-20.5. mu.L, 20 pmol/. mu.L of primer CIAV-50.5. mu.L, 20 pmol/. mu.L of primer CIAV-60.5. mu.L, and sample nucleic acid 2. mu.L.
The reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; 30 cycles of denaturation at 94 ℃ for 20sec, annealing at 53 ℃ for 20sec, and elongation at 72 ℃ for 40 sec; extension at 72 ℃ for 5 min.
After the reaction, 5. mu.L of the PCR product was applied to 1.5% agarose gel for electrophoresis and observed, the results are shown in FIG. 1. It can be seen that the differential diagnosis kit of the invention can amplify a single band with a size of 665bp from the chicken infectious anemia viruses, amplify a single band with a size of 337bp from the novel chicken circovirus, amplify two bands with sizes of 337bp and 665bp from the mixture of the novel chicken circovirus and the chicken infectious anemia viruses, and can not amplify any band from the H9 subtype avian influenza virus, Newcastle disease virus, infectious bronchitis virus, infectious laryngotracheitis virus, infectious bursal disease virus, serum type 4 avian adenovirus, egg drop syndrome virus, chicken reovirus, avian leukemia virus, reticuloendotheliosis virus and Marek's disease virus.
EXAMPLE 3 sensitivity of Dual PCR
The concentrations of the positive plasmids T-GyV3 and T-CIAV were measured by a spectrophotometer, and the plasmid copy number was calculated, followed by 10-fold dilution, and PCR amplification was performed using the above reaction system and conditions. After the reaction, 5. mu.L of each PCR product was added into 1.5% agarose gel for electrophoresis and observation, and the results are shown in FIGS. 2 and 3. Therefore, the minimum detection amount of the chicken novel circovirus DNA is 95 copies, and the minimum detection amount of the chicken infectious anemia virus DNA is 60 copies.
Example 4 reproducibility of double PCR
The PCR method is used for amplifying the positive pathological materials of the novel chicken circovirus and the infectious chicken anemia virus respectively, the amplification is repeated three times respectively, the repeatability is determined, and the results are shown in figures 4 and 5. As can be seen, three replicates of both viruses amplified the desired bands with substantially identical intensity.
Example 5 kit for identifying infection of novel chicken circovirus and infectious chicken anemia virus
The kit for identifying the infection of the novel chicken circovirus and the chicken infectious anemia virus comprises the following components by using a dosimeter for 100 times:
(1) 4800. mu.L of PCR reaction solution, which specifically included:
(2) positive plasmid: the final concentration of the recombinant plasmids T-GyV3 and T-CIAV mixture is 0.1 ng/mu L;
the detailed preparation method of the recombinant plasmids T-GyV3 and T-CIAV comprises the following steps:
GyV3 DNA and CIAV DNA are extracted according to a virus nucleic acid extraction kit, target bands are amplified by PCR respectively by using primers GyV3-1/GyV3-2 and CIAV-5/CIAV-6, and the reaction conditions are as follows:
the reaction system (50. mu.L) comprised the following components:
ddH 2 o38.5. mu.L, 10 XPCR buffer 5. mu.L, 2.5mM dNTP 3. mu.L, 5U/. mu.L Taq DNA polymerase 0.5. mu.L, 20 pmol/. mu.L upstream and downstream primers 0.5. mu.L, sample nucleic acid 2. mu.L.
The reaction procedure is as follows:
pre-denaturation at 95 ℃ for 5 min; 30 cycles of denaturation at 94 ℃ for 20sec, annealing at 53 ℃ for 20sec, and elongation at 72 ℃ for 40 sec; extension at 72 ℃ for 5 min.
After the reaction is finished, a target band is recovered and connected with a vector pMD18-T, the target band is transformed into DH5 alpha competent cells, plasmids are extracted, and sequencing is carried out after PCR identification is positive. Plasmids with correct sequences were labeled as T-GyV3 and T-CIAV and served as positive controls for GyV3 and CIAV, respectively.
The concentrations of recombinant plasmids T-GyV3 and T-CIAV were determined separately, both diluted to 0.2 ng/. mu.L, and mixed in equal amounts to a final concentration of 0.1 ng/. mu.L.
Example 6 specific procedures for identifying novel circovirus and infectious anemia virus infections in chickens Using the kit
The method for identifying the infection of the chicken novel circovirus and the chicken infectious anemia virus described in the embodiment is carried out by using the kit described in the embodiment 5, and the specific operation steps are as follows:
(1) extracting nucleic acid of a sample: taking 200 mu L of a sample to be detected, and extracting virus nucleic acid according to the instruction of the virus nucleic acid extraction kit for later use;
(2) and (3) PCR reaction: and (3) taking 48 mu L of the PCR reaction solution and 2 mu L of the sample nucleic acid, mixing uniformly, and carrying out PCR reaction according to the following procedures: pre-denaturation at 95 ℃ for 5 min; 30 cycles of denaturation at 94 ℃ for 20sec, annealing at 53 ℃ for 20sec, and elongation at 72 ℃ for 40 sec; extending for 5min at 72 ℃;
(3) positive control: adding 48 mu L of PCR reaction liquid into 2 mu L of positive plasmid, uniformly mixing, and carrying out amplification according to the reaction program;
(4) negative control: taking 48 mu L of PCR reaction solution in the kit, and adding ddH 2 O2 mu L, and after being uniformly mixed, the mixture is amplified according to the reaction program;
(5) and (3) electrophoretic observation: respectively taking 5 mu L of the PCR product of the sample and the negative and positive products, adding the PCR product and the negative and positive products into 1.5% agarose gel for electrophoresis observation, and judging that the chicken novel circovirus is positive if a single band with the size of 337bp appears under the condition that negative and positive controls are established; if a single band with the size of 665bp appears, the chicken infectious anemia virus is judged to be positive; if the bands of 337bp and 665bp appear at the same time, the infection is judged to be mixed.
Example 7 clinical applications
In this example, samples to be clinically tested are 117 samples showing proventriculitis, which are sent to different chicken farms in different periods, and the tissue nucleic acid extraction kit is used for extracting sample DNA, and the kit of example 5 and the operation method of example 6 are used for detection, so that the results show that 26 new chicken circovirus positive materials are contained in the 117 samples, and the positive rate is 22.2% (26/117); the positive rate of the chicken infectious anemia virus positive material is 12.8 percent (15/117) by 15 parts.
The above examples are provided to those of ordinary skill in the art to fully disclose and describe how to make and use the claimed embodiments, and are not intended to limit the scope of the disclosure herein. Modifications apparent to those skilled in the art are intended to be within the scope of the appended claims.
Sequence listing
<110> poultry institute of academy of agricultural sciences of Shandong province
<120> chicken novel circovirus and chicken infectious anemia virus differential diagnosis kit
<140> 2019107264728
<141> 2019-08-07
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 1
ctggtcgtgc gtggaaa 17
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 2
ggtatgaata cgagcccttg 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 3
cgctggaatt acaatcactc 20
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 4
gtccgcaatc aactcacc 18
Claims (1)
1. The application of the primer in preparing the chicken novel circovirus and chicken infectious anemia virus differential diagnosis kit is characterized in that: the primers comprise detection primers GyV3-1 and GyV3-2 for detecting the novel chicken circovirus and detection primers CIAV-5 and CIAV-6 for detecting the chicken infectious anemia virus;
the nucleotide sequences of the detection primers GyV3-1 and GyV3-2 are shown as follows:
GyV3-1：5'-CTGGTCGTGCGTGGAAA-3'；
GyV3-2：5'-GGTATGAATACGAGCCCTTG-3'；
the nucleotide sequences of the detection primers CIAV-5 and CIAV-6 are shown as follows:
CIAV-5：5'-CGCTGGAATTACAATCACTC-3'；
CIAV-6：5'-GTCCGCAATCAACTCACC-3'。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910726472.8A CN110628943B (en) | 2019-08-07 | 2019-08-07 | Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910726472.8A CN110628943B (en) | 2019-08-07 | 2019-08-07 | Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110628943A CN110628943A (en) | 2019-12-31 |
| CN110628943B true CN110628943B (en) | 2022-09-30 |
Family
ID=68969268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910726472.8A Active CN110628943B (en) | 2019-08-07 | 2019-08-07 | Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110628943B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733292A (en) * | 2020-07-21 | 2020-10-02 | 广西壮族自治区兽医研究所 | Primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof |
| CN112877478A (en) * | 2021-04-12 | 2021-06-01 | 广东省农业科学院动物卫生研究所 | Real-time fluorescence quantitative PCR detection reagent for glandular stomach necrosis virus and application thereof |
| CN114592089A (en) * | 2022-02-28 | 2022-06-07 | 山东农业大学 | Triple TaqMan fluorescent quantitative PCR kit for simultaneously detecting three circovirus |
| CN114959120A (en) * | 2022-06-30 | 2022-08-30 | 华南农业大学 | Primer probe set and kit for detecting chicken infectious anemia virus by RAA fluorescence method and application of primer probe set and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318963A (en) * | 2016-09-21 | 2017-01-11 | 扬州大学 | Preparation method of GyV6 novel annular virus VP3 protein |
-
2019
- 2019-08-07 CN CN201910726472.8A patent/CN110628943B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318963A (en) * | 2016-09-21 | 2017-01-11 | 扬州大学 | Preparation method of GyV6 novel annular virus VP3 protein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110628943A (en) | 2019-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110628943B (en) | Novel chicken circovirus and chicken infectious anemia virus differential diagnosis kit | |
| CN110628944A (en) | Duck type-3 adenovirus and duck novel reovirus differential diagnosis kit | |
| CN113528708A (en) | Triple PCR detection method for simultaneously detecting three feline diarrhea viruses and application thereof | |
| CN108411041B (en) | Fluorescent quantitative RT-PCR kit for detecting novel chicken reovirus and application thereof | |
| CN113584230A (en) | Reagent and method for detecting different genotypes of porcine circovirus | |
| CN112126716A (en) | Primer pair for qRT-PCR detection of tembusu virus and application thereof | |
| CN108913815B (en) | Primer group for detecting bovine norovirus and bovine coronavirus and dual RT-PCR method | |
| CN107475462B (en) | Kit for identifying common serotype chicken inclusion body hepatitis infection and application thereof | |
| CN113355460B (en) | Primer and kit for detecting novel goose reovirus, and detection method and application thereof | |
| CN111719020B (en) | Kit, primer and probe for detecting bovine rotavirus | |
| CN108384889B (en) | Multiple RT-PCR kit for genotyping and identifying bluetongue virus and detection method thereof | |
| CN111575412A (en) | Method for distinguishing four serotypes of avian adenovirus group I | |
| CN111004868A (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting goat intranasal tumor virus | |
| CN111304364A (en) | Primer and probe combination for detecting avian influenza virus, kit and detection method | |
| CN110735005A (en) | SIV and PRRSV multiple RT-PCR rapid detection kit and primer | |
| CN113046472B (en) | Triple PCR primer and kit for detecting porcine circovirus | |
| AU2021102364A4 (en) | Fluorescent pcr primer, probe and kit for detecting bovine rhinitis b virus | |
| CN114480737B (en) | FAdV-4 NP strain specific primer and application thereof in recombinase-mediated isothermal nucleic acid amplification detection | |
| CN114438261B (en) | Primer group and method for detecting goose astrovirus and goose tembusu virus | |
| CN114592088B (en) | Multiplex PCR (polymerase chain reaction) kit for detecting or distinguishing 4 different genotypes of avian reovirus and application thereof | |
| CN112746133B (en) | Fluorescence PCR detection kit for equine infectious anemia virus and application thereof | |
| CN112575122B (en) | Dual PCR primer set for rapidly detecting duck type 2 adenovirus and duck circovirus, and detection method and application thereof | |
| CN112746131B (en) | Primer and method for multiplex fluorescent quantitative PCR detection of avian metapneumovirus typing | |
| CN116064940A (en) | Multiplex fluorescence PCR detection primer probe set for different genotypes of goose astroviruses, kit and application | |
| CN111733292A (en) | Primer group for identifying avian nephritis viruses and chicken infectious anemia viruses and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |