CN107236825B

CN107236825B - Nucleic acid and method for rapidly detecting and distinguishing PRV (porcine reproductive and respiratory syndrome) wild virus and vaccine virus by real-time RPA (RPA)

Info

Publication number: CN107236825B
Application number: CN201710556795.8A
Authority: CN
Inventors: 王建昌; 刘立兵; 陈晨; 孙晓霞; 王金凤; 马付坤; 闫慧; 张静依
Original assignee: Gull Venture Capital Bio Tech Ltd Beijing One Hundred; Inspection And Quarantine Testing Center Of Hebei Entry-Exit Inspection And Quarantine Bureau
Current assignee: Gull Venture Capital Bio Tech Ltd Beijing One Hundred; Inspection And Quarantine Testing Center Of Hebei Entry-Exit Inspection And Quarantine Bureau
Priority date: 2017-07-10
Filing date: 2017-07-10
Publication date: 2020-03-10
Anticipated expiration: 2037-07-10
Also published as: CN107236825A

Abstract

The invention belongs to the technical field of biology, and particularly discloses nucleic acid and a method for rapidly identifying and detecting PRV (porcine reproductive and respiratory syndrome) wild viruses and vaccine viruses by real-time RPA (RPA). Specific RPA primers and exo probes were designed based on conserved regions of gB and gE genes in the PRV genome. The provided real-time RPA method for rapidly identifying and detecting PRV wild virus and vaccine virus can realize specific detection and differentiation of PRV wild virus and vaccine virus in a reaction system within 20min at 39 ℃, has no cross reaction with other common pig viruses, has rapid reaction, simple and convenient operation and reliable result, is very suitable for PRV detection in veterinary diagnosis laboratories and farm sites, and is particularly suitable for field detection of farm sites in remote areas with deficient resources.

Description

Nucleic acid and method for rapidly detecting and distinguishing PRV (porcine reproductive and respiratory syndrome) wild virus and vaccine virus by real-time RPA (RPA)

Technical Field

The invention belongs to the technical field of biology, and particularly relates to nucleic acid and a method for rapidly detecting and distinguishing PRV (porcine reproductive and respiratory syndrome) wild viruses and vaccine viruses by real-time RPA (RPA).

Background

Pseudorabies (PR), also known as Aujeszky's disease, is an important epidemic disease that can occur in pigs and other animals caused by Pseudorabies virus (PRV), and can cause severe economic losses in the swine industry. PRV, belonging to the family of herpesviridae, the genus varicella, is a double-stranded DNA virus with an envelope. Pigs are the natural host of PRV and are the only animal capable of tolerating PRV infection, resulting in latent infection. PRV can infect pigs at different growth stages and present different clinical symptoms: the newborn piglets are mainly manifested by nervous symptoms and high mortality; respiratory symptoms manifest primarily in adult pigs; reproductive disorders are mainly manifested in pregnant sows. In addition to swine, PRV can infect a variety of different mammals, including ruminants, canines, and rodents, and typically manifests post-infection death.

In China, pig farms, particularly small and medium-sized pig farms, pay little attention to biological safety, and this also makes control and removal of pseudorabies more difficult. In many farms, pigs infected or dying from PRV infection are not deeply buried or incinerated but are sold in different forms, which also results in the widespread dissemination of pseudorabies in our country.

Bartha-K61 strain virus lacks gE gene, and is the pseudorabies attenuated vaccine strain which is most widely applied at present. All pseudorabies attenuated vaccines currently used in China are Bartha-K61 strains. The pseudorabies attenuated vaccine can effectively control the pseudorabies epidemic situation and greatly reduce the morbidity and mortality of newborn piglets, but the PRV wild virus originally existing in the pig body cannot be eliminated after the vaccine is used, and the subsequent wild virus infection cannot be prevented. In infected pigs, PRV can form a lifelong latent infection and, once activated, can cause widespread dissemination of PRV wild virus. Since the end of 2011, a more virulent PRV variant has emerged in pig farms immunized with Bartha-K61 vaccine in various regions of our country and caused significant economic losses. Therefore, it is very important to establish a simple and rapid method for detecting and distinguishing PRV wild strains and vaccine viruses.

Various methods for PRV detection and identification based on DNA amplification techniques have been established, such as real-time fluorescence PCR (real-time PCR), loop-mediated isothermal amplification (LAMP), and nanoparticle PCR (nanopcr) methods. However, the above methods all have certain disadvantages and cannot be effectively applied to the production line and field detection. The Real-time PCR method requires professional and expensive equipment and special technicians for operation; the result judgment of the LAMP method and the nanophase PCR method needs agarose gel electrophoresis, so that the detection efficiency is greatly reduced, the false positive rate is high, and the result is unreliable.

Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification technique, where a recombinase binds primers to form a protein-DNA mixture and initiates the search for homologous sequences on a template DNA. After the homologous sequence is located, a strand displacement reaction is initiated, the primer binds to the corresponding template, and the polymerase in turn initiates DNA synthesis from the 3' end of the primer. Like PCR, two primers can initiate amplification of the target gene in order of magnitude. An exo probe is required to be added into a real-time (real-time) RPA reaction system, and a fluorescence signal generated in the amplification process is detected in real time by a fluorescence detector. However, at present, due to the design difficulty of primers and exo probes, ideal detection effect is difficult to achieve.

Disclosure of Invention

The invention aims to provide a group of nucleic acids for rapidly detecting PRV virus by real-time RPA, and the invention also aims to provide a group of nucleic acids for rapidly identifying and detecting PRV wild virus and vaccine virus by real-time RPA. The invention further aims to provide a kit for rapidly identifying and detecting nucleic acid of PRV wild virus and vaccine virus by real-time RPA and a detection method thereof.

In order to achieve the purpose, the invention adopts the following technical scheme that:

a group of nucleic acids for rapid detection of PRV by real-time RPA comprises an upstream primer 1, a downstream primer 1 and an exo probe 1 for detecting PRV; the sequence of the upstream primer 1 is shown as SEQ ID No.1, the sequence of the downstream primer 1 is shown as SEQ ID No.2, the sequence of the exo probe 1 is shown as SEQ ID No.3, wherein the 31 st T base of the exo probe 1 is marked with a fluorescent group, the 32 nd T base is marked with a fluorescence quenching group, a tetrahydrofuran molecule is arranged between the 31 st T base and the 32 nd T base, and the 3' end of the exo probe 1 is marked with C3, a phosphate group, biotin-TEG or amino.

The nucleic acid as described above, preferably, it further comprises a positive amplification product sequence 1 of PRV virus detection, wherein the positive amplification product sequence 1 comprises a sequence shown as SEQ ID No. 4.

A group of nucleic acids for rapid identification and detection of PRV wild virus and vaccine virus by real-time RPA comprises the nucleic acids and an upstream primer 2, a downstream primer 2 and an exo probe 2 for detection of PRV wild virus, wherein the sequence of the upstream primer 2 is shown as SEQ ID No.5, the sequence of the downstream primer 2 is shown as SEQ ID No.6, the sequence of the exo probe 2 is shown as SEQ ID No.7, a T base at the 31 st position of the exo probe 2 is marked with a fluorescent group different from the exo probe 1, a T base at the 32 th position is marked with a fluorescent quenching group, a tetrahydrofuran molecule is arranged between the T base at the 31 st position and the T base at the 32 th position, and the 3' end of the exo probe 2 is marked with C3, a phosphate group, biotin-TEG or an amino group.

The nucleic acid as described above, preferably, the group of nucleic acids further comprises a positive amplification product sequence 2 of PRV wild virus detection, wherein the positive amplification product sequence 2 comprises a sequence shown as SEQ ID No. 8.

The nucleic acid as described above, preferably, the fluorescent group is FAM, ROX or TAMARA, and the fluorescence quenching group is BHQ1 or BHQ 2.

A detection kit for rapidly identifying and detecting PRV wild virus and vaccine virus by real-time RPA contains the nucleic acid as described above.

The kit as described above, preferably, the kit further comprises: recA recombinase, Bsu DNA polymerase, single-strand binding protein, exo exonuclease, reaction Buffer and magnesium acetate solution.

A method for rapidly identifying and detecting PRV wild virus and vaccine virus by real-time RPA, which is a detection method for non-diagnosis purpose, specifically comprises the following steps:

(1) preparing DNA of a detection sample;

(2) carrying out isothermal amplification on the DNA in the step (1); wherein, in the reaction system, the nucleic acid as described in claim 3 is adopted and is placed at a constant temperature of 39 ℃ for reaction;

(3) carrying out the constant temperature reaction for 20min, and collecting fluorescence signals;

(4) and (4) judging a result:

if the fluorescent group marked by the exo probe 1 in the sample to be detected has an obvious amplification curve, and meanwhile, if the fluorescent group marked by the exo probe 2 has an obvious amplification curve, the PRV wild virus positive is judged;

if the fluorescent group marked by the exo probe 1 in a sample to be detected has an obvious amplification curve, and meanwhile, if the fluorescent group marked by the exo probe 2 does not have an obvious amplification curve, the PRV vaccine virus is judged to be positive;

and if the fluorescence group marked by the exo probe 1 in the sample to be detected has no amplification curve, judging that the sample is PRV virus negative.

In the method as described above, preferably, in the reaction system in the step (2), the final concentration of the forward primer 1 and the backward primer 1 is 200nmol/L, the final concentration of the exo probe 1 is 60nmol/L, the final concentration of the forward primer 2 and the backward primer 2 is 600nmol/L, and the final concentration of the exo probe 2 is 160 nmol/L.

The method as described above, preferably, in the step (2), the nuclease-free water is set as a negative control; the positive control contained the sequences shown as SEQ ID No.4 and SEQ ID No. 8.

In the detection process, a negative control and a positive control are simultaneously arranged and used for monitoring whether pollution exists or whether the operation is standard or not and whether the used reagent is effective or not in the detection process, so that the accuracy and the reliability of the detection result can be fully ensured, and the occurrence of false positive and false negative results can be effectively avoided.

The invention has the beneficial effects that:

the invention provides nucleic acid and a method for rapidly identifying and detecting PRV wild virus and vaccine virus by real-time RPA. The double real-time RPA method for rapidly identifying and detecting PRV wild virus and vaccine virus realizes the detection and the differentiation of PRV whether wild virus or vaccine virus is completed in the same reaction system. Further analysis shows that the provided method can simultaneously detect the PRV classical strain and the variant strain. The provided methods were validated using clinical samples and showed 100% consistency of detection for real-time RPA and real-time PCR methods, but the method of the invention (7-12min) was significantly faster than real-time PCR (28-38 min). The dual real-time RPA method provided by the invention has important significance for controlling pseudorabies in China, and particularly all pseudorabies vaccines used in China at present are gE-deleted, but gB genes are reserved.

Compared with the prior art, the real-time RPA detection method provided by the invention has the advantages that the RPA is detected within 20min, the real-time PCR detection needs about 55min, the LAMP method needs 60min, and the NanoPCR needs 90 min. Secondly, the RPA primer and the probe can tolerate 5-9 base mismatches without influencing the detection result, the base mismatch of the probe can cause the reduction of real-time PCR detection sensitivity, the detection result of the third and dual real-time RPA can realize real-time detection through two channels, the result analysis is simple, the result can be directly obtained, the LAMP method and the NanoPCR method need agarose gel electrophoresis for result analysis, the operation is complex, and the result can be obtained after at least 20min of waiting. The fluorescence detector Genie III used in the method can only weigh 1.75kg, and the rechargeable battery can continuously work for one day, so that the field identification detection of PRV becomes possible, which is particularly important for farms located in remote areas.

Drawings

FIG. 1 is a graph showing the sensitivity of a preferred method of the present invention to amplification of the gB gene.

FIG. 2 is a graph showing the sensitivity amplification of the gE gene according to a preferred method of the present invention.

FIG. 3 is a graph showing the specific amplification of the gB gene according to a preferred method of the present invention.

FIG. 4 is a graph showing the specific amplification of the gE gene according to a preferred method of the present invention.

FIG. 5 is a graph comparing the results of real-time RPA and fluorescence PCR methods of the present invention on gB gene detection.

FIG. 6 is a graph comparing the results of real-timeRPA method and fluorescence PCR method of the present invention on the detection of gE gene.

Detailed Description

The following description of the present invention is provided in connection with specific examples and should not be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1 design of primers and probes

In the invention, the gB gene of the pseudorabies virus is selected as a target gene for detection, and the gB gene is highly conserved and exists in all wild viruses and vaccine viruses, so the gB gene is selected as the target gene for detecting the rabies virus; the gE gene is deleted in all pseudorabies vaccines, so that the gE gene is detected to distinguish whether the gE gene is a vaccine virus or a wild virus.

The detection and identification of the pseudorabies virus are carried out by adopting a recombinase polymerase amplification technology (RPA), the primer pair and the exo probe are key to the success of the invention, the primer and probe design of the technology is not carried out by special software, only manual design is required, and different primer and probe combinations are required to be designed for verification, so that the specificity and the sensitivity of the detection are ensured. In the design of the RPA primer, (1) the first 3-5 bases of the 5 end of the primer should be avoided to be consecutive G, and the 5 end is preferably C (or pyrimidine). The last 3 bases at the 3-terminus of the primer are preferably G and C. (2) The occurrence of specific sequences in the primer, such as repeated long stretches of a certain base, is avoided as much as possible. (3) The GC content is moderate, not too high (> 70%) or too low (< 30%). (4) Pairing within or between primers should be avoided as much as possible to prevent the generation of primer dimers. (5) The formation of secondary structure of the primer is avoided as much as possible, the interaction between the primers is prevented, and the formation of hairpin structure is avoided. The exo probe is a nucleotide homologous to a target amplification sequence and comprises an abasic nucleotide mimic (THF) flanked by a dT-fluorophore and a dT-fluorescence quencher. At the same time, the 3-end of the probe is blocked by appropriate modifications (C3-spacer, phosphate group, biotin-TEG or amino group) to prevent possible polymerase amplification and extension. Currently, internal labeling of exo probes can only occur on T bases, and the two dT's in the probes cannot be more than 6 (1-5) bases apart. In the invention, all PRV sequences in the current Genbank are compared, primer probes are designed in highly conserved regions of gB and gE genes, PRV wild viruses and vaccine viruses can be distinguished in the same reaction system, no cross reaction is required between the primers and exo probes, the amplification specificity of the primer probes is fully ensured, a plurality of pairs of primer probe combinations are designed and synthesized, full verification is carried out, and the primer probe combination with the best amplification effect is screened.

Specifically, according to GQ325658.1, KT948054.1, KP009898.1, KT948053.1, KT818618.1, KP009897.1, KT948054.1, KP710982.1 and KJ526438.1 in Genbank, gB gene fragments of pseudorabies viruses are searched, and upstream and downstream primers 1 and exo probe 1 are designed. The upstream primer 1, the downstream primer 1(RPA-gB-F, RPA-gB-R) and the exo probe 1(RPA-gB-P) for detecting the pseudorabies virus by isothermal amplification are shown in Table 1.

The exo probe contains a base mimic Tetrahydrofuran (THF) molecule, wherein a fluorescent group and a fluorescence quenching group are respectively arranged on two sides of the THF molecule, and a blocker for preventing the probe from extending is arranged at the 3' end of the probe. When the probe is combined with target DNA to form a double-stranded hybrid DNA structure, exo III is used as a DNA repair enzyme, a THF site is recognized and cut to separate a fluorescent group and a fluorescence quenching group so as to generate fluorescence, two thymine nucleotides at the middle position of the exo probe 1 are respectively marked with a fluorescent group and a fluorescence quenching group, THF is designed between the two groups, the site can be recognized and cut by exonuclease III with 3'-5' exonuclease activity, a free fluorescent group is formed, and a fluorescent signal is emitted and then captured by an instrument for fluorescence detection. A large number of experiments prove that the invention selects the 31 st T base of the exo probe 1 to mark a fluorescent group, the 32 nd T base to mark a fluorescence quenching group, THF is arranged between the 31 st T base and the 32 nd T base, the 3' end of the exo probe 1 is connected with C3, a phosphate group, biotin-TEG or an amino group, the detection effect is optimal, and when the marked fluorescent group is FAM, the corresponding quenching group is BHQ 1; when the labeled fluorescent group is TAMARA or ROX, the corresponding quenching group is BHQ 2; the 3' end of the probe is connected with C3, phosphate group, biotin-TEG or amino, and the detection effect is the same when the group is adopted for detection. In this example, TCTACTACAAGAACGTCATCGTCACGACCG (FAM-dT) (THF) (BHQ1-dT) -GGTCCGGGAGCACGTA-C3 was used for the synthesis of exo probe 1.

The product of RPA-gB-F and RPA-gB-R amplification is 333bp, and the specific sequence is shown in SEQ ID No. 4: GCTCTTCAAGGAGAACATCGCCCCGCACAAGTTCAAGGCCCACATCTACTACAAGAACGTCATCGTCACGACCGTGTGGTCCGGGAGCACGTACGCGGCCATCACGAACCGCTTCACGGACCGCGTGCCCGTCCCCGTGCAGGAGATCACGGACGTGATCGACCGCCGCGGCAAGTGCGTCTCCAAGGCCGAGTACGTGCGCAACAACCACAAGGTGACCGCCTTCGACCGCGACGAGAACCCCGTCGAGGTGGACCTGCGCCCCTCGCGCCTGAACGCGCTCGGCACCCGCGGCTGGCACACCACCAACGACACCTACACCAAGATCGGCGC are provided. The sequence comprising SEQ ID No.4 can be used as a positive control.

On the basis of designing optimized primers and exo probes for real-time RPA detection of PRV, nucleic acids for distinguishing PRV wild virus and vaccine virus are designed, and sequences of a gE gene (AF207700.1, KF017615.1, KM189913.1, KM983048.1, KF360835.1, KJ789182.1, KU057086.1 and AY170318.1), an optimized upstream primer 2, a downstream primer 2(RPA-gE-F, RPA-g E-R) and an exo probe 2(RPA-gE-P) are selected, as shown in Table 1. Specifically, THF is arranged between the 31 st position and the 32 nd position during synthesis of the exo probe 2, two T base labels on two sides respectively label a fluorescent group and a fluorescence quenching group, the fluorescent group adopts ROX and the fluorescence quenching group adopts BHQ2 during synthesis, and the 3' end is connected with C3. Specifically CCGAGGAGGCGCCCCGCTCCGGCTTCGACG (ROX-dT) (THF) (BHQ2-dT) GGTTCCGCGATCCGGA-C3.

The sizes of the amplification products of the upstream primer 2 and the downstream primer 2 are 156bp, and the sequences are shown as SEQ ID No. 8: ACCCCGAGGACGAGTTCAGCAGCGACGAGGACGACGGGCTGTACGTGCGCCCCGAGGAGGCGCCCCGCTCCGGCTTCGACGTCTGGTTCCGCGATCCGGAGAAGCCGGAAGTGACGAATGGACCCAACTATGGCGTGACCGCCAACCGCCTGTTGA are provided.

The primer and probe sequences are shown in Table 1, and all primers and probes were synthesized in Shanghai.

TABLE 1 primer Probe sequence information

Wherein R represents A or G, and Y represents C or T. Example 2 Dual real-time fluorescent RPA method

The method for rapidly identifying and detecting PRV (porcine reproductive and respiratory syndrome) wild virus and vaccine virus by real-time RPA (reverse transcriptase polymerase chain reaction), namely the method for rapidly identifying and detecting PRV wild virus and vaccine virus by dual real-time fluorescent RPA (reverse transcriptase polymerase chain reaction) method, specifically comprises the following steps: (1) preparing DNA of a detection sample;

(2) carrying out isothermal amplification on the DNA sample in the step (1): using a Twist am pTM exo kit (Twist DX, Cambridge, UK) from Twist, 50. mu.L of the reaction system was used. In a 50. mu.L reaction system, 200nM, 400nM, 500nM and 600nM of the primer for gB gene (RPA-gB-F/RPA-gE-R) and the primer for gE gene (RPA-gE-F/RPA-gE-R) were used, and 60nM, 120nM, 160nM and 200nM of the exo probe for gB gene (RPA-gB-P) and the exo probe for gE gene (RPA-gE-P) were used, respectively. The reaction system also included 29.5. mu.L of exo Buffer, 2.5. mu.L of magnesium acetate at a concentration of 280mM, 1. mu.L of viral DNA and 11.9. mu.L of ddH₂And O. All reagents except the template and magnesium acetate were premixed and transferred to a 0.2mL reaction tube containing lyophilized enzyme preparations (recA recombinase, Bsu DNA polymerase, single-stranded binding protein and exo exonuclease) and were sufficiently homogeneous. Adding 1 mu L of template into a reaction tube, adding 2.5 mu L of magnesium acetate into a reaction tube cover, covering tightly, instantly centrifuging and vortexing, putting into Genie III, and reacting at constant temperature of 39 ℃;

(3) the reaction was carried out for 20min at an isothermal temperature of 39 ℃ while collecting the fluorescence signal: collecting a fluorescence signal amplified by the gB gene by using a Channel-1 Channel (Blue, the excitation wavelength is 470nm, and the detection wavelength is 510-560 nm); the fluorescence signal of the amplification of the gE gene was collected using the Channel-2 Channel (Yellow, excitation wavelength 590nm, detection wavelength > 620 nm).

(4) And (4) judging a result: if the fluorescent group marked by the exo probe 1 in a sample to be detected has an obvious amplification curve, and meanwhile, if the fluorescent group marked by the exo probe 2 has an obvious amplification curve, the PRV wild virus positive is judged, and if the fluorescent group marked by the exo probe 2 has no obvious amplification curve, the PRV vaccine virus positive is judged; and if the fluorescence group marked by the exo probe 1 in the sample to be detected has no amplification curve, judging that the sample is PRV virus negative.

Preferably, when the primer concentration of the gB gene is 200nM, the probe concentration is 60nM, and the primer concentration of the gE gene is 600nM, and the probe concentration is 160nM, the Channel-1(gB gene) and Channel-2(gE gene) channels can both detect fluorescence signals and present good amplification curves.

In the method established by the invention, in order to avoid the failure or pollution of the used reagent, a positive control reagent and a negative control reagent are also arranged, and the negative control adopts nuclease-free water;

the positive control adopts plasmid DNA carrying amplification products, and the nucleotide sequences of the amplification products contain sequences shown as SEQ ID No.4 and SEQ ID No. 8.

The design of negative control can effectively verify whether the used reagent is polluted or not, so that false positive is avoided, and the design of positive control can effectively verify the effectiveness of the used reagent, so that false negative is avoided.

EXAMPLE 3 detection of sensitivity

Preparation of DNA Standard

PRV Fa strain virus genome DNA is used as a template, pRVgB-F/pRVgB-R and pRVgE-F/pRVgE-R in Table 1 are used as primers, PCR amplification is respectively carried out to obtain gB gene and gE gene full length, PCR products are recovered and then connected with pMD19-T vector to construct recombinant plasmids pRV-gB and pRV-gE, the recombinant plasmids are transformed into competent cells DH5 α, positive clones with correct sequencing are cultured overnight to extract plasmids, and the concentration is measured by using ND 2000c, according to the formula, the copy number (copies/mu L) is 6.02 multiplied by 10²³X concentration (ng/. mu.L). times.10^-9/(number of bases prepared)660) And calculating the copy number of the recombinant plasmid. The recombinant plasmids pRV-gB and pRV-gE were diluted 10-fold to a range of 10⁶-10⁰Copies/. mu.L, as DNA standards, were stored at-80 ℃ until use.

2. Sensitivity detection Using the Dual real-time fluorescent RPA method of example 2

Using 1. mu.L of serially diluted DNA standards as templates, sensitivity analysis was performed by the method preferable in example 2, wherein the primer concentration of gB gene in the reaction solution was 200nM, the probe concentration was 60nM, the primer concentration of gE gene was 600nM, and the probe concentration was 160 nM.

At a concentration of 10⁶To 10⁰The gB and gE DNA standards of copies were used as templates for sensitivity detection, and 8 real-time RPA detections were performed for each concentration. The results show that when the concentration of gB and gE standard is 10⁶To 10²In cases of copies, the gB and gE genes are positive in 8 detections; as a result of the detection, the amplification curve of Channel-1(gB gene) is shown in FIG. 1, and the amplification curve of Channel-2(gE gene) is shown in FIG. 2. When the concentration of gB and gE standard substances is 10¹In copies, the gB gene was positive in 4 tests, while the gE gene was positive in 3 tests; when the concentration of gB and gE standard substances is 10⁰In copes, 8 detections of gB and gE genes were negative. The results show that the detection sensitivity of the invention can reach 10 for both gB and gE genes¹copies。

Example 4 specific detection

Pseudorabies virus (RPV, Fa, SH151218 strain), porcine reproductive and respiratory syndrome virus (PRRSV, strain HB-Xl), encephalomyocarditis virus (EMCV, strain BD) and porcine circovirus type 2 (PCV-2, strain HB-MC1) stored in the Central laboratory of the inspection and quarantine technology of the entry and exit inspection and quarantine office in Hebei are treated by the preferably dual real-time fluorescent RPA method of example 2; among them, PRV SH151218 strain is a variant isolated from Hebei pig farm immunized with Bartha-K61 vaccine.

And commercial attenuated vaccines from China: pseudorabies virus (Bartha-K61), classical swine fever virus (CSFV, striainAV 1412), and porcine parvovirus (PPV, strain BJ-2), and these 8 viruses were tested.

Using these viral genomic DNA or cDNA as templates, the reaction conditions for dual fluorescent RPA were: at 39 ℃ for 20 min.

The result was that PRV vaccine strain Bartha-K61 was positive for only the gB gene (A), while PRV wild strains Fa and SH151218 were both positive for gB and gE (B). The amplification curves are shown in fig. 3 and 4, where 1: pseudorabies virus (Fa); 2: pseudorabies virus (SH 151218); 3: pseudorabies virus (Bartha-K61) 4: hog cholera virus; 5: porcine reproductive and respiratory syndrome virus; 6: porcine encephalomyocarditis virus; 7: porcine parvovirus; 8: porcine circovirus type 2.

The result shows that the dual-fluorescence RPA provided by the invention can specifically detect and distinguish PRV vaccine strains and wild strains.

Example 5 detection of viral strains and clinical samples

1. Sources of viral strains and clinical samples

Pseudorabies viruses (RPV, Fa strain, SH151218 strain and NQY160308 strain) are stored in laboratories of the central laboratory of the entry and exit inspection and quarantine technology of Hebei. Both the PRV SH151218 strain and the NQY160308 strain are variants isolated from Hebei pig farms immunized with Bartha-K61 vaccine. PRV Bartha-K61 strain is a commercial attenuated vaccine in China.

37 clinical samples including 9 dead piglets with brain, lymph nodes, lung, kidney and whole blood, 8 dead raccoon dogs with brain, lymph nodes, lung, kidney, and 20 healthy slaughtered pigs with brain and lymph nodes from the northern river region of the farm. For tissue samples, 10mg were homogenized well in 1mL sterile PBS, centrifuged at 2000rpm for 10min, and the supernatant was used for viral DNA extraction. For the whole blood sample, 1mL was taken for viral DNA extraction.

2. Viral DNA/RNA extraction and reverse transcription of RNA

Viral nucleic acid extraction was performed using TIANAmp Virus genomic DNA/RNA kit (Tiangen Biochemical technology, Beijing, Ltd., Beijing). 100ng of viral RNA was transcribed using Primescript II 1st strand and cDNAsynthesis kit (Takara Shuzo Co., Ltd., Dalian Co., Ltd.) to obtain cDNA. The concentrations of the viral DNA and cDNA were measured using an ND-2000c nucleic acid concentration measuring instrument (Wilmington, USA). All viral DNA and cDNA were stored at-80 ℃.

3. Validation of Dual real-time RPA method

The differential detection of PRV was carried out on 3 strains of PRV wild virus (Fa, SH151218 and NQY160308, 160308), 1 strain of vaccine virus (Bartha-K61), and 37 clinical specimens using the preferably double real-time RPA method of example 2, and the results were compared with the real-time PCR method of the aforementioned document W.Ma, K.M.Lager, J.A.Richt, W.C.Stoffregen, F.ZHou, K.J.Yoon, development of real-time polymerase reaction assays for rapid detection and characterization of the same, JVimet Diagram, Invest,20 2008, 440-.

4. Results

The real-time RPA provided by the invention and the existing real-time PCR are consistent in detection results of all samples (21 positive and 20 negative), wherein the detection results of 21 positive are shown in Table 2. Further analysis showed that the consistency of detection was 100% for both methods. All samples from piglets and raccoon dogs were positive for PRV gB and gE genes (see table 2), while healthy pigs were negative for PRV gB and gE genes. All PRV strains (Fa, SH151218, NQY160308 and Bartha-K61) were positive for the gB gene, while only Bartha-K61 was negative for the gE gene (see Table 2). For positive clinical samples, the time required for real-time RPA detection was 7-12min, while the time required for real-time PCR was approximately 28-38min, which fully illustrates the rapidity of the real-time RPA method.

Linear regression analysis performed by Prism software with the detection result (TT) of real-time RPA method as ordinate and the detection result (Ct) of real-time PCR method as abscissa shows that the two methods have detection correlation (R) to gB gene (A)²) 0.983, correlation of detection of gE gene (B) (R)²) 0.992, and the results are shown in FIGS. 5 and 6.

TABLE 2 comparison of the results of detection of different PRV and clinical samples by dual fluorescent RPA and fluorescent PCR

In this example, all clinical samples from dead piglets and raccoon dogs were PRV wild virus positive, and PRV infection of piglets and raccoon dogs was confirmed by PRV isolation results. Further investigation shows that the raccoon dog has clinical symptoms of pseudorabies and dies after eating dead piglets.

The invention provides a dual real-time RPA method capable of simultaneously identifying and detecting PRV wild virus and vaccine virus. The portability of the method enables the method to be effectively applied to the field detection of the pseudorabies, particularly in resource-deficient areas, and has important significance on epidemiological investigation, prevention and control and elimination of the pseudorabies.

SEQUENCE LISTING

<110> inspection and quarantine technology center of entry and exit inspection and quarantine bureau of Hebei, Beijing Bai Lau-invested Biotechnology Ltd

<120> nucleic acid and method for rapid detection and differentiation of PRV wild virus and vaccine virus by real-time RPA

<130>

<160>18

<170>PatentIn version 3.5

<210>1

<211>30

<212>DNA

<213> Artificial Synthesis

<400>1

gctcttcaag gagaacatcg ccccgcacaa 30

<210>2

<211>31

<212>DNA

<213> Artificial Synthesis

<400>2

gcgccgatct tggtgtaggt gtcgttggtg g 31

<210>3

<211>48

<212>DNA

<213> Artificial Synthesis

<400>3

tctactacaa gaacgtcatc gtcacgaccg ttggtccggg agcacgta 48

<210>4

<211>333

<212>DNA

<213> Artificial Synthesis

<400>4

gctcttcaag gagaacatcg ccccgcacaa gttcaaggcc cacatctact acaagaacgt 60

catcgtcacg accgtgtggt ccgggagcac gtacgcggcc atcacgaacc gcttcacgga 120

ccgcgtgccc gtccccgtgc aggagatcac ggacgtgatc gaccgccgcg gcaagtgcgt 180

ctccaaggcc gagtacgtgc gcaacaacca caaggtgacc gccttcgacc gcgacgagaa 240

ccccgtcgag gtggacctgc gcccctcgcg cctgaacgcg ctcggcaccc gcggctggca 300

caccaccaac gacacctaca ccaagatcgg cgc 333

<210>5

<211>32

<212>DNA

<213> Artificial Synthesis

<400>5

accccgagga cgagttcagc agcgacgagg ac 32

<210>6

<211>31

<212>DNA

<213> Artificial Synthesis

<400>6

tcaacaggcg gttggcggtc acgccatagt t 31

<210>7

<211>48

<212>DNA

<213> Artificial Synthesis

<400>7

ccgaggaggc gccccgctcc ggcttcgacg ttggttccgc gatccgga 48

<210>8

<211>156

<212>DNA

<213> Artificial Synthesis

<400>8

accccgagga cgagttcagc agcgacgagg acgacgggct gtacgtgcgc cccgaggagg 60

cgccccgctc cggcttcgac gtctggttcc gcgatccgga gaagccggaa gtgacgaatg 120

gacccaacta tggcgtgacc gccaaccgcc tgttga 156

<210>9

<211>24

<212>DNA

<213> Artificial Synthesis

<400>9

atgcccgctg gtggcggtct ttgg 24

<210>10

<211>19

<212>DNA

<213> Artificial Synthesis

<400>10

ctacagggcg tcggggtcc 19

<210>11

<211>19

<212>DNA

<213> Artificial Synthesis

<400>11

atgcggccct ttctgctgc 19

<210>12

<211>21

<212>DNA

<213> Artificial Synthesis

<400>12

ttaagcgggg cgggacatca a 21

<210>13

<211>23

<212>DNA

<213> Artificial Synthesis

<400>13

acaagttcaa ggcccacatc tac 23

<210>14

<211>21

<212>DNA

<213> Artificial Synthesis

<400>14

gtcygtgaag cggttcgtga t 21

<210>15

<211>17

<212>DNA

<213> Artificial Synthesis

<400>15

acgtcatcgt cacgacc 17

<210>16

<211>21

<212>DNA

<213> Artificial Synthesis

<400>16

cttccactcg cagctcttct c 21

<210>17

<211>19

<212>DNA

<213> Artificial Synthesis

<400>17

gtraagttct cgcgcgagt 19

<210>18

<211>16

<212>DNA

<213> Artificial Synthesis

<400>18

ttcgacctga tgccgc 16

Claims

1. A group of nucleic acids for rapidly detecting PRV by real-time RPA is characterized by comprising an upstream primer 1, a downstream primer 1 and an exo probe 1 for detecting PRV; the sequence of the upstream primer 1 is shown as SEQ ID No.1, the sequence of the downstream primer 1 is shown as SEQ ID No.2, the sequence of the exo probe 1 is shown as SEQ ID No.3, wherein the 31 st T base of the exo probe 1 is marked with a fluorescent group, the 32 nd T base is marked with a fluorescence quenching group, a tetrahydrofuran molecule is arranged between the 31 st T base and the 32 nd T base, and the 3' end of the exo probe 1 is marked with C3, a phosphate group, biotin-TEG or amino.

2. The nucleic acid of claim 1, wherein the set of nucleic acids further comprises a positive amplification product sequence 1 of a PRV virus detection, wherein the positive amplification product sequence 1 comprises a sequence as set forth in SEQ ID No. 4.

3. A group of nucleic acids for rapid identification and detection of PRV wild virus and vaccine virus by real-time RPA, which is characterized by comprising the nucleic acid as claimed in claim 1 or 2, and an upstream primer 2, a downstream primer 2 and an exo probe 2 for detection of PRV wild virus, wherein the sequence of the upstream primer 2 is shown as SEQ ID No.5, the sequence of the downstream primer 2 is shown as SEQ ID No.6, the sequence of the exo probe 2 is shown as SEQ ID No.7, the 31 st T base of the exo probe 2 is marked with a fluorescent group different from the exo probe 1, the 32 nd T base is marked with a fluorescent quenching group, a tetrahydrofuran molecule is arranged between the 31 st T base and the 32 nd T base, and the 3' end of the exo probe 2 is marked with C3, a phosphate group, biotin-TEG or an amino group.

4. The nucleic acid of claim 3, wherein the nucleic acid set further comprises a positive amplification product sequence 2 of PRV wild virus detection, wherein the positive amplification product sequence 2 comprises a sequence shown as SEQ ID No. 8.

5. The nucleic acid of any one of claims 1 to 4, wherein the fluorophore is FAM, ROX or TAMARA and the fluorescence quencher is BHQ1 or BHQ 2.

6. A test kit comprising a nucleic acid according to any one of claims 1 to 5.

7. The test kit of claim 6, further comprising: recA recombinase, Bsu DNA polymerase, single-strand binding protein, exo exonuclease, reaction Buffer and magnesium acetate solution.