CN111621526B - Construction method and application of TOB1 gene knockout monoclonal cell line - Google Patents

Abstract

The invention belongs to the technical field of biological engineering, and particularly relates to a construction method and application of a TOB1 gene knockout monoclonal cell line. The invention discovers that a monoclonal cell line cell TOB1-KOs for inhibiting FMDV replication can be obtained by knocking out a TOB1 gene in a porcine kidney epithelial cell line IBRS-2 through a gene editing technology; after the cell line TOB1-KOs is subjected to FMDV challenge, no virus nucleic acid and protein can be detected, and the fact that the monoclonal cell line TOB1-KOs obtained by knocking out the TOB1 gene in the IBDS-2 has FMDV resistance phenotype shows that the replication of FMDV can be completely inhibited, so that a feasible strategy is provided for preventing or inhibiting FMDV infection in the future.

Description

Construction method and application of TOB1 gene knockout monoclonal cell line

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to a construction method and application of a TOB1 gene knockout monoclonal cell line.

Background

Foot and Mouth Disease (FMD) is an acute, hot, highly contagious animal epidemic caused by FMDV (Foot and mouth disease virus). The disease can be spread in a long distance, and the infected objects are main animal species such as pigs, cattle, sheep and the like and other artiodactyls. The characteristic symptoms of the affected animals are blisters at the mouth, nose, hoof, and teats of female animals, which are damaged to form ulcers or scabs, which show salivation, lameness, and lying on the ground, thereby causing a great decrease in productivity and causing a great economic loss and a negative impact on socio-politics. The world animal health organization ranks the disease as the first infectious disease of animals reported by law, and the Chinese government also ranks the disease as the first infectious disease of animals. FMDV is a non-enveloped virus with an icosahedral symmetrical structure belonging to the genus aphtoviridae, the genome of which is a single positive-stranded RNA of about 8300nt in length, encoding a long polyprotein, which is subsequently cleaved by the virus' own proteases to form 4 structural proteins, 11 non-structural proteins and a series of precursor proteins.

Epidemic control in the FMD epidemic area is achieved through diagnosis, monitoring and regular mass vaccination, and inactivated FMDV vaccine is available as early as the beginning of the 20 th century, and the occurrence of the inactivated FMDV vaccine inhibits the spread of FMD to some extent. FMDV has seven different serotypes, namely O, A, C, Asia1, SAT1, SAT2 and SAT3, and vaccines among the serotypes have no cross immune protection, so that after an animal is immunized by inactivated vaccines, the time required for generating antibodies by the immune response of the animal is long, and the duration of specific antibodies in the animal is short; in addition, vaccines do not completely inhibit viral replication at the primary site of viral infection. Thus, even though a large amount of FMD vaccine is put into use every year, the epidemic is still not effectively controlled, and the outbreak of the epidemic still affects millions of animals worldwide and creates a barrier to the trade of animals and animal products in a large number of FMD-affected areas. Therefore, the development of new and highly effective vaccines requires more specific molecular mechanisms for virus interaction with the host to provide theoretical support.

FMDV has been abusive worldwide for a long time, and has not differentiated from the development of a series of means for suppressing the host's antiviral immune response during long-term challenge with the host. After FMDV infects a host, the host cell is utilized to complete the self life cycle, more viruses are released to the environment, the host recognizes the viruses through a series of recognition factors, then a signal transmission and cascade amplification mechanism is started to activate the self antiviral immune response, including a type I interferon channel, a type III interferon channel and other antiviral cell factor expression channels with antiproliferative and immunoregulatory functions, so that the virus replication is inhibited, and the purposes of clearing the viruses and maintaining the self health are achieved. In the process of the virus and the host fighting each other, the two influence each other and co-evolve. For hundreds of years, FMDV is widely spread globally, and is frequently outbreaked in a large scale in a plurality of countries, not only because FMDV has multiple transmission paths, high transmission speed, more susceptible animals and high morbidity, but also more importantly, FMDV interacts with a host after infecting the host and inhibits the immune response of the host through multiple paths from multiple layers. Firstly, a plurality of nonstructural proteins of FMDV have protease activity, and the expression of host antiviral molecules can be inhibited at the transcription and translation levels simultaneously through the cleavage of host proteins; secondly, in terms of adaptive immune response against the host, FMDV can suppress the secretion and expression of antiviral cytokines and interferon stimulatory genes, inhibit the MHC class I molecules of the host, block or overcome the initial IFN α response produced by dendritic cells, induce host lymphopenia; in addition, FMDV can produce large quantities of virus within a very short replication cycle, avoiding the adverse effects of premature apoptosis on virus replication. Thus, by engineering host cells to enhance their resistance to FMDV, replication of FMDV in the host cell can be significantly reduced. Wherein, cell strains with FMDV virus resistance can be obtained by means of gene function deletion and function acquisition.

The ErbB2 binding protein (Transducer of ErbB2.1, TOB1) is a tumor suppressor protein that is a negative regulator of the tyrosine receptor kinase ErbB2.

The invention unexpectedly discovers that the deletion of the TOB1 gene in a host can obtain a host cell with FMDV resistant phenotype, and the host cell can inhibit FMDV replication.

Disclosure of Invention

In view of the above technical problems, the present invention aims to provide an application of inhibiting the replication of foot-and-mouth disease virus by inhibiting the expression of the TOB1 gene in host cells through a gene silencing technique.

Another objective of the invention is to provide an application of deleting the function of the TOB1 gene in a host cell to inhibit the replication of the foot-and-mouth disease virus.

Another objective of the invention is to provide an application of TOB1 gene mutation in host cell by gene targeting technology to inhibit FMDV replication.

Preferably, the gene targeting technology comprises gene knockout technology, gene mutation technology and gene insertion technology.

Another objective of the invention is to provide an application of the deletion of the function of the TOB1 gene in the host cell in animal antiviral breeding.

Preferably, the animal is an animal of the order Artiodactyla and the host cell is an animal cell of the order Artiodactyla.

Preferably, the host cell is derived from a bovine (Bovidae) animal, a porcine (Suidae) animal.

Another objective of the present invention is to provide a method for constructing a monoclonal cell line with missing TOB1 gene function, wherein the method comprises the following steps: the function of the TOB1 gene in the host cell is deleted by gene targeting technology.

Preferably, the construction method comprises the following steps:

(1) preparation of sgRNA double-stranded fragments targeting the TOB1 gene:

(2) connecting the double-stranded fragment in the step (1) with a pCRISPR-s4 vector after Bbs I enzyme digestion to obtain a gene targeting vector;

(3) co-transfecting the gene targeting vector in the step (2) with a Cas9 expression plasmid pCRISPR-s10 and a piggyBac transposase expression plasmid pPbase to obtain a monoclonal cell line with TOB1 gene function deletion.

Preferably, the sgRNA in step (1) has a forward fragment of 5'-CACCGCGTTTGGATCGACCCGTTT G-3' and a reverse fragment of 5'-AAACCAAACGGGTCGATCCAAACGC-3'.

Preferably, the host cell is derived from a bovine (Bovidae) animal, a porcine (Suidae) animal.

Another objective of the present invention is to provide a monoclonal cell line with loss of function of the TOB1 gene prepared by the above method.

Another objective of the invention is to provide an application of the monoclonal cell line with function loss of the TOB1 gene in antiviral breeding.

The invention has the beneficial effects that: the invention unexpectedly discovers that the TOB1 gene is deleted in a host, and the obtained host cell with FMD V resistance phenotype can inhibit FMDV replication; secondly, a monoclonal cell line with TOB1 gene function deletion is obtained by CRISPR/Cas9 technology; and providing a feasible strategy for preventing or inhibiting FMDV infection in the future.

Drawings

FIG. 1 is a diagram showing the result of verifying the loss of function of TOB1 in the cell line TOB1-KOs in which the function of the TOB1 gene is lost;

FIG. 2 shows the result of total FMDV RNA copy number detection after FMDV challenge by the cell line TOB1-KOs with gene function loss of TOB1 gene;

FIG. 3 shows the result of RNA copy number detection of FMDV in cells after FMDV challenge by the cell line TOB1-KOs with gene function loss of TOB1 gene;

FIG. 4 shows the results of intracellular viral protein staining after FMDV challenge for the cell line TOB1-KOs with gene function loss of TOB1 gene;

FIG. 5 shows the result of detecting the intracellular viral protein content of the cell line TOB1-KOs with gene function loss after FMDV challenge;

FIG. 6 is a cell morphology chart of a cell line TOB1-KOs with loss of TOB1 gene function after FMDV challenge;

FIG. 7 shows the result of cell viability detection of TOB1 gene function-deficient cell line TOB1-KOs after FMDV challenge.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail below with reference to the accompanying drawings. However, it will be appreciated by those of ordinary skill in the art that in various embodiments of the invention, numerous technical details are set forth in order to provide a better understanding of the present application. However, the technical solution claimed in the present application can be implemented without these technical details and various changes and modifications based on the following embodiments.

Definition of

The term "gene silencing" refers to the phenomenon of making a gene under-or not under-expressed without damaging the original DNA, and mainly includes two aspects, namely, gene silencing at the transcription level due to DNA methylation, heterochromatosis, position effect and the like; the second is post-transcriptional gene silencing, which is the inactivation of genes by specific inhibition of target RNA at the post-transcriptional level of the gene, including antisense RNA, co-suppression, gene suppression, RNA interference, and microrna-mediated translation suppression. The invention can inhibit the expression of the TOB1 gene in a host cell by a gene silencing technology, thereby inhibiting the virus replication after FMDV infection and being used for preventing or treating FMDV infection, wherein the TOB1 gene has more than 90 percent of homology with the nucleotide sequence shown in SEQ ID NO.1

The term "gene targeting" refers to a directional transgenic technology for directionally changing the genetic information of cells or biological individuals by using DNA site-directed homologous recombination, and mainly comprises gene knockout, gene inactivation, gene knock-in, point mutation, deletion of large segments of chromosome groups and the like. Wherein "gene knockout" refers to inactivation of a specific target gene by homologous recombination. According to the invention, through a gene knockout technology, the TOB1 gene in a host cell is knocked out, and the obtained TOB1 gene knocked-out monoclonal cell line can inhibit virus replication after FMDV infection.

The term "sgRNA" is a guide RNA that directs the insertion or deletion of uridine residues into the kinetoplast (kinetoplastid) during RNA editing, and is a small non-coding RNA.

The invention artificially synthesizes sgRNA targeting the TOB1 gene, prepares a forward fragment and a reverse fragment of the sgRNA by adding sticky ends, and anneals the sgRNA into a double-stranded fragment. The addition mode of the sticky end is as follows: if the first base at the 5 'end of the sgRNA sequence is not G, adding a base CACCG to the 5' end of the sgRNA sequence to obtain a forward fragment, and if the first base at the 5 'end of the sgRNA sequence is G, adding the base CACCG to the 5' end of the sgRNA sequence to obtain a forward fragment; if the first base at the 5 ' end of the sgRNA sequence is not G, the 3 ' end of the reverse complementary strand of the sgRNA is added with a base CAAA, and the 5 ' end is added with C to be used as a reverse fragment, and if the first base at the 5 ' end of the sgRNA sequence is G, the 3 ' end of the reverse complementary strand of the sgRNA is added with CAAA to be used as a reverse fragment.

On the basis of directly targeted splicing of the TOB1 gene, the invention utilizes a CRISPR/Cas9 combined specific method for knocking out the TOB1 gene, takes a porcine kidney cell line IBRS-2 as an example, and knocks out the TOB1 gene, thereby providing a strategy for preventing or treating the foot-and-mouth disease. Although only the TOB1 gene in the porcine kidney cell line IBRS-2 is knocked out to obtain a host cell with FMDV resistance, the invention can be deduced and expanded to construct a host cell with FMDV resistance by knocking out the TOB1 gene in other animal cells of the artiodactyla, which at least comprises animals of the Bovidae and the porcine (Suidee), because the TOB1 gene in the animal cells of the artiodactyla has high homology (> 90%).

The CRISPR/Cas9 system realizes the directional recognition and shearing of genes by sgRNA and Cas9, and the sgRNA determines the targeting property of Cas9 and also determines the cutting activity of Cas 9. The invention aims to realize effective knockout of a TOB1 gene by screening a gRNA sequence aiming at the TOB1 gene in vivo and in vitro by applying a CRISPR/Cas9 gene editing technology and obtain a TOB1 gene knockout monoclonal cell line for inhibiting FMDV virus replication, thereby providing a new strategy for preventing or treating foot-and-mouth disease virus infection.

By using a CRISPR/Cas9 gene editing technology, the SgRNA of a targeted TOB1 gene guides a Cas9 protein to be combined with a specific sequence position of a TOB1 gene to cut a DNA double strand, so that the gene double strand is broken, random mutation is generated under the action of a cell self-repair mechanism, the reading frame of the gene is changed due to mutation such as nucleotide deletion or insertion, the purpose of gene function inactivation is finally achieved, and the gene function-deficient cell is obtained.

After the function of the TOB1 gene in the host cell is deleted, the FMDV virus replication can be remarkably inhibited. Therefore, the deletion of the function of the TOB1 gene in the host cell can be used for breeding antiviral animals; the cell line constructed by deleting the function of the TOB1 gene can also be used for breeding antiviral animals.

The experiments described in the following examples obtain biosafety permits and african swine fever laboratory activity permits:

the FMDV A/GDMM/CHA/2013 wild strain is preserved by a foot-and-mouth disease reference laboratory of Lanzhou veterinary research institute of Chinese academy of agricultural sciences;

IBRS-2 (porcine kidney cell line), Escherichia coli DH5 alpha and sgRNA of the targeted porcine TOB1 gene are synthesized by Beijing Liuhe Hua Dagenescience and technology Limited; targeting vector pCRISPR-sg4, piggyBac transposase expression vector pPbase and doxorubicin induced Cas9 expression vector pCRISPR-s10 were purchased from Ribo Lai Biotech, Inc., Lanzhou;

the primers used for PCR, Q-PCR and reverse transcription are completed by Beijing Liuhe Hua Dagenescience and technology Limited and Shanghai Meiji biological medicine science and technology Limited; the conventional DNA sequencing is carried out by Beijing Liuhe Dagen technology Co., Ltd, Shanghai Meiji biological medicine technology Co., Ltd.

Example 1 construction of a monoclonal cell line TOB1-KOs deficient in TOB1 Gene function

(1) Artificially synthesizing a forward fragment and a reverse fragment of the sgRNA, and annealing the forward fragment and the reverse fragment into a double-stranded fragment, wherein the forward fragment of the sgRNA is 5'-CACCGCGTTTGGATCGACCCGTTTG-3' (shown in SEQ ID NO. 2), and the reverse sequence is 5'-AAACCAAACGGGTCGATCCAAACGC-3' (shown in SEQ ID NO. 3); an annealing system: 10 × LA PCR Buffer II (Mg)²⁺Plus) 5. mu.L, forward fragment (100. mu.M) 22.5. mu.L, reverse fragment (100. mu.M) 22.5. mu.L, gently mix; and (3) annealing procedure: at 95 ℃ for 2 min; 95-85 ℃ and 1 ℃/sec.

(2) Connecting the double-chain fragment with a pCRISPR-s4 vector after Bbs I enzyme digestion, and transforming the bacterial competence to obtain a TOB1 gene targeting vector PB-CRISPR;

when the wild-type IBRS-2 cells are in good state and the confluency reaches 80%, referring to the instruction of using a nucleofection kit, Cell line nucleofector kit R, Lonza and VACA-1001, 1.5 mu G of the TOB1 gene targeting vector PB-CRISPR, 1.5 mu G of pCRISPR-s10 (Cas 9 expression plasmid induced by doxorubicin) and 1 mu G of pPbase plasmid (piggyBac transposase expression plasmid induced by purromycin resistance gene) are respectively electrotransferred into the IBRS-2 cells, after 24 hours of electrotransferred, the cells are treated for 3 days by using a culture medium with purromycin concentration of 2 mu G/mL, the cells are treated for 7 days by using a culture medium with G418 concentration of 600ng/mL, the transfected positive cells are selected, and the expression of Cas9 is induced by treating the positive cells for 6 days by using a culture medium with doxorubicin concentration of 4 mu G/mL. Subsequently, KOs corresponding to the TOB1 gene is obtained by a dilution culture method and identified, the genome of KOs is extracted, the KOs genome is used as a template to amplify a sequence near a target point by PCR (an amplification primer: TOB 1F: AGCGAAAGTGGCAGTGGTAAAGGT (shown in SEQ ID NO. 4); TOB 1R: AGAAATATGAAGGGCACTGGTATC (shown in SEQ ID NO. 5)), the sequence information near the target point is determined by sequencing of a PCR product, and the sequence information is compared with the sequence information of a corresponding position in the genome of a wild-type IBRS-2 cell, so that a monoclonal cell line TOB1-KOs with the function of the TOB1 gene being deleted is obtained. Two monoclonal cells TOB1-KO1 and TOB1-KO2 were selected from the monoclonal cell line TOB 1-KOs.

Western blotting of TOB1-KOs

In order to further confirm the loss of function of the TOB1 gene in the TOB1-KOs, total protein of wild-type IBRS-2 cells (WT), Control library (transfection of nonsense sgRNA) and two TOB1 gene loss monoclonal cell lines TOB1-KOs (TOB1-KO1 and TOB1-KO2) is respectively extracted, Western blotting detects that the TOB1 protein in the TOB1-KOs is not detected, and the result is shown in FIG. 1, which indicates that protein translation frame shift mutation caused by base insertion/deletion of the coding region of the TOB1 gene in the IBRS-2 cells results in the loss of function of the TOB1 gene in cells, and the TOB1 gene loss monoclonal cell line TOB1-KOs is obtained; although the method is exemplified by IBRS-2 cells, due to the high homology (> 90%) of the TOB1 gene in animal cells of the order artiodactyla, corresponding host cells with loss of function of the TOB1 gene can also be obtained by the method for other animal cells of the order artiodactyla, including at least animals of the families Bovidae and Suideae.

Example 2 detection of RNA copy number and viral protein content of FMDV after FMDV challenge by TOB1-KOs

Total FMDV RNA copy number detection after FMDV challenge by TOB1-KOs

In the research, the RNA copy number of the FMDV at each time point in the 20hpi cell and in the culture supernatant of the TOB1-KOs is detected by adopting a fluorescence probe method absolute quantitative PCR (polymerase chain reaction). After counting, the same amount of wild-type IBDS-2 cells, Control library and 2 strains of TOB1-KOs (TOB1-KO1 and TOB1-KO2) were taken while FMDVA/GDMM was challenged (MOI 0.2), the cell and culture supernatant mixtures were harvested at 0hpi (non-challenged Control), 4hpi, 8hpi, 12hpi, 16hpi, 20hpi, 24hpi, 32hpi, 40hpi, 48hpi, 56hpi and 64hpi time points, respectively, viral RNA was extracted, the copy number of the viral RNA in each sample was determined by fluorescence absolute quantitative PCR (amplification primers FM3 DqF: ACTGGGTTTTACAAACCTGTGA (SEQ ID NO. 6)), FMDV3D R: GCGAGTCCTGCCACGGA (SEQ ID NO. 7)), each time point was determined, the copy number of the viral RNA in each sample was rapidly increased as shown in the top copy number of the wild-type IBDV cell and the copy number of the wild-type IBDV cell were increased as shown in FIG. 2, and as the top copy number of the wild-type IBDV cell was increased as shown in FIG. 2, after 20hpi, a large number of cells are lysed, the virus loses objects and replication sites which can be infected continuously, and the RNA copy number gradually decreases; the presence of viral RNA in cells and culture supernatants from TOB1-KOs (TOB1-KO1 and TOB1-KO2) was not detectable at various time points after challenge, compared to wild-type IBRS-2 cells and Control library. The result shows that the monoclonal cell line TOB1-KOs with the loss of the function of the TOB1 gene can obviously inhibit the replication of FMDV virus and has FMDV resistance phenotype; although the method is exemplified by an IBRS-2 cell, due to the high homology (> 90%) of the TOB1 gene in the cells of animals of the order artiodactyla, which includes at least Bovidae and swine (Suidae) animals, it is also possible to construct FMDV-resistant host cells by knocking out the TOB1 gene in the cells of other animals of the order artiodactyla.

2. Intracellular FMDV RNA content detection

To further verify the FMDV-resistant phenotype of TOB1-KOs, the present study examined intracellular viral RNA, included the endogenous gene GAPDH, and compared the content of FMDV RNA in TOB1-KOs (TOB1-KO1 and TOB1-KO2) with IBRS-2 cells and Control library cells by dye-based PCR. After counting cells, the same amount of wild-type IBDS-2 cells, Control library and 2 strains of TOB1-KOs (TOB1-KO1 and TOB1-KO2) were taken, FMDV A/GDMM was simultaneously detoxified (MOI ═ 0.2), and at 0hpi (non-detoxified Control), 4hpi, 8hpi and 12hpi (since wild-type IBDS-2 cells gradually disintegrated due to CPE and the integrity of the cells was destroyed under the poisoning condition, and thus no intact intracellular RNA was found, the present study, when relatively quantitative Q-PCR was used for detecting FMDV RNA, was only performed at a time point before 12hpi infection of cells), the cell culture medium was discarded, the cells were washed once with PBS, the total RNA was extracted and reverse transcribed, the dye method relatively quantitative PCR was used for detecting the amount of FMDV RNA relative to GAFMDV mRNA in the cells, and each time point was repeated as three primers (SEQ ID: 3. qDV, 3. ID: 596. for each cell amplification, three primers: SEQ ID 3: 3. for FMDV, 3. the present study, was performed by 12. hpI, and the present study, and the : GCGAGTCCTGCCACGGA (shown in SEQ ID NO. 7); GAPDH qF: ACTGAGGACCAGGTTGTGT (shown in SEQ ID NO. 8); GAPDH qR: AGGAAATGAGCTTGACGAAGTG (SEQ ID NO. 9)), and the results are shown in FIG. 3, in which the viral FMDV RNA was gradually increased over time in wild-type IBRS-2 cells and Control library cells, whereas FMDV RNA was not detected in TOB1-KOs (TOB1-KO1 and TOB1-KO 2). The result shows that the monoclonal cell line TOB1-KOs with the loss of the function of the TOB1 gene can obviously inhibit the replication of FMDV virus and has FMDV resistance phenotype; although the method is exemplified by an IBRS-2 cell, due to the high homology (> 90%) of the TOB1 gene in the cells of animals of the order artiodactyla, which includes at least Bovidae and swine (Suidae) animals, it is also possible to construct FMDV-resistant host cells by knocking out the TOB1 gene in the cells of other animals of the order artiodactyla.

3, detecting the content of intracellular viral protein after the TOB1-KOs is subjected to FMDV challenge

After FMDV infects a cell, it undergoes both transcription and replication of the genome and synthesis of viral proteins to assemble progeny virus for larger-scale infection. The research respectively adopts an indirect immunofluorescence staining technology and Western blotting to detect the content of FMDV protein in cells after FMDV challenge by TOB1-KOs (TOB1-KO1 and TOB1-KO 2).

After counting cells, the same amount of wild-type IBRS-2 cells and TOB1-KO1 were taken and simultaneously FMDV a/GDMM was detoxified (MOI ═ 0.2), cell culture media were discarded at 4hpi, 8hpi and 12hpi, respectively, and viral proteins were subjected to indirect immunofluorescence staining, and the staining results were observed under a confocal fluorescence microscope to detect viral proteins in the cells, as shown in fig. 4, where blue is the result of nuclear staining and red is the result of FMDV capsid protein staining. The results show that viral FMDV capsid protein increases gradually over time in wild-type IBDS-2 cells, whereas FMDV capsid protein is not detectable in TOB1-KO 1. The cell culture medium was discarded and the cells were washed once with PBS after 0hpi (non-challenge Control), 4hpi, 8hpi and 12hpi, respectively, total cell protein was extracted and viral protein was detected by Western blotting, as shown in FIG. 5, and viral protein was detected after wild-type IBRS-2 cells and Control library infected with FMDV 12hpi, but was not detected in TOB1-KO1 at all times. The result shows that the monoclonal cell line TOB1-KOs with the loss of the function of the TOB1 gene can obviously inhibit the replication of FMDV virus and has FMDV resistance phenotype; although the method is exemplified by an IBRS-2 cell, due to the high homology (> 90%) of the TOB1 gene in the cells of animals of the order artiodactyla, which includes at least Bovidae and swine (Suidae) animals, it is also possible to construct FMDV-resistant host cells by knocking out the TOB1 gene in the cells of other animals of the order artiodactyla.

Example 3 determination of cell morphology and cell viability of TOB1-KOs after FMDV challenge

Cell morphology of TOB1-KOs after FMDV challenge

After counting the cells, taking the same amount of wild-type IBRS-2 cells, Control library and 2 strains of TOB1-KOs (TOB1-KO1 and TOB1-KO2) and FMDV A/GDMM virus challenge (MOI is 0.2), when each group of cells is subjected to FMDV virus challenge, reserving cells of a culture dish as a Control (Mock), changing serum-free DMEM culture medium when FMDV virus challenge is carried out on the experimental group, observing and recording cytopathic conditions of the cells by an EVOS cell imager at 12hpi and 24hpi respectively, and finally, as shown in FIG. 6, the wild-type IBRS-2 cells and the Control library are infected by FMDV to generate early CPE, and part of the cells are changed from irregular polygonal adherent morphology into circular shapes; the cell morphology of TOB1-KOs (TOB1-KO1 and TOB1-KO2) is not affected by FMDV challenge, and the normal cell morphology is still maintained; after 24hpi of virus attack, the wild type IBDS-2 cells and Control library FMDV cells are disintegrated due to FMDV infection, most of the cells are completely shed from irregular polygonal adherent morphology to be round and float in a cell culture medium, and the cell morphology of TOB1-KOs (TOB1-KO1 and TOB1-KO2) is not influenced by FMDV virus attack and still maintains normal cell morphology. And Mock-treated groups of cells maintained normal cell morphology at each time point. Although the method is exemplified by the IBRS-2 cell, because the TOB1 gene in the animal cell of the artiodactyla has high homology (> 90%), the knockout of the TOB1 gene in other animal cells of the artiodactyla can also construct a host cell with FMDV resistance, and the obtained host cell is not affected by FMDV challenge and maintains normal cell morphology, wherein the animal cells of the artiodactyla at least comprise animals of the Bovidae and the Suideae.

2, cell viability detection of TOB1-KOs after FMDV challenge

After counting cells, taking the same amount of wild-type IBRS-2 cells, Control library and 2 strains of TOB1-KOs (TOB1-KO1 and TOB1-KO2) and FMDV A/GDMM virus challenge (MOI is 0.2), when each group of cells is subjected to FMDV virus challenge, reserving cells in a culture dish as a Control (Mock), changing serum-free DMEM culture medium when an experimental group is subjected to FMD virus challenge, detecting cell viability by using a CCK-8 method respectively at 12hpi, 16hpi, 20hpi and 24hpi, repeating each cell at each time point for six times, and counting the ratio of the cell viability of each challenge group to the Control according to the cell viability detection result of each group of cells treated by Mock. As shown in FIG. 7, the cell viability of the wild-type IBRS-2 cells and Control library gradually decreased with the passage of time after challenge, while the cell viability of TOB1-KOs (TOB1-KO1 and TOB1-KO2) was not affected. Although the method is exemplified by the IBRS-2 cell, because the TOB1 gene in the animal cell of the artiodactyla has high homology (> 90%), the knockout of the TOB1 gene in other animal cells of the artiodactyla can also construct a host cell with FMDV resistance, and the obtained host cell is not affected by FMDV challenge and can maintain normal cell viability, wherein the animal cells of the artiodactyla at least comprise animals of the Bovidae and the porcine (Suidee).

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> construction method and application of TOB1 gene knockout monoclonal cell line

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1041

<212> DNA

<213> pig (Sus scrofa)

<400> 1

atgcagcttg aaatccaagt agcactaaat ttcattattt catatctgta caataagctt 60

cccaggagac gtgtcaacat ttttggtgaa gagcttgaaa gacttcttaa gaagaaatat 120

gaagggcact ggtatcctga aaagccatat aaaggatcag ggtttagatg tatacacata 180

ggggagaaag tggacccagt gattgaacaa gcatccaaag agagtggttt ggacattgat 240

gatgttcgtg gcaatctgcc acaggatctt agcgtttgga tcgacccgtt tgaggtttcc 300

taccaaattg gtgaaaaggg accagtgaag gtactttatg tggatgataa taatgaaaat 360

ggatgtgagt tggataagga gatcaaaaac agctttaacc cagaggccca ggtttttatg 420

cccataagtg acccagcctc atcagtgtcc agctctccat cgcctccctt tggtcactct 480

gctgctgtaa gccctacctt catgccccgg tccactcagc ctttaacctt taccactgcc 540

actttcgctg ccaccaagtt cggctctacc aaaatgaaga atagtggccg cagcaacaag 600

gtcgcacgta cttctcctat caacctcggc ttgaatgtga atgacctctt gaagcagaaa 660

gccatctctt cctcaatgca ctctctgtat gggcttggcc tgggtagccc gcagcagccg 720

cagcagcagc agcagccatc ccagccgccg ccgccaccgc caccaccaca gcagcagcag 780

cagcagcaga aaacctctgc cctttctcct aatgccaagg aatttatttt tcctaatatg 840

cagggtcaag gtagtagtac cagtggaatg ttcccaggtg acagccccct taacctcagt 900

cctctccagt acagtaatgc ctttgatgtg ttttcggcct atggaggcct caacgagaag 960

tcttttgtag atggcttgaa ttttagcttg aataacatgc agtattctaa ccagcaattc 1020

cagcctgtta tggctaacta a 1041

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caccgcgttt ggatcgaccc gtttg 25

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaaccaaacg ggtcgatcca aacgc 25

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agcgaaagtg gcagtggtaa aggt 24

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agaaatatga agggcactgg tatc 24

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

actgggtttt acaaacctgt ga 22

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcgagtcctg ccacgga 17

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

actgaggacc aggttgtgt 19

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aggaaatgag cttgacgaag tg 22

Claims (2)

1. A kind ofTOB1A method for constructing a non-human monoclonal cell line deficient in gene function, said method comprising the steps of:

(1) preparation of targetingTOB1A sgRNA double-stranded fragment of a gene, wherein the forward fragment of the sgRNA is 5'-CACCGCGTTTGGATCGACCCGTTTG-3', and the reverse fragment of the sgRNA is 5'-AAACCAAACGGGTCGATCCAAACGC-3';

(2) connecting the double-stranded fragment in the step (1) with a pCRISPR-s4 vector after Bbs I enzyme digestion to obtain a gene targeting vector;

(3) subjecting the product of step (2)Co-transfecting the gene targeting vector with a Cas9 expression plasmid pCRISPR-s10 and a piggyBac transposase expression plasmid pPbase to obtain a host cellTOB1A monoclonal cell line with a loss of gene function.

2. The method of claim 1, wherein the host cell is derived from bovidae (ox: (ll) of the family bovidaeBovidae) Animal, porcine (A) and (B)Suidae) An animal.

Images