CN101560520A - Japanese encephalitis/dengue chimeric virus and application thereof - Google Patents

Abstract

The invention provides a Japanese encephalitis/dengue chimeric virus, which is obtained by replacing a prM/E gene in Japanese encephalitis cDNA clone with the prM/E gene of dengue virus type II. IFA and Western blot confirm that the chimeric virus can express E protein of a dengue virus and can stabilize passage in C6/36 cells. The invention lays a foundation for developing a dengue virus vaccine. The chimeric virus can be taken as a vaccine to immunize animals so as to enable the animals to obtain immune protection against the dengue virus.

Description

Japanese encephalitis/dengue chimeric virus and application thereof

Technical field

The present invention relates to the structure of japanese encephalitis virus (JEV) SA14-14-2 strain full length cDNA clone, the structure of replicon carrier.And the preparation method of Japanese encephalitis/dengue chimeric virus who the primary structure albumen prM/E albumen of encephalitis b virus is replaced to the corresponding protein of dengue virus.

Background technology

It is the widest popular arbovirus in the mankind nowadays that dengue virus (Dengue Virus DV) infects.Dengue virus is propagated by yellow-fever mosquito, nowadays almost in all torrid zones, subtropical zone distribution is arranged all.Estimate that according to WHO the whole world has 25～3,000,000,000 populations to face the danger of infecting dengue virus, annual nearly 5,000 ten thousand to 100,000,000 singapore hemorrhagic fever (Dengue fever DF) case takes place, symptoms such as the high heat of performance, headache, myalgia, arthrodynia and fash; This wherein has 500,000 examples to develop into even more serious dengue hemorrhagic fever (Dengue hemorrhagic fever DHF) and dengue shock syndrome (Dengue shocksyndrome DSS), and annual number because of dengue virus infection death is 2.5 ten thousand.In recent years along with global warming and tourist industry development, the geographic range of its media yellow-fever mosquito constantly enlarges, dengue virus infection is extensively sent out in worldwide, has become one of the widest, that number of the infected maximum, harm the is maximum important arbovirus that distributes in the world.

But, also have many problems of not understanding so far and solving about dengue virus and infection thereof, so that the control of dengue virus infection lacks very effective measure, particularly dengue virus vaccine research does not make substantial progress.Dengue virus has 4 serotypes, and 4 kinds of serotype viruses can cause morbidity.Present studies show that; antibody at a certain serotype of dengue virus does not have long-term provide protection to other serotypes; when infecting special-shaped virus once more; (antibody-dependentenhancement ADE) makes the patient produce even more serious dengue hemorrhagic fever and dengue shock syndrome because antibody relies on enhancement in meeting.So a kind of successful leather vaccine of stepping on must be stepped on leather to 4 types and can both produce protective immunity, can prevent the caused disease of dengue virus infection.WHO has been asserted dengue virus vaccine one of vaccine of first developing.And dengue virus vaccine also is the focus that the various countries scholar pays close attention to always, and nearly over 60 years, the effort that the leather vaccine is stepped in development never stops, and is used for clinical but still do not step on the leather vaccine at present.

Be accompanied by molecular biological develop rapidly, the new approaches that the leather vaccine is stepped in some researchs have been produced, the embedded virus vaccine is exactly wherein a kind of, its thinking is mainly: with a kind of weak viral disease poison is gene skeleton (being carrier), the corresponding gene of the structure gene (goal gene) of another kind virus being replaced vector virus has been built into infective embedded virus, and this embedded virus keeps the original weak malicious characteristic of vector virus and has the viral antigenicity of embedding.Mosaic can be induced stronger humoral immunization and cellular immunization with the form submission protective antigen of live virus.Using at present than successful carrier system in the research of dengue chimeric virus is respectively YF-17D, DEN2PDK-53 and aforesaid rDEN4 Δ 30.

Encephalitis b virus and dengue virus all belong to the member of flaviviridae Flavivirus together, are the sub-thread positive chain RNA virus, and genome is about 11kb, contain a single opening code-reading frame.Sequence in the gene is 5 ' NCR-C-PrM/M-E-NS 1-NS2B-NS3-NS4A-NS4B-NS5-NCR 3 ' in proper order, encode altogether 3 structural protein and 7 Nonstructural Proteins.Wherein the E albumen of E genes encoding is the virus surface envelope glycoprotein, has with cell surface receptor to combine, mediate the film fusion, induces important biomolecules such as producing neutralizing antibody to learn function, is viral most important antigen composition.The PrM/M albumen of PrM genes encoding also is considered to induce the antigenic component that produces neutralizing antibody.Nonstructural gene and non-coding region are main relevant with virus replication and protein translation.Encephalitis b virus SA14-14-2 strain is that encephalitis b virus virulent strain SA14 strain virus is gone down to posterity by suslik kidney monolayer cell long-term cultivation, by plaque screening and continue repeatedly to select had no pathogenicity in the mouse brain, by the go down to posterity stable low virulent strain of not reversion of mouse brain.This attenuated live vaccine has surpassed 200,000,000 in China's accumulative total inoculation number since approval is produced, and has good security.Yet, also encephalitis b virus SA14-14-2 strain is not used to make up the virus vaccines carrier at present, especially for the report that makes up dengue virus vaccine.

Summary of the invention

The objective of the invention is on the basis that makes up JEV SA14-14-2 strain vector system, prM/E gene among the encephalitis cDNA clone is replaced with the prM/E gene of dengue virus, obtain Japanese encephalitis/dengue chimeric virus, the prevention of possible dengue virus provides vaccine safely and effectively for future.

For achieving the above object, but first aspect present invention provides a kind of infective JEV cDNA clone that can generate the JEVRNA transcript of self-replacation, called after pBRF.

PBRF virus replication comprises plasmid vector and JEV SA14-14-2 full-length cDNA genomic clone.By the synthetic JEVRNA transcript of external run-off transcription (run-off transcription) production total length, allos protokaryon or eukaryotic promoter have been increased at the genomic 5 ' end of JEV.These promotors can be T7, CMV etc.Has unique restriction endonuclease sites as transcribing site out of control at the genomic 3 ' end of JEV SA14-14-2 full-length cDNA.

In embodiments of the present invention, JEV SA14-14-2 strain sequence (AF315119) according to the NCBI announcement, by two sections virus genome RNAs that increased of two eclipsed of RT-PCR technical point (comprising 3 ' terminal and 5 ' end), subsequently these two fragment order have been connected among the low copy plasmid pBR322.

For synthetic JEV by external run-off transcription (run-off transcription) production total length

The rna transcription thing has increased the T7 promoter sequence at the genomic 5 ' end of JEV, and it is terminal as transcribing site out of control to make unique restriction endonuclease sites SalI be positioned at genome 3 '.And in order to increase in-vitro transcription efficient, the present invention has increased by two guanylic acid bases (GG) after the T7 promoter sequence.

Transformation for the ease of the JEV carrier, the present invention will be arranged on the JEV genome ns3 gene the 963rd VITAMIN B4 A by site-directed mutagenesis technique and be mutated into thymus pyrimidine T, and therefore obtain the restriction endonuclease sites KpnI of a uniqueness in the JEV genome.

A second aspect of the present invention, replicon carrier based on above-mentioned replicon is provided, the proteic all or part of nucleic acid of the coding prM/E of replicon replaces with multiple clone site, and described part nucleotide sequence is meant coding proteic full sequence of prM and the proteic most of sequence of coding E.

In embodiments of the present invention, specifically having made up two can self-replacation and can express the JEV replicon carrier of yellow fluorescence protein (YFP), called after pFull Δ prM/E and pPartial Δ prM/E respectively.

Described replicon pFull Δ prM/E has lacked the proteic whole encoding sequences of prM/E of JEV fully, and has added multiple clone site (MCS) sequence that makes things convenient for exogenous gene cloning in the corresponding position.Multiple clone site is for holding 3 ' end to be followed successively by from 5 ': Age I, BSSH II, Xho I, XmaI.The sequence of pFull Δ prM/E such as SEQ ID NO1.Described replicon pPartial Δ prM/E has lacked the proteic proteic most encoding sequences of E that all reach of prM fully, has kept 71 amino acid coding of E PROTEIN C end.Because the contriver considers that this part sequence may be influential to the proteic expression of NS1.Equally, also added MCS sequence as replicon pFull Δ prM/E in the corresponding position.The sequence of pPartial Δ prM/E is shown in SEQ ID NO2.The in-vitro transcription RNA of above-mentioned two replicons all has the of self-replication capacity through real-time PCR experiment confirm in the BHK-21 cell.

Further, the present invention adopts conventional Protocols in Molecular Biology to insert the YFP reporter gene between the Age of above-mentioned two replicon carriers I and Xma I, and the YFP albumen in verified two replicon carriers has all obtained expression.

A third aspect of the present invention, Japanese encephalitis/dengue chimeric virus based on the JEV replicon carrier is provided, it is that the proteic all or part of nucleic acid of the coding prM/E of replicon is replaced with the proteic all or part of nucleotide sequence of dengue virus coding prM/E, or at the proteic all or part of nucleotide sequence of the multiple clone site insertion dengue virus coding prM/E of described replicon carrier, described part nucleotide sequence is meant coding proteic full sequence of prM and the proteic most of sequence of coding E.

In embodiments of the present invention, two strain embedded viruses have been made up, respectively called after JED ₂V and JEED ₂1770V.

The embodiment of the invention adopts the RT-PCR technology to obtain the prM/E protein coding gene sequence of dengue virus 2 types (DV2) NGC strain.Between the Age I of above-mentioned pFull Δ prM/E replicon and XmaI, insert the prM/E protein coding gene of (DV2) NGC strain fully, make up mosaic clone pJEN-prM/E.Virus gene sequence among the pJEN-prM/E is shown in SEQ ID NO3.Between the AgeI of above-mentioned pPartial Δ prM/E replicon and Xma I, insert 71 amino acid whose prM/E protein coding gene sequences of intercepting E PROTEIN C end of (DV2) NGC strain, made up mosaic clone pJEE-1770.Virus gene sequence among the pJEE-1770 is shown in SEQ ID NO4.

Above-mentioned two mosaics clone's in-vitro transcription RNA can pack out Japanese encephalitis/dengue chimeric virus JED in the BHK-21 cell ₂V and JEED ₂1770V.Described two strain embedded viruses confirm to express the E albumen of dengue virus through IFA and Western blot, and confirm to have chimeric nucleic acid through RT-PCR.And two strain embedded viruses all can be stablized in the C6/36 cell and go down to posterity.

Embedded virus of the present invention confirms to express the E albumen of dengue virus through IFA and Western blot, and can stablize in the C6/36 cell and go down to posterity, and behind the immune Balb/c mouse of two strain embedded viruses, can produce the proteic special IgG antibody of anti-DV2E.The present invention lays a good foundation for the dengue virus vaccine development.

Restriction enzyme site unique among the present invention is meant that the recognition sequence of this restriction enzyme site on certain nucleotide sequence is unique.

Description of drawings

Fig. 1 a is the stability experiment result of plasmid pBRF in E.coli DH5 α who contains the JEV full-length gene, 19329,7743,6223,4254,3472,2690,1882,1489,925,421 wherein: M1 is DNAmarker λ-EcoT14 (is followed successively by from top to bottom:, 74bp), 23130,9416,6557,4361,2322,2027,564 M2 is DNA marker λ-HindIII (is followed successively by from top to bottom:, 125bp), 1,2,3,4,5,6,7,8,9,10 be 1～10 generation plasmid.

Fig. 1 b is the stability experiment result of plasmid pBRF in E.coliXL10-Gold who contains the JEV full-length gene, 23130,9416,6557,4361,2322,2027,564 wherein: M1 is DNA marker λ-HindIII (is followed successively by from top to bottom:, 125bp), 19329,7743,6223,4254,3472,2690,1882,1489,925,421 M2 is DNA marker λ-EcoT14 (is followed successively by from top to bottom:, 74bp), 1,2,3,4,5,6,7,8,9,10 be 1～10 generation plasmid.

Fig. 1 C is the stability experiment result of plasmid pBRF in E.coliXL1-Blue who contains the JEV full-length gene, 19329,7743,6223,4254,3472,2690,1882,1489,925,421 wherein: M is DNAmarker λ-EcoT14 (is followed successively by from top to bottom:, 74bp), 1,2,3,4,5,6,7,8,9,10 be 1～10 generation plasmid.

Fig. 2 is Sf and the segmental policy map of Sp that amplification makes up the JEV replicon carrier.

Fig. 3 a is the flow cytometer detection figure behind the pJEfull-YFP RNA transfection BHK-21 cell.

Fig. 3 b is the flow cytometer detection figure behind the pJEpartial-YFP RNA transfection BHK-21 cell.

Fig. 4 a is JED ₂V and JEED ₂1770V is to the pathology effect figure of BHK-21 cell.Wherein, A is normal BHK-21 cell, and B is JED ₂V infected B HK-21 cell, C is JEED ₂1770V infected B HK-21 cell, D are JEV infected B HK-21 cells, and D is a DV2 infected B HK-21 cell.

Fig. 4 b is JED ₂V and JEED ₂1770V is to the pathology effect figure of C6/36 cell.Wherein, A is normal C6/36 cell, and B is JED ₂The C6/36 cell that V infects, C is JEED ₂The C6/36 cell that 1770V infects, D are the C6/36 cells that JEV infects, and D is the C6/36 cell that DV2 infects.

Fig. 5 is JED ₂V and JEED ₂The identified by immunofluorescence figure of 1770V.A, B, C, D are respectively JED ₂V, JEED ₂The reaction result of C6/36 cell that 1770V, JEV infect and normal C6/36 cell and reorganization DV2EIII albumen rabbit immune serum.

Fig. 6 is JED ₂V and JEED ₂The westorn-blot of 1770V identifies figure.Wherein, M is molecular weight of albumen marker, and 1,2,3,4 is respectively JED ₂V, JEED ₂The reaction result of the C6/36 cell of 1770V, DV2, infection and normal C6/36 cell and reorganization DV2EIII albumen rabbit immune serum.

Fig. 7 is with JED ₂V, JEED ₂After 1770V, JEV, DV2,1640 kept around the liquid immunity Balb/C mouse, each organized the anti-DV2E protein I of mouse serum gG detected result relatively.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

The structure of embodiment 1:JEV full length cDNA clone

One, the cultivation of JEV SA14-14-2 strain and cell total rna extract

JEV SA14-14-2 strain is Chengdu Inst. of Biological Products's product, goes down to posterity in this chamber to cultivate to be no more than for 3 generations.JEV SA14-14-2 seed culture of viruses liquid is inoculated in the adherent BKH-21 cell that covers with (U.S. Stratagene), treats that cytopathy reaches ++ +～++ ++ the time, adopt Trizol reagent method to extract cell total rna.

LS Reagent is an American I nvitrogen company product.

Two, the JEV cDNA of total length is incorporated among the plasmid pBR322 JEV cDNA clone of preparation total length

Adopt ThermoScript ^TMRT-PCR System (American I nvitrogen) is with synthetic cDNA first chain of JEV RNA reverse transcription.Adopt Elongase Amplification System (American I nvitrogen) to divide two sections full genomes of amplification JEV (the sub-called after U of 5 ' end half point fragment, the sub-called after L of 3 ' end half point fragment).The segmental primer of amplification U is: upstream primer: 5 '-CG GAATTCTAATACGACTCACTATAGGAGAAGTTTATCTGTGTGAACTTCTTGGCTTA-3 ' (the EcoR I restriction enzyme site of underscore for introducing, italic is the T7 promoter sequence, immediately following two guanylic acid bases with increase transcribe efficient thereafter), downstream primer is: 5 '-AAA GGATCCGT GGTACC(underscore is BamH I and Kpn I restriction enzyme site to AGGCGGGGTCGCTGTCATA-3 '.Wherein BamH I carries for the JEV genome, and Kpn I is that rite-directed mutagenesis obtains).The segmental primer of amplification L is: upstream primer: 5 '-GCCATCTTTATGACAGCGAC-3 ', downstream primer is: 5 ' CG GTCGACAGATCCTGTGTTCTTCCTCACCACCACGTACATACT-3 ' (the Sal I restriction enzyme site of underscore) for introducing.Above-mentioned U fragment and L fragment are connected to pGEM-T Easy Vector Systems (U.S. Promaga) obtain two kinds of positive colony pGEMT-U plasmids and pGEMT-L plasmid.With pGEMT-U plasmid EcoR I and BamH I double digestion, reclaiming molecular weight is the fragment band of 5.6kb size, be inserted between the EcoR I and BamH I restriction enzyme site of pBR322 carrier (Chinese magnificent company), identify the positive middle clone pBRU plasmid of acquisition through EcoR I and BamH I double digestion.The pGEMT-L plasmid with BamH I and Sal I double digestion, is reclaimed the fragment band that molecular weight is about the 5.4kb size, be inserted between the BamH I and Sal I restriction enzyme site of pBRU plasmid, cut evaluation, obtain JEV full length cDNA clone pBRF through enzyme.

Three, the stability experiment of JEV full length cDNA clone pBRF in intestinal bacteria

PBRF plasmid difference Transformed E .coli DH5 α, XL1-Blue, XL10-Gold three kinds of competent cells such as (being U.S. Stratagene company product) that will contain the JEV full length cDNA clone, the inoculation of picking mono-clonal contains antibiotic LB substratum and carried out 37 ℃ of shaking culture 12 hours, and carry out continuous passage respectively, passed for 10 generations altogether.Go down to posterity at every turn and adopt 10 ⁴Extension rate, the incubation time that goes down to posterity are 12 hours, and each is for preparing plasmid DNA in a small amount, and agarose gel electrophoresis detects.The result shows that the pBRF plasmid can be stablized and goes down to posterity and the large fragment deletion of molecule does not take place in the XL1-Blue bacterial strain.The result is shown in Fig. 1 a, Fig. 1 b, Fig. 1 c.

The structure and the evaluation of embodiment 2:JEV replicon

One, the structure of JEV replicon

On above-mentioned JEV full length cDNA clone pBRF basis, with structural protein gene PrM/E disappearance, replace the multiple clone site that makes things convenient for exogenous gene cloning (multiple clone site, MCS).Multiple clone site selection principle: after the prM/E sequence of the complete sequence of multianalysis plasmid pBR322 and JEV SA14-14-2 strain, DV2NGC strain, not produce frameshit is principle, and selection cutting sequence is that Age I, BSSH II, Xho I, the Xma I of 6 bases is multiple clone site.The restriction enzyme site analysis software is the SeqBuilder module among the Lasergene.For fear of the lethality deletion, made up two replicons simultaneously, one for lacking the PrM/E gene fully; One keeps E gene C end 213bp, because the contriver considers that this part sequence may be significant with processing to the correct expression of NS1.

As shown in Figure 2, be template with JEV cDNA, with upstream primer: 5 '-AGGAGGGCCCGGTAAAAACC-3 ' and downstream primer: 5 '-cccgggctcgaggcgcgcaccggtGGCTCCTGCACAAGCTATG-3 ' (small letter is the MCS sequence) amplification S1 fragment; Upstream primer: 5 '-accggtgcgcgcctcgagcccgggGACACTGGATGTGCCATTGAC-3 ' (small letter is the MCS sequence) and downstream primer: 5 '-AAAGGATCCGTGGTACCAGGCGGGGTCGCTGTCATA-3 ' amplification S2 fragment, upstream primer: 5 '-accggtgcgcgcctcgagcccgggATTGGAGGGGTCTTCAACTC-3 ' (small letter is the MCS sequence) and downstream primer: 5 '-AAAGGATCCGTGGTACCAGGCGGGGTCGCTGTCATA-3 ' amplification S3 fragment, adopt the method amplification of merging PCR to transform the respective segments Sf and the Sp of carrier.Sf and Sp cut rear clone through Apa I and Kpn I enzyme and go in the pBRF that same enzyme is cut, the JEV replicon carrier plasmid of acquisition, called after pFull Δ prM/E and pPartial Δ prM/E respectively.The evaluation of cutting and check order of plasmid enzyme after preparation in a small amount.

Two, the preparation of JEV replicon in-vitro transcription thing RNA

As previously mentioned, the Sal I restriction enzyme site that is positioned at JEV replicon gene 3 ' end is the site out of control of in-vitro transcription.Therefore, earlier with plasmid pFull Δ prM/E and pPartial Δ prM/E through Sal I linearizing and purifying (purifying adopts Chinese T IANGEN gel Midi Purification Kit), adopt the RIBOMAX large scale RNA production system of Promega to prepare in-vitro transcription RNA.The preparation of 100 μ l reaction systems: 5 * transcript buffer, 20 μ l, rNTPs 30 μ l (rATP 25mM, rCTP25mM, rUTP 25mM, rGTP 8.33mM), m7G cap 5 μ l, enzemy mix (T7) 10 μ l, linearization plasmid 35 μ l (15～25ng/ μ l).Reaction system in 37 ℃ hatch 4h after, add 2 μ lDNAase and hatch 20min in 37 ℃.The in-vitro transcription thing adopts the RNeasyMini Kit purifying of QIAGEN company, and quantitatively the back packing is stored in-70 ℃.

Three, the self-replicating ability of Real-time PCR checking JEV replicon

Above-mentioned in-vitro transcription thing is by go down to posterity BHK-21 cell in 6 orifice plates of the dosage transfection in 4 μ g/ holes, and transfection method is that electricity changes, and electricity changes parameter and is: 850v, and 25uF, the resistance infinity shocks by electricity 2 times.24h, 48h, 72h, 96h harvested cell, the synthetic cDNA of reverse transcription adopt the platinum SYBR Green qPCR SuperMix-UDG of Invitrogen company to carry out Real-time PCR after transfection.

With GAPDH is the internal reference gene, with after 100 times of the cDNA dilutions as template, according to platinum SYBR Green qPCR SuperMix-UDG test kit specification sheets configuration PCR system.The PCR reaction system: PCR mix12.5 μ l, each 0.5 μ l of the upstream and downstream primer of 10 μ mol/L, cDNA (having diluted 100 times) 1 μ l, RNase-free water complement is long-pending to 20 μ l.The primer of amplification internal control gene GAPDH is: upstream primer 5 '-AAGGTGAAGGTCGGAGTCAACG-3 '; Downstream primer 5 '-GTCCCTGGAAGATGGTGATGG-3 '.The specific gene amplimer is: upstream primer 5 '-AGTGAAGAGGGTAGTAATGAG-3 '; Downstream primer 5 '-CCAAGTTCTCGTTTGAAACTA-3 '.Carry out Real-time PCR experiment at the IQ5 instrument.Every pipe PCR reaction triplicate.

The Ct value that reaction obtains through PCR is according to formula Δ Δ Ct=(Ct.Target-Ct.GAPDH) TX-(Ct.Target-Ct.GAPDH) _T0(Target represents candidate gene, and GAPDH is an internal control gene), Tx represents random time point, T ₀The expression control point) calculates gene is compared the Ct value with control cells in the different periods changing value Δ Δ Ct.When Δ Δ Ct was negative value, expression genetic expression was risen, Δ Δ Ct be on the occasion of the time, expression genetic expression decline.Equal 2 according to changing multiple ^{| Δ Δ Ct|}Obtain the multiple of changes in gene expression.

The result as shown in Table 1 and Table 2, RNA has in time to be increased and ever-increasing trend shows that the encephalitis b virus replicon of structure has the self-replicating ability.

Table 1 pFull Δ prM/E RNA Real-time PCR interpretation of result

Period	Ct.target-Ct.GAPDH	ΔΔCt	2 |ΔΔCt|	Rise or descend
					24h	7.98	/	/	/
48h	5.36	-2.62	6.15	↑
					72h	5.13	-0.23	1.17	↑
96h	-0.21	-5.34	40.50	↑

Table 2 pPartial Δ prM/E RNA Real-time PCR interpretation of result

Period	Ct.target-Ct.GAPDH	ΔΔCt	2 |ΔΔCt|	Rise or descend
					24h	8.94	/	/	/
48h	7.75	-1.49	2.81	↑
					72h	7.35	-0.40	1.32	↑
96h	3.66	-3.69	12.91	↑

Four, the JEV replicon is identified the ability to express of foreign protein

With the plasmid PCDNA6.2/C-YFP-GW/TOPO (invitrogen company) that contains reporter gene YFP) be template, 5 ' AccggtAtggtgagcaagggc-3 ' (the Age I restriction enzyme site of underscore) and 5 ' for introducing- CccgggCttgtacagctggtc-3 ' (the Xma I restriction enzyme site of underscore for introducing) is a primer, employing Invitrogen company

Taq DNA Polymerase High Fidelity amplification YFP gene.The gene fragment that obtains is cut through Age I and Xma I enzyme, carries out ligation with pFull Δ prM/E that cuts through same enzyme and pPartial Δ prM/E, connects product transformed into escherichia coli XL1-Blue, and plasmid is through the evaluation of cutting and check order of preparation back employing enzyme in a small amount.The plasmid called after pJEfull-YFP and the pJEpartial-YFP that make up.

PJEfull-YFP and pJEpartial-YFP are through behind Sal I linearizing and purifying, and in-vitro transcription obtains RNA.RNA is with go down to posterity BHK-21 cell in 6 orifice plates of the dosage in 4 μ g/ holes electric shock transfection.24h, 48h, 72h, 96h observe the YFP expression down in fluorescent microscope after transfection.Collect the capable flow cytometer of corresponding period cell simultaneously and detect, understand the positive cell rate of expressing YFP.Establish the negative contrast of normal BHK-21 cell simultaneously.

The result shows, in being inverted under the fluoroscope, transfection the BHK-21 cell of pJEfull-YFP RNA and pJEpartial-YFPRNA all can behind 24h, observe lasting enhanced fluorescent signal.The flow cytometer detected result shows that also the cell positive rate of express fluorescent protein all is the trend that increases gradually.The positive cell rate of different periods is respectively after the pJEfull-YFP RNA transfection: 3.0%, 5.8%, 6.9%, 13.9% (Fig. 3 a); That pJEpartial-YFP RNA is 4.1%, 7.1%, 7.9%, 15.6% (Fig. 3 b).

Embodiment 3: the preparation and the evaluation of encephalitis/step on leather 2 type embedded viruses

One, encephalitis/step on leather 2 type mosaics clone's structure

CDNA is a template with DV2 virus, adopt the RT-PCR technology to obtain DV2 (NGC strain, CDC virus disease institute) prM/E full-length gene (DV2-prM/E, 1983bp) and intercepted the gene fragment of prM/E gene 3 ' end 213nt (DV2-1770 1770bp) (adopts the Platinum Pfx archaeal dna polymerase amplification of Invitrogen company).The primer of amplification DV2-prM/E is: upstream primer 5 ' AccggtTTCCATTTAACC ACA-3 ' (underscore is the Age I restriction enzyme site for introducing), downstream primer 5 '- CccgggGGCCTGCACCATGAC-3 (the Xma I restriction enzyme site of underscore) for introducing; The primer of amplification DV2-1770 is: upstream primer is 5 '- AccggtTTCCATTTAACCACA-3 ' (underscore is the Age I restriction enzyme site for introducing), downstream primer be 5 '- CcccgggGGATCCAAAATCCCAAGCTG-3 ' (the Xma I restriction enzyme site of underscore) for introducing.Behind Age I and Xma I double digestion, reclaim the purpose fragment, be connected, connect product transformed into escherichia coli XL1-blue with pFull Δ prM/E that cuts through same enzyme and pPartial Δ prM/E orientation.Prepare in a small amount behind the plasmid and further through enzyme evaluations of cutting and check order, the recombinant plasmid of acquisition is distinguished called after pJEN-prM/E and pJEE-1770.DV2 gene order among the pJEN-prM/E is shown in SEQ IDNO3, and the DV2 gene order among the pJEE-1770 is shown in SEQ ID NO4.

Two, the preparation of mosaic in-vitro transcription thing RNA

Plasmid pJEN-prM/E and pJEE-1770 adopt the RIBOMAX large scale RNA production system of Promega to prepare in-vitro transcription RNA behind Sal I linearizing and purifying.The preparation of 100 μ l reaction systems: 5 * transcript buffer, 20 μ l, rNTPs 30 μ l (rATP25mM, rCTP 25mM, rUTP 25mM, rGTP 8.33mM), m7G cap 5ul, enzemymix (T7) 10 μ l, linearization plasmid 35 μ l (15～25ng/ μ l).Reaction system in 37 ℃ hatch 4h after, add 2 μ l DNAase and hatch 20min in 37 ℃, with the digestion template DNA.The in-vitro transcription thing adopts the RNeasy Mini Kit purifying of QIAGEN company, and quantitatively the back packing is stored in-70 ℃.

Three, encephalitis/step on leather 2 rescues of type embedded virus in the BHK-21 cell

Will be in the T25 square vase the adherent BHK-21 cell that covers with 10% trysinization, with the DMEM nutrient solution re-suspended cell that contains 10%FBS, the centrifugal 5min of 400g; Wash cell twice with aseptic cold PBS, cell is resuspended among the 400ulPBS, behind adding 10ug in-vitro transcription RNA and the abundant mixing, on Biorad Gene Pulser, carry out electricity immediately and change.Electricity changes parameter: twice of voltage 850v, electric capacity 25uF, resistance ∞, pulse.Cell after the electric shock is placed 5min on ice, change over to immediately and add 2.5ml in advance and contain in six orifice plates of DMEM nutrient solution of 10%FBS, 37 ℃ of cultivations are changed liquid once behind the cell attachment.If the negative contrast of normal bhk cell through electric shock.Day by day observation of cell form.

The result shows, behind the in-vitro transcription thing transfection BHK-21 cell of pJEN-prM/E and pJEE-1770, can be observed typical CPE, show as cell rounding, come off in 5～7 days, similar to DV2 and JEV to the pathology effect of BHK-21 cell, and negative control cell does not have pathology.The results are shown in Figure 4a.With cell that CPE occurs together with supernatant multigelation 3 times after, the centrifugal 5min of 4000rpm, the results supernatant is preserved as seed culture of viruses.The embedded virus called after JED that obtains ₂V and JEED ₂1770V.Four, the cultivation of going down to posterity of encephalitis/step on leather 2 type embedded viruses

Get above-mentioned JED ₂V and JEED ₂1770V seed culture of viruses supernatant 0.5ml is inoculated in bhk cell and the C6/36 cell that passes in the T25 square vase respectively, and behind 37 ℃ and 28 ℃ absorption 1h, add the cell maintenance medium that contains 2%FBS and continue to cultivate, and observation of cell form day by day.JED as a result ₂V and JEED ₂In 1770V 5 generations of blind passage in the BHK-21 cell, all can not detect virus.And the embedded virus JED that in the C6/36 cell, cultivates ₂V and JED ₂1770V can make cell typical cytopathic occur in about 4 days in infection, shows as the swelling and the gathering of cell, and is similar to the pathology effect of C6/36 cell to DV2 and JEV, but the buildup effect degree of pair cell is not as good as two parent's strain.The results are shown in Figure 4b.

Five, the RT-PCR of encephalitis/step on leather 2 type embedded viruses identifies

Get and inoculated s-generation JED ₂V and JED ₂1770V also the C6/36 cell of CPE occurs, carries the synthetic cDNA of RNA and reverse transcription.With this cDNA is template, carry out pcr amplification at the zone design primer that is positioned at beyond the embedded virus prM/E gene, upstream primer is 5 '-CGAGAACTTGGAACACTCATTGACG-3 ', downstream primer is 5 '-GCGCTTTGTGGACGATCTTCGCTAG-3 ', and amplified production send order-checking after 1% agarose gel electrophoresis purifying reclaims.

The two fragment about 2100bp that all increases as a result.With the negative contrast of RNA before the transfection, do not diffuse into the purpose band, show that dna profiling has digested fully.With this sequencing fragment, comparison result is found to be the mosaic gene of DV2prM/E gene and JEV C and NS1.The genetic marker site that the Age I that introduces when making up the mosaic clone and two restriction enzyme sites of Xma I also can be used as embedded virus, sequencing result has all detected this two marks.

Six, the indirect immunofluorescence of encephalitis/step on leather 2 type embedded viruses is identified

Get and inoculated JED ₂V and JED ₂1770V also the cell of CPE occurs, cell is blown down the back wash 2 times with PBS.Cell is resuspended among the PBS, preparation antigen sheet, and cold acetone is 15min fixedly.Rabbit anteserum with DV2 reorganization EIII protein immunization is one anti-(1: 200), and the goat-anti rabbit anteserum of FITC mark is two anti-(1: 100; U.S. Sigma), fluorescent microscope is observed the antigen sheet down.The result can observe specific fluorescence under fluorescent microscope, C6/36 cell that JEV infects and normal C6/36 cell be not rabbit anteserum reaction therewith all.JED ₂V and JED ₂The C6/36 cell that 1770V infects does not react with normal rabbit serum yet.The results are shown in Figure 5.

Seven, the western-blot of encephalitis/step on leather 2 type embedded viruses identifies

Add lysis liquid in having inoculated JED2V and JED21770V and having occurred placing 30min on ice in the cell of CPE.Get 40 μ l and add 10 μ l, 5 * protein loading buffer, boil 3min.The centrifugal 10min of 12000rpm gets the capable SDS-PAGE electrophoresis of supernatant, through half-dried electric commentaries on classics method, albumen is transferred on the PDVF film, rabbit anteserum with DV2 reorganization EIII protein immunization is one anti-(1: 200), and the goat-anti rabbit anteserum of HRP mark is two anti-(1: 2000 U.S. Sigma), the DAB colour developing.With the positive contrast of C6/36 cell pyrolysis liquid that DV2 infects, the normal negative contrast of C6/36 cell, the result is except that negative control, and is consistent with expection in the equal bands visible in 60KD place, sees Fig. 6.Eight, the immunogenicity experiments of encephalitis/step on leather 2 type embedded viruses

(1) immunogenic preparation

Be harvested from cultivate in the C6/36 cell the 4th generation the embedded virus supernatant, cross the 0.45um filter membrane.Adopt the TCID50 experiment to determine virus titer, adopt the RPMI-1640 nutrient solution that contains 1%FBS that virus titer is adjusted to 10 ⁵Standby.The DV2 and the JEV virus liquid that prepare identical titre with method.

(2) laboratory animal and grouping

25 of healthy Balb/C female mices are provided by the Chinese Academy of Medical Sciences, China Concord Medical Science University institute of lab animals.Laboratory animal is divided into 5 groups (5/group) at random: (1) JED2V immune group; (2) JED21770V immune group; (3) DV2 immune group; (4) JEV immune group; (5) negative control group (the RPMI-1640 nutrient solution that contains 1%FBS).

(3) immunization protocol

Get above-mentioned seed culture of viruses liquid and negative control nutrient solution, fully behind the mixing,, only inoculate mouse by 200ul/ with the abdominal injection approach.The 4th week of immunity back is put to death mouse, collects carotid artery blood, and separation of serum is standby.

(4) ELISA detects the anti-DV2E protein antibodies of serum

1) antigen coated: the DV2EIII albumen with the prokaryotic expression purifying is antigen, adds in 96 orifice plates by the 100ng/ hole, and 4 ℃ are spent the night, and PBST washes plate 3 times;

2) every hole adds 5% skimmed milk of the aseptic PBS preparation of 300ul, 37 ℃ of sealing 2h, and PBST washes plate 3 times;

3) mice serum collected is diluted with 5% skimmed milk, since 1: 100, make 2 times of serial dilutions, add in 96 orifice plates by the 100ul/ hole, hatch 1h for 37 ℃, PBST washes plate 6 times;

4) adding two resists: by dilution in 1: 500,1h was hatched for 37 ℃ in the 100ul/ hole to the sheep anti-mouse igg of HRP mark with 5% skimmed milk, and PBST washes plate 6 times;

5) colour developing: add substrate A liquid, the every hole 50ul of B liquid, lucifuge is placed 10min.2N H ₂SO ₄The 50ul termination reaction.

6) microplate reader detects A ₄₅₀

(5) neutralization test detects the neutralization activity of serum

1), treats that cell grows to individual layer with BHK-21 passage to 96 orifice plate;

2) with the mouse immune serum collected in 56 ℃ of deactivation 30min, cross the 0.45um filter membrane;

3) with inactivated serum with keeping liquid since 1: 8, make 2 times of doubling dilutions, mixed 37 ℃ of incubation 1h by 1: 1 with the DV2 of 100TCID50;

4) nutrient solution in sucking-off 96 orifice plates is washed 1 time with keeping liquid;

5) press in the adding of 200ul/ hole and serum, each extent of dilution is done 4 multiple holes;

6) 37 ℃, 5%CO ₂Condition is cultivated, and observes pathology day by day, observes altogether 7 days.

7) with four multiple Kong Jun do not occur observable cytopathic serum dilution as antibody neutralization tire.

The result shows, each extent of dilution OD of the mouse serum of embedded virus and DV2 immunity ₄₅₀All be higher than JEV immune group and negative control group (P＜0.05), embedded virus immunity Balb/C mouse is described after, can produce special anti-DV2E protein I gG antibody.Specifically see Table 3 and Fig. 7.The serum antibody titer of Balb/C mouse after the two strain embedded virus immunity is answered about 1: 10.Specifically see Table 4.

Table 3 is respectively organized mouse anti DV2E protein I gG detected result

Group	1∶100	1∶200	1∶400	1∶800
					JED 2V	0.5267±0.1127	0.2276±0.0517	0.1278±0.02969	0.0905±0.0151
JED 21770V	0.5585±0.2694	0.2421±0.1372	0.1352±0.0642	0.0982±0.0288
					DV2	0.7499±0.0834	0.3083±0.0357	0.2018±0.0226	0.1209±0.0221
JEV	0.1255±0.0193	0.0692±0.0082	0.0496±0.0009	0.0354±0.0030
					Negative control	0.1368±0.0407	0.0824±0.0074	0.0476±0.0067	0.0398±0.0085

Table 4 is respectively organized mice serum NAT detected result

Annotate: data are expressed as in the table: the number of animals/actual detected number of animals that reaches certain antibody titer.

Sequence table

＜110〉CDC virus disease institute

＜120〉Japanese encephalitis/dengue chimeric virus and application thereof

<130>KHP09112373.6

<160>26

<170>PatentIn version 3.5

<210>1

<211>9019

<212>DNA

＜213〉artificial sequence

<400>1

taatacgact cactatagga gaagtttatc tgtgtgaact tcttggctta gtatcgtaga 60

gaagaatcga gagattagtg cagtttaaac agttttttag aacggaagat aaccatgact 120

aaaaaaccag gagggcccgg taaaaaccga gctatcaata tgctgaaacg cggcctaccc 180

cgcgtattcc cactagtggg agtgaagagg gtagtaatga gcttgttgga cggcagaggg 240

ccagtacgtt tcgtgctggc tcttatcacg ttcttcaagt ttacagcatt agccccgacc 300

aaggcgcttt caggccgatg gaaagcagtg gaaaagagtg tggcaatgaa acatcttact 360

agtttcaaac gagaacttgg aacactcatt gacgccgtga acaagcgggg cagaaagcaa 420

aacaaaagag gaggaaatga aggctcaatc atgtggctcg cgagcttggc agttgtcata 480

gcttgtgcag gagccaccgg tgcgcgcctc gagcccgggg acactggatg tgccattgac 540

atcacgagaa aagagatgag atgtggaagt ggcatcttcg tgcacaacga cgtggaagcc 600

tgggtggata ggtataaata tttgccagaa acgcccagat ccctagcgaa gatcgtccac 660

aaagcgcaca aggaaggcgt gtgcggagtc agatctgtca ctagactgga gcaccaaatg 720

tgggaagccg taagggacga attgaacgtc ctgctcaaag agaatgcagt ggacctcagt 780

gtggttgtga acaagcccgt gggaagatat cgctcagccc ctaaacgcct atccatgacg 840

caagagaagt ttgaaatggg ctggaaagca tggggaaaaa gcatcctctt tgccccggaa 900

ttggctaact ccacatttgt cgtagatgga cctgagacaa aggaatgccc tgatgagcac 960

agagcttgga acagcatgca aatcgaagac ttcggctttg gcatcacatc aacccgtgtg 1020

tggctgaaaa ttagagagga gagcactgac gagtgtgatg gagcgatcat aggcacggct 1080

gtcaaaggac atgtggcagt ccatagtgac ttgtcgtact ggattgagag tcgctacaac 1140

gacacatgga aacttgagag ggcagtcttt ggagaggtca aatcttgcac ttggccagag 1200

acacacaccc tttggggaga tgatgttgag gaaagtgaac tcatcattcc gcacaccata 1260

gccggaccaa aaagcaagca caatcggagg gaagggtata agacacaaaa ccagggacct 1320

tgggatgaga atggcatagt cttggacttt gattattgcc cagggacaaa agtcaccatt 1380

acagaggatt gtagcaagag aggcccttcg gtcagaacca ctactgacag tggaaagttg 1440

atcactgact ggtgctgtcg cagttgctcc cttccgcccc tacgattccg gacagaaaat 1500

ggctgctggt acggaatgga aatcagacct gttatgcatg atgaaacaac actcgtcaga 1560

tcacaggttc atgctttcaa aggtgaaatg gttgaccctt ttcagctggg ccttctggtg 1620

atgtttctgg ccacccagga agtccttcgc aagaggtgga cggccagatt gaccattcct 1680

gcggttttgg gggtcctact tgtgctgatg cttgggggta tcacttacac tgatttggcg 1740

aggtatgtgg tgctagtcgc tgctgctttc gcagaggcca acagtggagg agacgtcctg 1800

caccttgctt tgattgctgt ttttaagatc caaccagcat ttttagtgat gaacatgctt 1860

agcacgagat ggacgaacca agaaaacgtg gttctggtcc taggggctgc ctttttccaa 1920

ttggcctcag tagatctgca aataggagtc cacggaatcc tgaatgccgc cgctatagca 1980

tggatgattg tccgagcgat caccttcccc acaacctcct ccgtcaccat gccagtctta 2040

gcgcttctaa ctccggggat gagggctcta tacctagaca cttacagaat catcctcctc 2100

gtcataggga tttgctccct gctgcacgag aggaaaaaga ccatggcgaa aaagaaagga 2160

gctgtactct tgggcttagc gctcacatcc actggatggt tctcgcccac cactatagct 2220

gccggactaa tggtctgcaa cccaaacaag aagagagggt ggccagctac tgagtttttg 2280

tcggcagttg gattgatgtt tgccatcgta ggtggtttgg ccgagttgga tattgaatcc 2340

atgtcaatac ccttcatgct ggcaggtctc atggcagtgt cctacgtggt gtcaggaaaa 2400

gcaacagata tgtggcttga acgggccgcc gacatcagct gggatatggg tgctgcaatc 2460

acaggaagca gtcggaggct ggatgtgaaa ctggatgatg acggagattt tcacttgatt 2520

gatgatcccg gtgttccatg gaaggtctgg gtcctgcgca tgtcttgcat tggcttagcc 2580

gccctcacgc cttgggccat cgttcccgcc gctttcggtt attggctcac tttaaaaaca 2640

acaaaaagag ggggcgtgtt ttgggacacg ccatccccaa aaccttgctc aaaaggagac 2700

accactacag gagtctaccg aattatggct agagggattc ttggcactta ccaggccggc 2760

gtcggagtca tgtacgagaa tgttttccac acactatggc acacaactag aggagcagcc 2820

attgtgagtg gagaaggaaa attgacgcca tactggggta gtgtgaaaga agaccgcata 2880

gcttacggag gcccatggag gtttgaccga aaatggaatg gaacagatga cgtgcaagtg 2940

atcgtggtag aaccggggaa gggcgcagta aacatccaga caaaaccagg agtgtttcgg 3000

actcccttcg gggaggttgg ggctgttagt ctggattacc cgcgaggaac atccggctca 3060

cccattctgg attccaatgg agacattata ggcctatacg gcaatggagt tgagcttggc 3120

gatggctcat acgtcagcgc catcgtgcag ggtgaccgtc aggaggaacc agtcccagaa 3180

gcttacaccc caaacatgtt gagaaagaga cagatgactg tgctagattt gcaccctggt 3240

tcagggaaaa ccaggaaaat tctgccacaa ataattaagg acgctatcca gcagcgccta 3300

agaacagctg tgttggcacc gacgcgggtg gtagcagcag aaatggcaga agttttgaga 3360

gggctcccag tacgatatca aacttcagca gtgcagagag agcaccaagg gaatgaaata 3420

gtggatgtga tgtgccacgc cactctgacc catagactga tgtcaccgaa cagagtgccc 3480

aactacaacc tatttgtcat ggatgaagct catttcaccg acccagccag tatagccgca 3540

cgaggataca ttgctaccaa ggtggaatta ggggaggcag cagccatctt tatgacagcg 3600

accccgcctg gtaccacgga tccttttcct gactcaaatg ccccaatcca tgatttgcaa 3660

gatgagatac cagacagggc atggagcagt ggatacgaat ggatcacaaa atatgcgggt 3720

aaaaccgtgt ggtttgtggc gagcgtaaaa atggggaatg agattgcaat gtgcctccaa 3780

agagcgggga aaaaggtcat ccaactcaac cgcaagtcct atgacacaga atacccaaaa 3840

tgtaagaatg gagactggga ttttgtcatt accaccgaca tctctgaaat gggggccaac 3900

ttcggtgcga gcagggtcat cgactgtaga aagagcgtga aacccaccat cttagaagag 3960

ggagaaggca gagtcatcct cggaaaccca tctcccataa ccagtgcaag cgcagctcaa 4020

cggaggggca gagtaggcag aaaccccaat caagttggag atgaatacca ctatgggggg 4080

gctaccagtg aagatgacag taacctagcc cattggacag aggcaaagat catgttagac 4140

aacatacaca tgcccaatgg actggtgacc cagctctatg gaccagagag ggaaaaggct 4200

ttcacaatgg atggcgaata ccgtctcaga ggtgaagaaa agaaaaactt cttagagctg 4260

cttaggacgg ctgacctccc ggtgtggctg gcctacaagg tggcgtccaa tggcatccag 4320

tacaccgaca gaaagtggtg ttttgatggg ccgcgtacga atgccatact ggaggacaac 4380

accgaggtag agatagtcac ccggatgggt gagaggaaaa tcctcaagcc gagatggctt 4440

gatgcaagtg tttatgcaga tcaccaggcc ctcaagtggt tcaaagactt tgcagcaggg 4500

aagagatcag ccgttagctt catagaggtg ctcggtcgca tgcctgagca tttcatggga 4560

aagacgcggg aagctttaga caccatgtac ttggttgcaa cggctgagaa aggtgggaaa 4620

gcacaccgaa tggctctcga agagctgcca gatgcactgg aaaccatcac acttattgtc 4680

gccattactg tgatgacagg aggattcttc ctactaatga tgcagcgaaa gggtataggg 4740

aagatgggtc ttggagctct agtgctcaca ctagctacct tcttcctgtg ggcggcagag 4800

gttcctggaa ccaaaatagc agggaccctg cagatcgccc tgctgctgat ggtggttccc 4860

atcccagaac cggaaaaaca gaggtcacag acagataacc aactggcggt gtttctcatc 4920

tgtgtcttga ccgtggttgg agtggtggca gcaaacgagt acgggatgct agaaaaaacc 4980

aaagcggatc tcaagagcat gtttggcgga aagacgcagg catcaggact gactggattg 5040

ccaagcatgg cactggacct gcgtccagcc acagcctggg cactgtatgg ggggagcaca 5100

gtcgtgctaa cccctcttct gaagcacctg atcacgtcgg aatacgtcac cacatcgcta 5160

gcttcaatta actcacaagc tggctcatta ttcgtcttgc cacgaggcgt gccttttacc 5220

gacctagact tgactgttgg cctcgtcttc cttggctgtt ggggtcaagt caccctcaca 5280

acgtttctga cagccatggc tctggcgaca cttcactatg ggtacatgct ccctggatgg 5340

caagcagaag cactcagggc tgcccagaga aggacagcgg ctggaataat gaagaatgcc 5400

gttgttgacg gaatggtcgc cactgatgtg cctgaactgg aaaggactac tcctctgatg 5460

caaaagaaag tcggacaggt gctcctcata ggggtaagcg tggcagcgtt cctcgtcaac 5520

cctaatgtca ccactgtgag agaagcaggg gtgttggtga cggcggctac gcttactttg 5580

tgggacaatg gagccagtgc cgtttggaat tccaccacag ccacgggact ctgccatgtc 5640

atgcgaggta gctacctggc tggaggctcc attgcttgga ctctcatcaa gaacgctgat 5700

aagccctcct tgaaaagggg aaggcctggg ggcaggacgc taggggagca ttggaaggaa 5760

aaactaaatg ccatgagtag agaagagttt tttaaatacc ggagagaggc cataatcgag 5820

gtggaccgca ctgaagcacg cagggccaga cgtgaaaata acatagtggg aggacatccg 5880

gtttcgcgag gctcagcaaa actccgttgg ctcgtggaga aaggatttgt ctcgccaata 5940

ggaaaagtca ttgatctagg gtgtgggcgt ggaggatgga gctactacgc agcaaccctg 6000

aagaaggtcc aggaagtcag aggatacacg aaaggtgggg cgggacatga agaaccgatg 6060

ctcatgcaga gctacggctg gaacctggtc tccctgaaga gtggagtgga cgtgttttac 6120

aaaccttcag agcccagtga taccctgttc tgtgacatag gggaatcctc cccaagtcca 6180

gaagtagaag aacaacgcac actacgcgtc ctagagatga catctgactg gttgcaccga 6240

ggacctagag agttctgcat taaagttctc tgcccttaca tgcccaaggt tatagaaaaa 6300

atggaagttc tgcagcgtcg cttcggaggt gggctagtgc gtctccccct gtcccgaaac 6360

tccaatcacg agatgtattg ggttagtgga gccgctggca atgtggtgca cgctgtgaac 6420

atgaccagcc aggtattact ggggcgaatg gatcgcacag tgtggagagg gccaaagtat 6480

gaggaagatg tcaacctagg gagcggaaca agagccgtgg gaaagggaga agtccatagc 6540

aatcaggaga aaatcaagaa gagaatccag aagcttaaag aagaattcgc cacaacgtgg 6600

cacaaagacc ctgagcatcc ataccgcact tggacatacc acggaagcta tgaagtgaag 6660

gctactggct cagccagctc tctcgtcaac ggagtggtga agctcatgag caaaccttgg 6720

gacgccattg ccaacgtcac caccatggcc atgactgaca ccaccccttt tggacagcaa 6780

agagttttca aggagaaagt tgacacgaag gctcctgagc caccagctgg agccaaggaa 6840

gtgctcaacg agaccaccaa ctggctgtgg gcctacttgt cacgggaaaa aagaccccgc 6900

ttgtgcacca aggaagaatt cattaagaaa gttaacagca acgcggctct tggagcagtg 6960

ttcgctgaac agaatcaatg gagcacggcg cgtgaggctg tggatgaccc gcggttttgg 7020

gagatggttg atgaagagag ggaaaaccat ctgcgaggag agtgtcacac atgtatctac 7080

aacatgatgg gaaaaagaga gaagaagcct ggagagtttg gaaaagctaa aggaagcagg 7140

gccatttggt tcatgtggct tggagcacgg tatctagagt ttgaagcttt ggggttcctg 7200

aatgaagacc attggctgag ccgagagaat tcaggaggtg gagtggaagg ctcaggcgtc 7260

caaaagctgg ggtacatcct ccgtgacata gcaggaaagc aaggagggaa aatgtacgct 7320

gatgataccg ccgggtggga cactagaatt accagaactg atttagaaaa tgaagctaag 7380

gtactggagc tcctagacgg tgaacaccgc atgctcgccc gagccataat tgaactgact 7440

tacaggcaca aagtggtcaa ggtcatgaga cctgcagcag aaggaaagac cgtgatggac 7500

gtgatatcaa gagaagatca aagggggagt ggacaggtgg tcacttatgc tcttaacact 7560

ttcacgaaca tcgctgtcca gctcgtcagg ctgatggagg ctgagggggt cattggacca 7620

caacacttgg aacatctacc taggaaaaac aagatagctg tcaggacctg gctctttgag 7680

aatggagagg agagagtgac caggatggcg atcagcggag acgactgtgc cgtcaaaccg 7740

ctggacgaca gattcgccac agccctccac ttcctcaacg caatgtcaaa ggtcagaaaa 7800

gacatccagg aatggaagcc ttcgcatggc tggcacgatt ggcagcaagt tcccttctgt 7860

tctaaccatc ttcaggagat tgtgatgaaa gatggaagga gtatagttgt cccgtgcaga 7920

ggacaggatg agctgatagg cagggctcgc atctctccag gagctggatg gaatgtgaag 7980

gacacagctt gcctggccaa agcatatgca cagatgtggc tactcctata cttccatcgc 8040

agggacttgc gtctcatggc aaatgcgatt tgctcagcag cgccagtaga ttgggtgccc 8100

acaggcagga catcctggtc aatacactcg aaaggagagt ggatgaccac ggaagacatg 8160

ctgcaggtct ggaacagagt ttggattgaa gaaaatgaat ggatgatgga caagactcca 8220

atcacaagct ggacagacgt tccgtatgtg ggaaagcgcg aggacatctg gtgtggcagc 8280

ctcatcggaa cgcgatccag agcaacctgg gctgagaaca tctatgcggc gataaaccag 8340

gttagagctg tcattgggaa agaaaattat gttgactaca tgacctcact caggagatac 8400

gaagacgtct tgatccagga agacagggtc atctagtgtg atttaaggta gaaaagtaga 8460

ctatgtaaac aatgtaaatg agaaaatgca tgcatatgga gtcaggccag caaaagctgc 8520

caccggatac tgggtagacg gtgctgcctg cgtctcagtc ccaggaggac tgggttaaca 8580

aatctgacaa cagaaagtga gaaagccctc agaaccgtct cggaagtagg tccctgctca 8640

ctggaagttg aaagaccaac gtcaggccac aaatttgtgc cactccgcta gggagtgcgg 8700

cctgcgcagc cccaggagga ctgggttacc aaagccgttg aggcccccac ggcccaagcc 8760

tcgtctagga tgcaatagac gaggtgtaag gactagaggt tagaggagac cccgtggaaa 8820

caacaacatg cggcccaagc cccctcgaag ctgtagagga ggtggaagga ctagaggtta 8880

gaggagaccc cgcacttgca tcaaacagca tattgacacc tgggaataga ctgggagatc 8940

ttctgctcta tctcaacatc agctactagg cacagagcgc cgaagtatgt acgtggtggt 9000

gaggaagaac acaggatct 9019

<210>2

<211>9232

<212>DNA

＜213〉artificial sequence

<400>2

taatacgact cactatagga gaagtttatc tgtgtgaact tcttggctta gtatcgtaga 60

gaagaatcga gagattagtg cagtttaaac agttttttag aacggaagat aaccatgact 120

aaaaaaccag gagggcccgg taaaaaccga gctatcaata tgctgaaacg cggcctaccc 180

cgcgtattcc cactagtggg agtgaagagg gtagtaatga gcttgttgga cggcagaggg 240

ccagtacgtt tcgtgctggc tcttatcacg ttcttcaagt ttacagcatt agccccgacc 300

aaggcgcttt caggccgatg gaaagcagtg gaaaagagtg tggcaatgaa acatcttact 360

agtttcaaac gagaacttgg aacactcatt gacgccgtga acaagcgggg cagaaagcaa 420

aacaaaagag gaggaaatga aggctcaatc atgtggctcg cgagcttggc agttgtcata 480

gcttgtgcag gagccaccgg tgcgcgcctc gagcccggga ttggaggggt cttcaactcc 540

ataggaagag ccgttcacca agtgtttggt ggtgccttca gaacactctt tgggggaatg 600

tcttggatca cacaagggct aatgggtgcc ctactgctct ggatgggcgt caacgcacga 660

gaccgatcaa ttgctttggc cttcttagcc acaggaggtg tgctcgtgtt cttagcgacc 720

aatgtgcatg ctgacactgg atgtgccatt gacatcacaa gaaaagagat gagatgtgga 780

agtggcatct tcgtgcacaa cgacgtggaa gcctgggtgg ataggtataa atatttgcca 840

gaaacgccca gatccctagc gaagatcgtc cacaaagcgc acaaggaagg cgtgtgcgga 900

gtcagatctg tcactagact ggagcaccaa atgtgggaag ccgtaaggga cgaattgaac 960

gtcctgctca aagagaatgc agtggacctc agtgtggttg tgaacaagcc cgtgggaaga 1020

tatcgctcag cccctaaacg cctatccatg acgcaagaga agtttgaaat gggctggaaa 1080

gcatggggaa aaagcatcct ctttgccccg gaattggcta actccacatt tgtcgtagat 1140

ggacctgaga caaaggaatg ccctgatgag cacagagctt ggaacagcat gcaaatcgaa 1200

gacttcggct ttggcatcac atcaacccgt gtgtggctga aaattagaga ggagagcact 1260

gacgagtgtg atggagcgat cataggcacg gctgtcaaag gacatgtggc agtccatagt 1320

gacttgtcgt actggattga gagtcgctac aacgacacat ggaaacttga gagggcagtc 1380

tttggagagg tcaaatcttg cacttggcca gagacacaca ccctttgggg agatgatgtt 1440

gaggaaagtg aactcatcat tccgcacacc atagccggac caaaaagcaa gcacaatcgg 1500

agggaagggt ataagacaca aaaccaggga ccttgggatg agaatggcat agtcttggac 1560

tttgattatt gcccagggac aaaagtcacc attacagagg attgtagcaa gagaggccct 1620

tcggtcagaa ccactactga cagtggaaag ttgatcactg actggtgctg tcgcagttgc 1680

tcccttccgc ccctacgatt ccggacagaa aatggctgct ggtacggaat ggaaatcaga 1740

cctgttatgc atgatgaaac aacactcgtc agatcacagg ttcatgcttt caaaggtgaa 1800

atggttgacc cttttcagct gggccttctg gtgatgtttc tggscaccca ggaagtcctt 1860

cgcaagaggt ggacggccag attgaccatt cctgcggttt tgggggtcct acttgtgctg 1920

atgcttgggg gtatcactta cactgatttg gcgaggtatg tggtgctagt cgctgctgct 1980

ttcgcagagg ccaacagtgg aggagacgtc ctgcaccttg ctttgattgc tgtttttaag 2040

atccaaccag catttttagt gatgaacatg cttagcacga gatggacgaa ccaagaaaac 2100

gtggttctgg tcctaggggc tgcctttttc caattggcct cagtagatct gcaaatagga 2160

gtccacggaa tcctgaatgc cgccgctata gcatggatga ttgtccgagc gatcaccttc 2220

cccaccacct cctccgtcac catgccagtc ttagcgcttc taactccggg gatgagggct 2280

ctatacctag acacttacag aatcatcctc ctcgtcatag ggatttgctc cctgctgcac 2340

gagaggaaaa agaccatggc gaaaaagaaa ggagctgtac tcttgggctt agcgctcaca 2400

tccactggat ggttctcgcc caccactata gctgccggac taatggtctg caacccaaac 2460

aagaagagag ggtggccagc tactgagttt ttgtcggcag ttggattgat gtttgccatc 2520

gtaggtggtt tggccgagtt ggatattgaa tccatgtcaa tacccttcat gctggcaggt 2580

ctcatggcag tgtcctacgt ggtgtcagga aaagcaacag atatgtggct tgaacgggcc 2640

gccgacatca gctgggatat gggtgctgca atcacaggaa gcagtcggag gctggatgtg 2700

aaactggatg atgacggaga ttttcacttg attgatgatc ccggtgttcc atggaaggtc 2760

tgggtcctgc gcatgtcttg cattggctta gccgccctca cgccttgggc catcgttccc 2820

gccgctttcg gttattggct cactttaaaa acaacaaaaa gagggggcgt gttttgggac 2880

acgccatccc caaaaccttg ctcaaaagga gacaccacta caggagtcta ccgaattatg 2940

gctagaggga ttcttggcac ttaccaggcc ggcgtcggag tcatgtacga gaatgttttc 3000

cacacactat ggcacacaac tagaggagca gccattgtga gtggagaagg aaaattgacg 3060

ccatactggg gtagtgtgaa agaagaccgc atagcttacg gaggcccatg gaggtttgac 3120

cgaaaatgga atggaacaga tgacgtgcaa gtgatcgtgg tagaaccggg gaagggcgca 3180

gtaaacatcc agacaaaacc aggagtgttt cggactccct tcggggaggt tggggctgtt 3240

agtctggatt acccgcgagg aacatccggc tcacccattc tggattccaa tggagacatt 3300

ataggcctat acggcaatgg agttgagctt ggcgatggct catacgtcag cgccatcgtg 3360

cagggtgacc gtcaggagga accagtccca gaagcttaca ccccaaacat gttgagaaag 3420

agacagatga ctgtgctaga tttgcaccct ggttcaggga aaaccaggaa aattctgcca 3480

caaataatta aggacgctat ccagcagcgc ctaagaacag ctgtgttggc accgacgcgg 3540

gtggtagcag cagaaatggc agaagttttg agagggctcc cagtacgata tcaaacttca 3600

gcagtgcaga gagagcacca agggaatgaa atagtggatg tgatgtgcca cgccactctg 3660

acccatagac tgatgtcacc gaacagagtg cccaactaca acctatttgt catggatgaa 3720

gctcatttca ccgacccagc cagtatagcc gcacgaggat acattgctac caaggtggaa 3780

ttaggggagg cagcagccat ctttatgaca gcgaccccgc ctggtaccac ggatcctttt 3840

cctgactcaa atgccccaat ccatgatttg caagatgaga taccagacag ggcatggagc 3900

agtggatacg aatggatcac aaaatatgcg ggtaaaaccg tgtggtttgt ggcgagcgta 3960

aaaatgggga atgagattgc aatgtgcctc caaagagcgg ggaaaaaggt catccaactc 4020

aaccgcaagt cctatgacac agaataccca aaatgtaaga atggagactg ggattttgtc 4080

attaccaccg acatctctga aatgggggcc aacttcggtg cgagcagggt catcgactgt 4140

agaaagagcg tgaaacccac catcttagaa gagggagaag gcagagtcat cctcggaaac 4200

ccatctccca taaccagtgc aagcgcagct caacggaggg gcagagtagg cagaaacccc 4260

aatcaagttg gagatgaata ccactatggg ggggctacca gtgaagatga cagtaaccta 4320

gcccattgga cagaggcaaa gatcatgtta gacaacatac acatgcccaa tggactggtg 4380

acccagctct atggaccaga gagggaaaag gctttcacaa tggatggcga ataccgtctc 4440

agaggtgaag aaaagaaaaa cttcttagag ctgcttagga cggctgacct cccggtgtgg 4500

ctggcctaca aggtggcgtc caatggcatc cagtacaccg acagaaagtg gtgttttgat 4560

gggccgcgta cgaatgccat actggaggac aacaccgagg tagagatagt cacccggatg 4620

ggtgagagga aaatcctcaa gccgagatgg cttgatgcaa gtgtttatgc agatcaccag 4680

gccctcaagt ggttcaaaga ctttgcagca gggaagagat cagccgttag cttcatagag 4740

gtgctcggtc gcatgcctga gcatttcatg ggaaagacgc gggaagcttt agacaccatg 4800

tacttggttg caacggctga gaaaggtggg aaagcacacc gaatggctct cgaagagctg 4860

ccagatgcac tggaaaccat cacacttatt gtcgccatta ctgtgatgac aggaggattc 4920

ttcctactaa tgatgcagcg aaagggtata gggaagatgg gtcttggagc tctagtgctc 4980

acactagcta ccttcttcct gtgggcggca gaggttcctg gaaccaaaat agcagggacc 5040

ctgcagatcg ccctgctgct gatggtggtt cccatcccag aaccggaaaa acagaggtca 5100

cagacagata accaactggc ggtgtttctc atctgtgtct tgaccgtggt tggagtggtg 5160

gcagcaaacg agtacgggat gctagaaaaa accaaagcgg atctcaagag catgtttggc 5220

ggaaagacgc aggcatcagg actgactgga ttgccaagca tggcactgga cctgcgtcca 5280

gccacagcct gggcactgta tggggggagc acagtcgtgc taacccctct tctgaagcac 5340

ctgatcacgt cggaatacgt caccacatcg ctagcttcaa ttaactcaca agctggctca 5400

ttattcgtct tgccacgagg cgtgcctttt accgacctag acttgactgt tggcctcgtc 5460

ttccttggct gttggggtca agtcaccctc acaacgtttc tgacagccat ggctctggcg 5520

acacttcact atgggtacat gctccctgga tggcaagcag aagcactcag ggctgcccag 5580

agaaggacag cggctggaat aatgaagaat gccgttgttg acggaatggt cgccactgat 5640

gtgcctgaac tggaaaggac tactcctctg atgcaaaaga aagtcggaca ggtgctcctc 5700

ataggggtaa gcgtggcagc gttcctcgtc aaccctaatg tcaccactgt gagagaagca 5760

ggggtgttgg tgacggcggc tacgcttact ttgtgggaca atggagccag tgccgtttgg 5820

aattccacca cagccacggg actctgccat gtcatgcgag gtagctacct ggctggaggc 5880

tccattgctt ggactctcat caagaacgct gataagccct ccttgaaaag gggaaggcct 5940

gggggcagga cgctagggga gcattggaag gaaaaactaa atgccatgag tagagaagag 6000

ttttttaaat accggagaga ggccataatc gaggtggacc gcactgaagc acgcagggcc 6060

agacgtgaaa ataacatagt gggaggacat ccggtttcgc gaggctcagc aaaactccgt 6120

tggctcgtgg agaaaggatt tgtctcgcca ataggaaaag tcattgatct agggtgtggg 6180

cgtggaggat ggagctacta cgcagcaacc ctgaagaagg tccaggaagt cagaggatac 6240

acgaaaggtg gggcgggaca tgaagaaccg atgctcatgc agagctacgg ctggaacctg 6300

gtctccctga agagtggagt ggacgtgttt tacaaacctt cagagcccag tgataccctg 6360

ttctgtgaca taggggaatc ctccccaagt ccagaagtag aagaacaacg cacactacgc 6420

gtcctagaga tgacatctga ctggttgcac cgaggaccta gagagttctg cattaaagtt 6480

ctctgccctt acatgcccaa ggttatagaa aaaatggaag ttctgcagcg tcgcttcgga 6540

ggtgggctag tgcgtctccc cctgtcccga aactccaatc acgagatgta ttgggttagt 6600

ggagccgctg gcaatgtggt gcacgctgtg aacatgacca gccaggtatt actggggcga 6660

atggatcgca cagtgtggag agggccaaag tatgaggaag atgtcaacct agggagcgga 6720

acaagagccg tgggaaaggg agaagtccat agcaatcagg agaaaatcaa gaagagaatc 6780

cagaagctta aagaagaatt cgccacaacg tggcacaaag accctgagca tccataccgc 6840

acttggacat accacggaag ctatgaagtg aaggctactg gctcagccag ctctctcgtc 6900

aacggagtgg tgaagctcat gagcaaacct tgggacgcca ttgccaacgt caccaccatg 6960

gccatgactg acaccacccc ttttggacag caaagagttt tcaaggagaa agttgacacg 7020

aaggctcctg agccaccagc tggagccaag gaagtgctca acgagaccac caactggctg 7080

tgggcctact tgtcacggga aaaaagaccc cgcttgtgca ccaaggaaga attcattaag 7140

aaagttaaca gcaacgcggc tcttggagca gtgttcgctg aacagaatca atggagcacg 7200

gcgcgtgagg ctgtggatga cccgcggttt tgggagatgg ttgatgaaga gagggaaaac 7260

catctgcgag gagagtgtca cacatgtatc tacaacatga tgggaaaaag agagaagaag 7320

cctggagagt ttggaaaagc taaaggaagc agggccattt ggttcatgtg gcttggagca 7380

cggtatctag agtttgaagc tttggggttc ctgaatgaag accattggct gagccgagag 7440

aattcaggag gtggagtgga aggctcaggc gtccaaaagc tggggtacat cctccgtgac 7500

atagcaggaa agcaaggagg gaaaatgtac gctgatgata ccgccgggtg ggacactaga 7560

attaccagaa ctgatttaga aaatgaagct aaggtactgg agctcctaga cggtgaacac 7620

cgcatgctcg cccgagccat aattgaactg acttacaggc acaaagtggt caaggtcatg 7680

agacctgcag cagaaggaaa gaccgtgatg gacgtgatat caagagaaga tcaaaggggg 7740

agtggacagg tggtcactta tgctcttaac actttcacga acatcgctgt ccagctcgtc 7800

aggctgatgg aggctgaggg ggtcattgga ccacaacact tggaacatct acctaggaaa 7860

aacaagatag ctgtcaggac ctggctcttt gagaatggag aggagagagt gaccaggatg 7920

gcgatcagcg gagacgactg tgccgtcaaa ccgctggacg acagattcgc cacagccctc 7980

cacttcctca acgcaatgtc aaaggtcaga aaagacatcc aggaatggaa gccttcgcat 8040

ggctggcacg attggcagca agttcccttc tgttctaacc atcttcagga gattgtgatg 8100

aaagatggaa ggagtatagt tgtcccgtgc agaggacagg atgagctgat aggcagggct 8160

cgcatctctc caggagctgg atggaatgtg aaggacacag cttgcctggc caaagcatat 8220

gcacagatgt ggctactcct atacttccat cgcagggact tgcgtctcat ggcaaatgcg 8280

atttgctcag cagcgccagt agattgggtg cccacaggca ggacatcctg gtcaatacac 8340

tcgaaaggag agtggatgac cacggaagac atgctgcagg tctggaacag agtttggatt 8400

gaagaaaatg aatggatgat ggacaagact ccaatcacaa gctggacaga cgttccgtat 8460

gtgggaaagc gcgaggacat ctggtgtggc agcctcatcg gaacgcgatc cagagcaacc 8520

tgggctgaga acatctatgc ggcgataaac caggttagag ctgtcattgg gaaagaaaat 8580

tatgttgact acatgacctc actcaggaga tacgaagacg tcttgatcca ggaagacagg 8640

gtcatctagt gtgatttaag gtagaaaagt agactatgta aacaatgtaa atgagaaaat 8700

gcatgcatat ggagtcaggc cagcaaaagc tgccaccgga tactgggtag acggtgctgc 8760

ctgcgtctca gtcccaggag gactgggtta acaaatctga caacagaaag tgagaaagcc 8820

ctcagaaccg tctcggaagt aggtccctgc tcactggaag ttgaaagacc aacgtcaggc 8880

cacaaatttg tgccactccg ctagggagtg cggcctgcgc agccccagga ggactgggtt 8940

accaaagccg ttgaggcccc cacggcccaa gcctcgtcta ggatgcaata gacgaggtgt 9000

aaggactaga ggttagagga gaccccgtgg aaacaacaac atgcggccca agccccctcg 9060

aagctgtaga ggaggtggaa ggactagagg ttagaggaga ccccgcactt gcatcaaaca 9120

gcatattgac acctgggaat agactgggag atcttctgct ctatctcaac atcagctact 9180

aggcacagag cgccgaagta tgtacgtggt ggtgaggaag aacacaggat ct 9232

<210>3

<211>1983

<212>DNA

＜213〉artificial sequence

<400>3

ttccatttaa ccacacgtaa cggagaacca cacatgatcg tcagtagaca agagaaaggg 60

aaaagtcttc tgtttaaaac agaggatggt gtgaacatgt gtaccctcat ggccatggac 120

cttggtgaat tgtgtgaaga tacaatcacg tacaagtgtc cttttctcag gcagaatgaa 180

ccagaagaca tagattgttg gtgcaactct acgtccacat gggtaactta tgggacgtgt 240

accaccacag gagaacacag aagagaaaaa agatcagtgg cactcgttcc acatgtggga 300

atgggactgg agacacgaac tgaaacatgg atgtcatcag aaggggcctg gaaacatgcc 360

cagagaattg aaacttggat cttgagacat ccaggcttta ccataatggc agcaatcctg 420

gcatacacca taggaacgac acatttccaa agagccctga ttttcatctt actgacagct 480

gtcgctcctt caatgacaat gcgttgcata ggaatatcaa atagagactt tgtagaaggg 540

gtttcaggag gaagctgggt tgacatagtc ttagaacatg gaagctgtgg gacgacgatg 600

gcaaaaaaca aaccaacatt ggattttgaa ctgataaaaa cagaagccaa acaacctgcc 660

actctaagga agtactgtat agaggcaaag ctgaccaaca caacaacaga ttctcgctgc 720

ccaacacaag gagaacccag cctaaatgaa gagcaggaca aaaggttcgt ctgcaaacac 780

tccatggtgg acagaggatg gggaaatgga tgtggattat ttggaaaagg aggcattgtg 840

acctgtgcta tgttcacatg caaaaagaac atgaaaggaa aagtcgtgca accagaaaac 900

ttggaataca ccattgtgat aacacctcac tcaggggaag agcatgcagt cggaaatgac 960

acaggaaaac atggcaagga aatcaaaata acaccacaga gttccatcac agaagcagag 1020

ttgacaggct atggcactgt cacgatggag tgctctccga gaacgggcct cgacttcaat 1080

gagatggtgt tgctgcaaat ggaaaataaa gcttggctgg tgcacaggca atggttccta 1140

gacctgccgt tgccatggct gcccggagcg gacacacaag gatcaaattg gatacagaaa 1200

gagacattgg tcactttcaa aaatccccat gcgaagaaac aggatgttgt tgttttggga 1260

tcccaagaag gggccatgca cacagcactc acaggggcca cagaaatcca gatgtcatca 1320

ggaaacttac tgttcacagg acatctcaag tgcaggctga ggatggacaa actacagctc 1380

aaaggaatgt catactctat gtgcacagga aagtttaaag ttgtgaagga aatagcagaa 1440

acacaacatg gaacaatagt tatcagagta caatatgaag gggacggttc tccatgtaag 1500

atcccttttg agataatgga tttggaaaaa agacatgttt taggtcgcct gattacagtc 1560

aacccaatcg taacagaaaa agatagccca gtcaacatag aagcagaacc tccattcgga 1620

gacagctaca tcatcatagg agtagagccg ggacaattga agctcaactg gtttaagaaa 1680

ggaagttcta tcggccaaat gattgagaca acaatgaggg gagcgaagag aatggccatt 1740

ttaggtgaca cagcttggga ttttggatcc ctgggaggag tgtttacatc tataggaaag 1800

gctctccacc aagttttcgg agcaatctat ggggctgcct tcagtggggt ctcatggact 1860

atgaaaatcc tcataggagt cattatcaca tggataggaa tgaattcacg cagcccctca 1920

ctgtctgtgt cactagtatt ggtgggagtc gtgacgctgt atttgggagt catggtgcag 1980

gcc 1983

<210>4

<211>1770

<212>DNA

＜213〉artificial sequence

<400>4

ttccatttaa ccacacgtaa cggagaacca cacatgatcg tcagtagaca agagaaaggg 60

aaaagtcttc tgtttaaaac agaggatggt gtgaacatgt gtaccctcat ggccatggac 120

cttggtgaat tgtgtgaaga tacaatcacg tacaagtgtc cttttctcag gcagaatgaa 180

ccagaagaca tagattgttg gtgcaactct acgtccacat gggtaactta tgggacgtgt 240

accaccacag gagaacacag aagagaaaaa agatcagtgg cactcgttcc acatgtggga 300

atgggactgg agacacgaac tgaaacatgg atgtcatcag aaggggcctg gaaacatgcc 360

cagagaattg aaacttggat cttgagacat ccaggcttta ccataatggc agcaatcctg 420

gcatacacca taggaacgac acatttccaa agagccctga ttttcatctt actgacagct 480

gtcgctcctt caatgacaat gcgttgcata ggaatatcaa atagagactt tgtagaaggg 540

gtttcaggag gaagctgggt tgacatagtc ttagaacatg gaagctgtgt gacgacgatg 600

gcaaaaaaca aaccaacatt ggattttgaa ctgataaaaa cagaagccaa acaacctgcc 660

actctaagga agtactgtat agaggcaaag ctgaccaaca caacaacaga ttctcgctgc 720

ccaacacaag gagaacccag cctaaatgaa gagcaggaca aaaggttcgt ctgcaaacac 780

tccatggtgg acagaggatg gggaaatgga tgtggattat ttggaaaagg aggcattgtg 840

acctgtgcta tgttcacatg caaaaagaac atgaaaggaa aagtcgtgca accagaaaac 900

ttggaataca ccattgtgat aacacctcac tcaggggaag agcatgcagt cggaaatgac 960

acaggaaaac atggcaagga aatcaaaata acaccacaga gttccatcac agaagcagag 1020

ttgacaggct atggcactgt cacgatggag tgctctccga gaacgggcct cgacttcaat 1080

gagatggtgt tgctgcaaat ggaaaataaa gcttggctgg tgcacaggca atggttccta 1140

gacctgccgt tgccatggct gcccggagcg gacacacaag gatcaaattg gatacagaaa 1200

gagacattgg tcactttcaa aaatccccat gcgaagaaac aggatgttgt tgttttggga 1260

tcccaagaag gggccatgca cacagcactc acaggggcca cagaaatcca gatgtcatca 1320

ggaaacttac tgttcacagg acatctcaag tgcaggctga ggatggacaa actacagctc 1380

aaaggaatgt catactctat gtgcacagga aagtttaaag ttgtgaagga aatagcagaa 1440

acacaacatg gaacaatagt tatcagagta caatatgaag gggacggttc tccatgtaag 1500

atcccttttg agataatgga tttggaaaaa agacatgttt taggtcgcct gattacagtc 1560

aacccaatcg taacagaaaa agatagccca gtcaacatag aagcagaacc tccattcgga 1620

gacagctaca tcatcatagg agtagagccg ggacaattga agctcaactg gtttaagaaa 1680

ggaagttcta tcggccaaat gattgagaca acaatgaggg gagcgaagag aatggccatt 1740

ttaggtgaca cagcttggga ttttggatcc 1770

<210>5

<211>58

<212>DNA

＜213〉artificial sequence

<400>5

cggaattcta atacgactca ctataggaga agtttatctg tgtgaacttc ttggctta 58

<210>6

<211>36

<212>DNA

＜213〉artificial sequence

<400>6

aaaggatccg tggtaccagg cggggtcgct gtcata 36

<210>7

<211>20

<212>DNA

＜213〉artificial sequence

<400>7

gccatcttta tgacagcgac 20

<210>8

<211>44

<212>DNA

＜213〉artificial sequence

<400>8

cggtcgacag atcctgtgtt cttcctcacc accacgtaca tact 44

<210>9

<211>20

<212>DNA

＜213〉artificial sequence

<400>9

aggagggccc ggtaaaaacc 20

<210>10

<211>43

<212>DNA

＜213〉artificial sequence

<400>10

cccgggctcg aggcgcgcac cggtggctcc tgcacaagct atg 43

<210>11

<211>45

<212>DNA

＜213〉artificial sequence

<400>11

accggtgcgc gcctcgagcc cggggacact ggatgtgcca ttgac 45

<210>12

<211>36

<212>DNA

＜213〉artificial sequence

<400>12

aaaggatccg tggtaccagg cggggtcgct gtcata 36

<210>13

<211>44

<212>DNA

＜213〉artificial sequence

<400>13

accggtgcgc gcctcgagcc cgggattgga ggggtcttca actc 44

<210>14

<211>36

<212>DNA

＜213〉artificial sequence

<400>14

aaaggatccg tggtaccagg cggggtcgct gtcata 36

<210>15

<211>22

<212>DNA

＜213〉artificial sequence

<400>15

aaggtgaagg tcggagtcaa cg 22

<210>16

<211>21

<212>DNA

＜213〉artificial sequence

<400>16

gtccctggaa gatggtgatg g 21

<210>17

<211>21

<212>DNA

＜213〉artificial sequence

<400>17

agtgaagagg gtagtaatga g 21

<210>18

<211>21

<212>DNA

＜213〉artificial sequence

<400>18

ccaagttctc gtttgaaact a 21

<210>19

<211>21

<212>DNA

＜213〉artificial sequence

<400>19

accggtatgg tgagcaaggg c 21

<210>20

<211>21

<212>DNA

＜213〉artificial sequence

<400>20

cccgggcttg tacagctggt c 21

<210>21

<211>21

<212>DNA

＜213〉artificial sequence

<400>21

accggtttcc atttaaccac a 21

<210>22

<211>21

<212>DNA

＜213〉artificial sequence

<400>22

cccgggggcc tgcaccatga c 21

<210>23

<211>21

<212>DNA

＜213〉artificial sequence

<400>23

accggtttcc atttaaccac a 21

<210>24

<211>26

<212>DNA

＜213〉artificial sequence

<400>24

cccgggggat ccaaaatccc aagctg 26

<210>25

<211>25

<212>DNA

＜213〉artificial sequence

<400>25

cgagaacttg gaacactcat tgacg 25

<210>26

<211>25

<212>DNA

＜213〉artificial sequence

<400>26

gcgctttgtg gacgatcttc gctag 25

Claims (10)

1, a kind of virus replication, it comprises plasmid vector and JEV SA14-14-2 full-length cDNA genomic clone.

2, replicon as claimed in claim 1 is characterized in that, has prokaryotic promoter at the genomic 5 ' end of JEV SA14-14-2 full-length cDNA, and preferred described promotor is T7, more preferably also increases by two sweet soda acid bases of bird after described promotor.

3, replicon as claimed in claim 2 is characterized in that, has unique restriction endonuclease sites as transcribing site out of control at the genomic 3 ' end of JEV SA14-14-2 full-length cDNA.

4, replicon as claimed in claim 3 is characterized in that, described restriction enzyme site is SalI.

As each described replicon of claim 1～4, it is characterized in that 5, the 963rd VITAMIN B4 A sports thymus pyrimidine T on the ns3 gene.

6, a kind of replicon carrier, it obtains by the proteic all or part of nucleic acid of the coding prM/E of the arbitrary described replicon of claim 1～5 being replaced with multiple clone site, and described part nucleotide sequence is meant coding proteic full sequence of prM and the proteic most of sequence of coding E.

7, replicon carrier as claimed in claim 6 is characterized in that, the nucleotide sequence of described carrier is shown in SEQ ID No.1 or SEQ ID No.2.

8, a kind of embedded virus, it is the proteic all or part of nucleic acid of the coding prM/E of the arbitrary described replicon of claim 1～5 to be replaced with the proteic all or part of nucleotide sequence of dengue virus coding prM/E obtain, or inserting the proteic all or part of nucleotide sequence of dengue virus coding prM/E in the multiple clone site of claim 8 or 9 described replicon carriers obtains, and described part nucleotide sequence is meant coding proteic full sequence of prM and the proteic most of sequence of coding E.

9, embedded virus as claimed in claim 8 is characterized in that, described dengue virus is dengue virus 2 types.

10, claim 8 or the 9 described embedded viruses application in the preparation dengue virus vaccine.

Images