CN103205460A - Chimeric virus, and preparation method and application thereof - Google Patents

Abstract

The invention discloses an infectious Japanese encephalitis virus clone which is a recombinant vector including full-length cDNA of genome of a Japanese encephalitis virus attenuated strain SA14-14-2. The invention further discloses a chimeric virus and application thereof and a bacterial artificial chromosome as represented by SEQ ID No. 1. The chimeric virus provided by the invention can grow and proliferate on a plurality of cells used for production of human vaccines and show similar growth characteristics, is applicable to production of four serotype Dengue vaccines and has the advantages of strong immunogenicity, high antibody titer, good application prospects and a high industrial application value.

Description

A kind of embedded virus and its preparation method and application

Technical field

The present invention relates to a kind of embedded virus, particularly a kind of chimeric infection and encephalitis B virus infection sex clone of dengue virus protective antigen.

Background technology

Singapore hemorrhagic fever is one of the most serious unheeded torrid zone of harm and subtropics transmissible disease by the WHO analogy.According to the WHO statistics, since nineteen fifty-five was found this disease, the leather case of stepping on of WHO report had increased about 30 times.At present, the epidemic regions that the whole world has nearly half population (3,500,000,000) to live in singapore hemorrhagic fever, annual morbidity example is approximately 5,000 ten thousand, but the whole world does not also have vaccine available at present.

The crucial difficult point of stepping on the research and development of leather vaccine is that dengue virus is divided into four kinds by serotype, namely steps on leather 1 type, steps on leather 2 types, steps on leather 3 types, steps on leather 4 types, and alternately occur in epidemic regions.Though between four serotypes cross reaction is arranged, there are not cross protection or cross protection very weak, the time length is very short, and the several months is only arranged.Behind the dengue virus that infects certain serotype, the clinical symptom that general only reveal any symptoms is more weak or asymptomatic, as again by another kind of serotype dengue virus infection, the pathology enhancement that antibody relies on can appear, it is short to show as latent period, clinical symptom obviously increases the weight of, and serious hemorrhage, shock or dead may occur.Therefore must research and development can protect the tetravalence of 4 serotype dengue viruss to step on the leather vaccine simultaneously.Because 4 serotype dengue virus growth characteristics difference are big, the immunne response ability is different, keep 4 types and step on the balance of immune response level certain between the leather vaccine and have certain technical difficulty.Therefore, there is not safe and effective vaccine listing so far.

Application number: 200910085231.6, denomination of invention: the patent application of Japanese encephalitis/dengue chimeric virus and application thereof is to utilize encephalitis attenuated vaccine strain SA14-14-2 to be the gene skeleton, dengue 2-type virus NGC strain antigen gene prM-E is replaced Vaccinum Encephalitidis Epidemicae strain corresponding gene zone structure form.Because the patented product only can breed at mosquito cells C6/36, this cell can not be used for the production of vaccine for man, and only is encephalitis/step on a kind of embedded virus of leather 2 types, can't carry out production of vaccine, has very big defective.

Summary of the invention

In order to address the above problem, the invention provides a kind of new infection and encephalitis B virus infection sex clone, be the dengue chimeric virus of skeleton with this infection and encephalitis B virus infection sex clone, and step on leather vaccine and new bacterial artificial chromosome.

Infection and encephalitis B virus infection sex clone of the present invention, it is the recombinant vectors that comprises encephalitis b virus attenuated strain SA14-14-2 genome full-length cDNA.

Wherein, described recombinant vectors is reorganization pACNR plasmid or recombinant bacteria artificial chromosome, and the nucleotide sequence of bacterial artificial chromosome is shown in SEQ ID NO.1.

Wherein, 5 ' of described full-length cDNA end has prokaryotic promoter.Described promotor is SP6.

The Transcription Termination site of 3 ' end of described full-length cDNA is restriction enzyme digestion sites.Described restriction enzyme digestion sites is XhoI or SalI.

Preferably, the nucleotide sequence of described infections clone is shown in SEQ ID NO.2 or SEQ ID NO.3.

Embedded virus of the present invention, it is made up by aforementioned infection and encephalitis B virus infection sex clone and forms, and wherein the prM-E gene is dengue virus prM-E gene.

Wherein, described dengue virus is dengue virus 1,2,3 or 4 types.

Wherein, described dengue virus 1 type is dengue virus ThD0008-81 strain; Described dengue virus 2 types are dengue virus PUO-218 strain; Described dengue virus 3 types are dengue virus PaH881-88 strain; Described dengue virus 4 types are dengue virus 814669 strains.

Wherein, the nucleotide sequence of described dengue virus prM-E gene is respectively shown in SEQ ID NO.4 ~ 7.

The nucleotide sequence of described embedded virus is shown in any one of SEQ ID NO.8 ~ 11.

The purposes of aforementioned embedded virus in the preparation dengue vaccine.

The present invention also provides a kind of dengue vaccine, and it is to be prepared from by aforesaid embedded virus.

The present invention has also offered the bacterial artificial chromosome of a kind of nucleotide sequence shown in SEQ ID NO.1.

The present invention utilizes encephalitis attenuated vaccine strain SA14-14-2 and bacterial artificial chromosome of the present invention, successfully made up the infection and encephalitis B virus infection sex clone, and be the gene skeleton with this infections clone, successfully made up and contained leather 1 type of stepping on, step on leather 2 types, step on the Japanese encephalitis/dengue chimeric virus of leather 3 types or 4-type dengue virus antigen gene prM-E, these embedded viruses can various human with production of vaccine with cell on growth and breeding, and growth characteristics are similar, can be used for the production that four serotypes are stepped on the leather vaccine, immunogenicity is strong, the titre height of the antibody that produces has a good application prospect.

Obviously, according to foregoing of the present invention, according to ordinary skill knowledge and the customary means of this area, not breaking away under the above-mentioned basic fundamental thought of the present invention prerequisite, can also make modification, replacement or the change of other various ways.

The embodiment of form is described in further detail foregoing of the present invention again by the following examples.But this should be interpreted as that the scope of the above-mentioned theme of the present invention only limits to following example.All technology that realizes based on foregoing of the present invention all belong to scope of the present invention.

Description of drawings

Figure 1B AC carrier is transformed (BAC53) back Hind Ⅲ ﹠amp; Kpn I double digestion proof diagram, 4 clones of swimming lane 1,2,3,4 for selecting, M is dna molecular amount standard DL15000);

The enzyme of the sub-plasmid pJEV5 ' of Fig. 2 JEV 5 ' half point structure is cut qualification result, and wherein the 1st swimming lane is DNA marker (DL15000); The 2nd swimming lane is plasmid vector pACNR; The 3rd swimming lane is that the F1 fragment is inserted into pACNR-F1 clone behind the carrier pACNR; The 4th swimming lane is that F1 fragment and F3 fragment are inserted into pACNR-F13 behind the carrier pACNR; The 5th swimming lane is that F1, F2 and F3 fragment are inserted into the sub-plasmid pJEV5 ' of 5 ' half point behind the carrier pACNR; The 6th swimming lane is that the sub-plasmid pJEV5 ' of 5 ' half point is carried out the result that enzyme is cut checking with restriction restriction endonuclease AscI and KasI, the 7th swimming lane is that the sub-plasmid pJEV5 ' of 5 ' half point is carried out the result that enzyme is cut checking with restriction restriction endonuclease BglII and KasI, the 8th swimming lane is that the sub-plasmid pJEV5 ' of 5 ' half point is carried out the result that enzyme is cut checking with restriction restriction endonuclease BglII and BspEI, the 9th swimming lane is that the sub-plasmid pJEV5 ' of 5 ' half point is carried out the result that enzyme is cut checking with restriction restriction endonuclease AscI and Xhol, and the 10th swimming lane is DNA marker (DL2000);

Fig. 3 pJFC total length plasmid structural representation, red arrow is represented the promoter sequence of artificial adding, and the AscI restriction enzyme site is to be used for clone's structure artificial the adding, and blue portion is represented encephalitis attenuated vaccine strain SA14-14-2 full-length cDNA;

Fig. 4 pJFC total length plasmid enzyme restriction qualification result, wherein swimming lane 1 is DNA marker DL15000; Swimming lane 2 is pJFC total length plasmid; The electrophoretogram that swimming lane 3 is cut through the HindIII enzyme for pJFC; The electrophoretogram that swimming lane 4 is cut through the BglII enzyme for pJFC; Swimming lane 5 is DNA marker DL2000;

Fig. 5 BAC53-JFC total length plasmid enzyme restriction qualification result, the wherein electrophoretogram cut through NotI and XhoI enzyme for BAC53-JFC of swimming lane 1; Swimming lane 2 is DNA marker DL2000; M is DNA markerDL15000;

Fig. 6 RT-PCR detects the electrophoresis result of rJEV.Swimming lane 1 is DNAmarker (λ DNA/HindIII), swimming lane 2 is DNA marker (DL2000), swimming lane 3 is pcr amplification F123 fragment, swimming lane 4 is pcr amplification F45 fragment, swimming lane 5 is that pcr amplification F67 fragment swimming lane 6 is pcr amplification F89 fragment, swimming lane 7 is pcr amplification F10 fragment, and swimming lane 8 is pcr amplification F11 fragment;

Fig. 7 indirect immunofluorescence detects rJEV result.Wherein A, B are respectively the results who detects with JEV E monoclonal antibody and JEV NS1 monoclonal antibody behind the attenuated strain JEV cells infected; C, D are respectively the results who detects with JEV E monoclonal antibody and JEV NS1 monoclonal antibody behind the viral rJEV cells infected of recovery; E, F are respectively that the cell that does not infect contrasts the result who detects with JEV E monoclonal antibody and JEV NS1 monoclonal antibody;

The plaque form of Fig. 8 rJEV and Vaccinum Encephalitidis Epidemicae strain JEV relatively;

Fig. 9 encephalitis/step on chimeric 5 ' half point of leather 1 type to clone pJD1-5 ' plasmid electrophorogram;

Figure 10 encephalitis/step on chimeric 5 ' half point of leather 1 type to clone the electrophorogram that pJD1-5 ' plasmid is used NotI and BglII double digestion;

The plasmid pJD1FC electrophorogram of the chimeric full-length clone of Figure 11 encephalitis/step on leather 1 type;

The plasmid pJD1FC of the chimeric full-length clone of Figure 12 encephalitis/step on leather 1 type is with the electrophorogram of NotI and XhoI double digestion;

The plasmid pJD1FC of the chimeric full-length clone of Figure 13 encephalitis/step on leather 1 type uses the electrophorogram of BamHI and XhoI single endonuclease digestion respectively;

The electrophorogram of the plasmid pJD1FC in-vitro transcription product of the chimeric full-length clone of Figure 14 encephalitis/step on leather 1 type;

Cytopathy behind the plasmid pJD1FC in-vitro transcription product transfectional cell BHK21 of the chimeric full-length clone of Figure 15 encephalitis/step on leather 1 type, left side figure be that the cell of untransfected contrasts, the right is the cytopathy after the transfection;

The pathology result of Figure 16 embedded virus JD1 after former generation, hamster kidney cell went down to posterity, the left side is the cell contrast of not infecting, the right is metainfective cytopathy;

The electrophorogram of the RT-PCR calibrating of Figure 17 embedded virus JD1, amplified fragments 1,2,3 is all consistent with expection;

The plaque detected result of Figure 18 encephalitis/step on leather 1 type embedded virus JD1;

Figure 19 encephalitis/step on and remove from office dengue virus 1 type E protein expression Westernblot detected result among the 1 type embedded virus JD1;

Figure 20 encephalitis/step on and remove from office the growth characteristics detected result of 1 type embedded virus JD1 on former generation hamster kidney cell PHK;

The immunogenicity detected result of Figure 21 encephalitis/step on leather 1 type embedded virus JD1;

Figure 22 encephalitis/step on the chimeric full-length clone pJD2FC of leather 2 types enzyme to cut evaluation.1 is DNAmarker (DL15000); 2 is the pJD2FC plasmid; 3 is pJD2FC plasmid HindIII restriction enzyme mapping; 4 is pJD2FC plasmid BglII restriction enzyme mapping; 5 is pJD2FC plasmid double digestion collection of illustrative plates (AscI+Xhol); 6 is pJD2FC plasmid double digestion collection of illustrative plates (BspEI+Xhol); 7 is DNA marker (DL2000);

The cytopathy of Figure 23 encephalitis/step on leather 2 type embedded virus JD2 on former generation hamster kidney cell, the left side is not for infecting control cells, and the right is the cytopathy behind the JD2 infection PHK cell;

Figure 24 RT-PCR detects the electrophorogram of embedded virus JD2.1 is DNA marker (DL15000); 2 is pcr amplified fragment F123; 3 is pcr amplified fragment F45; 4 is pcr amplified fragment F67; 5 is pcr amplified fragment F89; 6 is pcr amplified fragment F10; 7 is pcr amplified fragment F11;

Figure 25 indirect immunofluorescence detects encephalitis/the step on experimental result of leather 2 type embedded virus JD2.Wherein A, B, C are respectively with stepping on the result that leather 2 type monoclonal antibodies, JEV E monoclonal antibody and JEV NS1 monoclonal antibody detect behind the dengue 2-type virus cells infected; D, E, F are that embedded virus JD2 is respectively with stepping on the result that leather 2 type monoclonal antibodies, JEV E monoclonal antibody and JEV NS1 monoclonal antibody detect; G, H, I are that encephalitis recovers viral rJEV respectively with stepping on the result that leather 2 type monoclonal antibodies, JEV E monoclonal antibody and JEVNS1 monoclonal antibody detect; J, K, L are the results that the cell of uninfecting virus detects with the E monoclonal antibody of stepping on leather 2 type monoclonal antibodies, JEV and JEV NS1 monoclonal antibody respectively;

Figure 26 encephalitis/step on and remove from office 2 type embedded virus JD2 plaque form and sizes;

The growth curve of Figure 27 encephalitis/step on leather 2 type embedded virus JD2 on former generation hamster kidney cell;

The immunogenicity detected result of Figure 28 encephalitis/step on leather 2 type embedded virus JD2;

Figure 29 has the encephalitis of 8 base deletions/step on the leather pJD3-5 ' double digestion of the chimeric 5 ' half point of 3 types (Kas I/Bgl II) to identify electrophorogram;

Figure 30 merges pcr amplification 1-3446 fragment, eliminates 8 bases of disappearance;

Figure 31 encephalitis/step on the sub-BAC53JD3-5 ' double digestion of the chimeric 5 ' half point of leather 3 types to identify electrophorogram, swimming lane 1 is BamH I single endonuclease digestion, swimming lane 2 is Asc I/BamH I double digestion;

Figure 32 is used for making up the JEV-F11 fragment PCR amplification electrophorogram of the sub-pJEV-3 ' of JEV 3 ' half point (Sal I) that contains the SalI restriction enzyme site;

Figure 33 contains the sub-pJEV3 ' of JEV3 ' half point (Sal I) enzyme of SalI restriction enzyme site and cuts the evaluation electrophorogram, and swimming lane 1 is Xho I/Xba I double digestion, and swimming lane 2 is the SalI/XbaI double digestion;

Figure 34 encephalitis/stepping on the chimeric full-length clone BAC53JD3FC of leather 3 types plasmid carries out the electrophorogram that enzyme is cut evaluation with HindIII restriction restriction endonuclease, and swimming lane 1 is the pJD3 plasmid, and M1 is molecular weight standard DL 15,000, and M2 is molecular weight standard DL2, and 000;

Figure 35 encephalitis/stepping on the chimeric full-length clone BAC53JD3FC of leather 3 types plasmid carries out the electrophorogram that enzyme is cut evaluation with XhoI restriction restriction endonuclease, and swimming lane 1 is the pJD3 plasmid, and M is molecular weight standard DL15, and 000;

Figure 36 encephalitis/step on the chimeric full-length clone BAC53-JD3FC of leather 3 types in-vitro transcription RNA electrophorogram, 1 is in-vitro transcription RNA, and M1 is molecular weight standard DL15, and 000, M2 is molecular weight standard DL2,000;

The pathology situation of Figure 37 PHK cell compares (left side) with control cells, and obvious CPE appears in the cell (right side) that has infected encephalitis/step on leather 3 type embedded viruses;

Figure 38 encephalitis/step on leather 3 type embedded viruses adopt steps on leather 1 ~ step on the RT-PCR qualification result of the special detection primer of leather 4 types, only steps on leather 3 types and detects primer amplification and go out the fragment that length is 615bp;

Figure 39 encephalitis/step on the plaque detected result of leather 3 type embedded viruses, the virus titer that obtains according to plaque counting is 5.93lgPFU/ml;

Figure 40 encephalitis/step on leather 3 type embedded virus growth curves are 0.001 to be best infective dose according to MOI as a result;

Figure 41 encephalitis/step on the Western blot that removes from office 3 type embedded viruses to identify.The result shows that embedded virus can be observed clear band in the dengue virus E protein corresponding position, and encephalitis b virus is not seen band;

The immunogenicity determining result of Figure 42 encephalitis/step on leather 3 type embedded virus JD3;

The electrophoretogram of Figure 43 encephalitis/step on leather 4 types 5 ' half point clone pJD4-5 ' plasmid.PJD4-5 ' half plasmid size is 6.3kb;

The enzyme of Figure 44 encephalitis/step on leather 4 types 5 ' half point clone pJD4-5 ' plasmid is cut the evaluation collection of illustrative plates.PJD4-5 ' plasmid is 4.1kb and 2.2kb fragment through KasI and BglII double digestion;

The electrophoretogram of Figure 45 encephalitis/step on leather 4 type full-length clone pJD4FC plasmids.PJD4FC plasmid size is 13.6kb;

Figure 46 encephalitis/step on the enzyme of removing from office 4 type full-length clone pJD4FC plasmids to cut the evaluation collection of illustrative plates.The pJD4FC plasmid is 8.9kb and 4.7kb fragment through BspEI and MluI double digestion;

The electrophoretogram of Figure 47 pJD4FC in-vitro transcription product;

The pathology situation of Figure 48 BHK21 cell is compared with control cells on (left side), transfection the cell (right side) of pJD4FC in-vitro transcription thing obvious CPE appears;

The pathology situation of Figure 49 PHK cell is compared (left side) with control cells, and obvious CPE appears in the cell (right side) that has infected encephalitis/step on leather 4 type embedded virus JD4;

Figure 50 encephalitis/step on the RT-PCR qualification result of leather 4 type embedded viruses adopts 4 pairs of primers to amplify the fragment that length is 2078bp, 2155bp, 820bp and 1608bp respectively;

Figure 51 encephalitis/step on the plaque detected result of leather 4 type embedded viruses, the virus titer that obtains according to plaque counting is 5.99lgPFU/ml;

The growth curve of Figure 52 Japanese encephalitis/dengue chimeric virus in the PHK cell;

The Western blot of Figure 53 Japanese encephalitis/dengue chimeric virus identifies.The result shows that embedded virus can be observed clear band in the dengue virus E protein corresponding position, and encephalitis b virus is not seen band;

The immunogenicity detected result of Figure 54 encephalitis/step on leather 4 type embedded virus JD4.

Concrete embodiment

Embodiment 1: contain the recovery of structure, evaluation and the recombinant virus of the full-length infectious full length cDNA clone of JEV vaccine strain SA14-14-2

One, the transformation of carrier

(1) transformation of low copy plasmid pACNR

Dissolve primer Oligo-1(5'-CGCGCCATTA respectively GGCGCCTTAT AGATCTAATG TCCGGATTAT GGATCCTGAT TGATCATTAT TCTAGAATTAC-3', underscore place are followed successively by KasI, BglII, BspEI, BamHI, BclI, XbaI recognition site, synthetic) and Oligo-2(5'-TCGAGTAAT TCTAGAATAA TGATCAATCA GGATCCATAA TCCGGACATT AGATCTATAA GGCGCCTAATGG-3', after forming complementary two strands with Oligo-1,5' and 3' end form Ascl respectively and the Xhol enzyme is cut the back cohesive end, synthetic) in 100 μ l sterilization distilled water, respectively getting 10 μ l mixes, naturally cooling after being heated to 100 ℃, getting 2 μ l is connected in 4 ℃ with pACNR with AscI and Xhol double digestion and spends the night, transformed competence colibacillus cell TOP10(TIANGEN Biotech (Beijing) Co., Ltd.), picking amicillin resistance clone extracting plasmid is done order-checking and is identified (the English Weihe River, Shanghai Jie Ji Bioisystech Co., Ltd).

Sequencing result shows: the polyclone district of the implanted plasmid of restriction enzyme site obtains the pACNR plasmid of polyclone position point through transforming.

(2) transformation of BAC53 carrier

Be the following three pairs of primers of stencil design with carrier pBAC53e3.6 sequence at first:

BAC53F1：

5-G AAGCTTGGATCCGCATGCGTCGACCTCGAGThe part polyclone restriction enzyme site of CAATTCTCATGTTTGACAGCTTATCAT-3(line part for adding is followed successively by the Hind III, BamH I, Bsiw I, Sal I and Xho I)

BAC53R1：

5-TT GGTACCTCTAGA ACGCGTGGCTTCGCCCTGTCGCTCG-3(line part is restriction endonuclease digestion site, Kpn I and Mlu I, the wherein restriction enzyme site of MluI for introducing)

BAC53F2:5-GG ACGCGTTGAGCGAGGAAGCACCAGGGAAC-3(line part is the artificial restriction endonuclease digestion site Mlu I that adds)

BAC53R2:5-TGAATATGAAGATCT GGTACCCATCCGTGA-3(line part is restriction endonuclease digestion site Kpn I)

BAC53F3:5-GG ACGCGTCCTCAATGTATCACGGATG GGTACCAGATCT-3(line part is restriction endonuclease digestion site, Mlu I and Kpn I, the wherein restriction enzyme site of MluI for introducing)

BAC53R3：

5-GG AAGCTTGGCGCCGGCGCGCCGCTAGC GCGGCCGCThe part polyclone restriction enzyme site of AGCGACACACTTGCATCGGATGC-3(line part for adding is followed successively by the Hind III, Kas I, Asc I and Not I)

Getting 2 μ l pBAC53e3.6 plasmid DNA is template, respectively with primer BAC53F1 and BAC53R1, BAC53F2 and BAC53R2, BAC53F3 and the corresponding PCR fragment of BAC53R3 pairing amplification, called after BAC53-P1, BAC53-P2, BAC53-P3 respectively.Used archaeal dna polymerase is U.S. NEB company

Super fidelity dna polysaccharase, amplification condition is: 98 ℃ of pre-sex change of 2min; 98 ℃ of 10sec, 58 ℃ of 15sec, 72 ℃ of 1.5min, 30 circulations; 72 ℃ of 10min.The dna fragmentation of amplification adds the A reaction with the archaeal dna polymerase LA of TaKaRa company: 10 * LA buffer, 1 μ l, dNTP1 μ l, DNA 7.5 μ l, LA 0.5 μ l, 72 ℃ of 30min. reactions finish, and pGEM-T easy carrier direct and PROMEGA company carries out ligation.2 * Rapid ligation buffer, 5 μ l, pGEM-T easy1 μ l adds the PCR product 3 μ l of A, T4DNA ligase 1 μ l, 4 ℃ of connections are spent the night.Connect product transformed competence colibacillus cell TOP10, be laid on the penbritin LB flat board that contains 100ug/ml, next day, the colourless bacterium colony of picking increases bacterium to be cultivated, the evaluation of checking order of extracting plasmid.

The clone of above-mentioned three fragments that order-checking is correct cuts digestion with limiting restriction endonuclease HindIII and MluI, MluI and KpnI, KpnI and HindIII enzyme respectively, reclaim fragment BAC53-P1, BAC53-P2, BAC53-P3, T4DNA ligase1 μ l, 4 ℃ of connections are spent the night.Connect product transformed competence colibacillus cell DH10B, be laid on the LB flat board that contains 25ug/ml paraxin, next day, the colourless bacterium colony of picking increases bacterium to be cultivated, evaluations of checking order of extracting plasmid, and called after BAC53, through checking order, its sequence is shown in SEQ ID NO.1.

Carry out enzyme with restriction restriction endonuclease Hind III and Kpn I and cut checking, as shown in Figure 1, restriction enzyme mapping is with theoretical consistent.

Two, the preparation of JEV attenuated strain SA14-14-2 virus cDNA

(1) extracting of JEV attenuated strain SA14-14-2 viral RNA

JEV vaccine virus (SA14-14-2 strain) is produced by Chengdu Institute of Biological Products Co., Ltd., by specification redissolves, get 400 μ l virus liquid and carry out the extracting (by specification carries out) of RNA with the RNA extraction agent box (Highpure viral RNA kit) of Roche company production, RNA be stored in-80 ℃ standby.

(2) reverse transcription of viral cDNA

The viral RNA (getting 11 μ l respectively) that extracts is used two primer RR5 (5'-GACTGCTTCCTGTGATTGCA-3') and RR13 (5'-AGATCCTGTGTTCTTCCT CACCACCAGCTACA-3') retrovirus cDNA respectively, used kit is the SuperS criptTM III Reverse Transcriptase of Invitrogen company, primer is synthetic by the English Weihe River, Shanghai Jie Ji Bioisystech Co., Ltd, and method reference reagent box specification sheets carries out.

(3) pcr amplification of viral cDNA fragment and order-checking

Getting viral cDNA 2 μ l is template, difference primers F 1 and R1, F2 and R3, F4 and R4, F5 and R6, F7 and R8, F9 and R10, F11 and R11 pairing amplification corresponding cDNA fragment (primer information sees Table 1), used archaeal dna polymerase is the PrimeSTAR of TaKaRa company, (Touch-down PCR) increases with touchdown PCR, and amplification condition is: 98 ℃ of 2min; 98 ℃ of 10sec, 72 ℃ of kb/min of 58.5 ℃ → 53.5 ℃ 10sec, 10 circulations; 53.5 ℃ of 10sec of 98 ℃ of 10sec, 72 ℃ of kb/min, 20 circulations; 72 ℃ of 10min.The dna fragmentation of amplification adds the A reaction with the archaeal dna polymerase LA of TaKaRa company: 10 * LAbuffer1 μ l, dNTP 1 μ l, DNA 7.5 μ l, LA 0.5 μ l, 72 ℃ of 30min. reactions finish, and T carrier pMD19-T direct and TaKaRa company carries out ligation.2 * ligation buffer, 5 μ l, pMD19-T1 μ l adds the PCR product 3 μ l of A, ligase1 μ l, 4 ℃ of connections are spent the night.Connect product and be laid on the LB flat board that contains penbritin, IPTG and X-gal, next day, the colourless bacterium colony of picking increases bacterium to be cultivated, and the extracting plasmid carries out the enzyme evaluation of cutting and check order.

Table 1 clone the primer

The result shows: be template with cDNA, amplified and corresponding 7 dna fragmentations of theoretical size that size is respectively 0.5kb, 2.2kb, 0.8kb, 2.1kb, 1.5kb, 2.1kb, 1.8kb.And 7 fragments all successfully are cloned into pMD19-T, and sequencing result shows: the silent mutation for introducing, all fragments all do not have the base sudden change, insert and disappearance except fragment 1 and 2 people.

Three, the structure that contain JEV 5 ' half point (base 1-3450) plasmid, contains JEV 3 ' half point (3445-10977) plasmid and contain JEV virus full-length cDNA carrier

(1) structure and the enzyme that contains JEV 5 ' half point (base 1-3450) plasmid cut evaluation

(size is respectively 0.5kb 3 amplified fragments of 5 ' end by the program of Fig. 1,2.2kb, 0.8kb) be cloned into successively among the pACNR that step 1 prepares with AscI and KasI, KasI and BglII, BglII and BspEI respectively, obtain containing the sub-plasmid pJEV5 ' of JEV 5 ' half point.

The result shows: 3 dna fragmentations that vary in size successfully are cloned in the low copy plasmid, see Fig. 2.

(2) contain structure and the evaluation of JEV virus full-length cDNA

4 dna fragmentations splicing of the 3 ' end that increases and be cloned into corresponding restriction enzyme site among the pJEV5 ', obtain containing the plasmid of JEV full-length cDNA by the described method of Fig. 3, called after pJFC, its structural representation is seen Fig. 3.

With restriction enzyme NotI and XhoI the encephalitis full-length cDNA on the pJFC is downcut simultaneously, be inserted in the bacterial artificial chromosome (BAC53), be built into JEV full-length clone BAC53-JFC.

With big extraction reagent kit (the QIAfilter Plasmid Maxi Kit) large quantity extracting plasmid of QIAGEN company, serve the order-checking of extra large English Weihe River Jie Ji Bioisystech Co., Ltd, and with restriction enzyme plasmid is carried out enzyme simultaneously and cut evaluation.

The result shows: enzyme is cut the result and theory matches (seeing Fig. 4,5); According to the order-checking collection of illustrative plates, shown in SEQ ID NO.2 and 3, except the silent mutation of artificial the 378th Nucleotide of introducing of C protein gene, all the other each several parts of JEV virus do not have base sudden change, insertion and lack the sequence that can read pJFC and this BAC53-JFC respectively.

(3) contain structure and the evaluation of JEV 3 ' half point (3445-10977) plasmid

With BspEI and Xhol double digestion plasmid pJFC, reclaim the dna fragmentation of 7.5kb size, be connected Screening and Identification recon, called after pJEV3 ' with the low copy plasmid pACNR that cuts with same enzyme.

Enzyme is cut with sequencing result and is shown: contain the success of JEV 3 ' half point (base 3445-10977) plasmid construction.

Four, the in-vitro transcription of JEV full-length infectious CDNA clones, transfection and JEV recover the rescue of virus (rJEV) and go down to posterity

In 37 ℃ with the about 3h of Xhol digestion pJFC after, add mung-bean nuclease in 30 ℃ of effect 30min, adding final concentration is the SDS deactivation mung-bean nuclease of 1g/L, the PCR product reclaims test kit and reclaims linearizing endonuclease bamhi, be template to reclaim fragment, with U.S. Promega company in-vitro transcription test kit (Promega RiboMAX Large Scale RNA Production Systems-SP6) in-vitro transcription RNA, electrotransfection BHK21 cell, 37 ℃, 5% CO ₂Cultivate 5d, to obvious cytopathy occurring, collect nutrient solution supernatant, called after rJEV with freeze-thaw method.Get the viral supernatant of the first-generation (P1) and do virus titer mensuration in the BHK21 cell.And with supernatant inoculation BHK21 cell, the method for results supernatant is carried out virus and is gone down to posterity.

The result shows: transfection BHK21 cell 5 days, pathology appears in visible cell.Virus titer is about 6.0lgPFU/ml, and the hamster kidney cell rJEV that goes down to posterity recovers virus titer and can reach 7.5lgPFU/ml in former generation, and is similar to vaccine strain.

Five, the evaluation of recombinant virus rJEV

(1) RT-PCR identifies

Get the viral supernatant of the third generation (P3), with Roche Holding Ag's high purity viral RNA extraction agent box (HighPure Viral RNA Kit) extracting rJEV viral RNA, use primer

RR5(5'-GACTGCTTCCTGTGATTGCA-3')

With RR 13 (5'-AGATCCTGTGTTCTTCCTCACCACCAGCTA CA-3 ') retrovirus cDNA, as template, carry out pcr amplification with primers F 1 and R3, F4 and R5, F6 and R7, F8 and R9, F10 and R10, F11 and R11 pairing respectively, serve extra large English Weihe River Jie Ji Bioisystech Co., Ltd behind the gained PCR fragment purification and carry out sequencing.

The result shows: PCR clip size and theory match, and (size is respectively 2.6kb, 2.1kb, 1.8kb, 1.7kb, 1.0kb, 1.8kb), see Fig. 6, sequencing result shows and contains the silent mutation of artificial introducing by C protein gene the 378th bit base (A → C), all the other do not find base mutation everywhere.

(2) identified by immunofluorescence is recovered virus

Inoculation 3 * 10 ⁴Individual LLC-MK2 cell next day, treats that cell grows up to individual layer in 96 orifice plates, press 103PFU/ hole inoculation P3 virus in the hole, in 37 ℃, 5% CO2 cultivated 2 days, inhaled and removed nutrient solution, PBS washs 1 cell, add fixedly 20min of methyl alcohol room temperature, discard methyl alcohol, PBS washing 3 times, add 0.2%Tritonx-100 room temperature permeable membrane 10min, PBS washing 1 time adds anti-JEV E protein monoclonal antibody (1:10, U.S. Abcam company), hatch 1h for 37 ℃, PBS washing 3 times, the goat-anti mouse two that adds the FITC mark resists (1:100, U.S. Santa Crus company), hatch 1h for 37 ℃, PBS washing 3 times, fluorescence microscope is also taken pictures, and sees Fig. 7.

(3) rJEV plaque on the BHK21 cell forms

In six orifice plates, cultivate the BHK21 cell, treat that the cytogamy degree reaches about 80%-90%, inoculation P3 recombinant virus and vaccine strain, 37 ℃ of absorption 1h, the coverture final concentration is the low melting-point agarose of 10g/L, and the violet staining with 10g/L after 37 ℃, 5%CO2 are cultivated 5d detects virus titer, plaque form and size.

The result shows: rJEV can form the similar plaque of size and form with JEV vaccine strain SA14-14-2 on the BHK21 cell, see Fig. 8.

(4) detection of rJEV neurovirulence

With recovering virus inoculation BALB/c mouse in 4 age in week, 0.03ml(contains viral 3.5lgPFU respectively)/only and 3-5 days BALB/c suckling mouses, 0.02ml(contains viral 3.3lgPFU)/only, and each 10, raised 14 days, observe viral neurovirulence.

Experimental result sees Table 2

Table 2 recovers viral neurovirulence and detects

Experimental result shows, the present invention has successfully made up the infection and encephalitis B virus infection sex clone that contains the JEV full-length cDNA: pJFC and BAC53-JFC, use this infections clone can obtain to recover virus, recover virus and can grow at the BHK21 cell, can be used as the gene skeleton.

Embodiment 2: preparation and the evaluation of encephalitis/step on leather 1 type embedded virus

One, the preparation of encephalitis/step on leather 1 type embedded virus

1, dengue virus 1 type antigen gene prM-E fragment is synthetic

Get the gene fragment prME(of dengue virus 1 type ThD1000881 strain coding E albumen shown in SEQID NO.4), after the Nucleotide replacement of 9 Nucleotide with the corresponding site of encephalitis b virus SA14-14-2 strain with coding E protein carboxyl groups end protein in this fragment, merge with N-terminal 204 Nucleotide of encephalitis b virus SA14-14-2 strain NS1 protein gene.

Then this fragment is inserted into the pcDNA3.1 carrier, obtains the plasmid clone pcDNA3.1-D1PrME of dengue virus 1 type antigen gene prM-E.

2, the structure of encephalitis/step on leather 1 type 5 ' half point

With the above-mentioned pcDNA3.1-D1prM-E plasmid of dengue virus 1 type antigen gene prM-E that contains with the BglII single endonuclease digestion, remove the part (BglII 13-BglII 900) between two BglII restriction enzyme sites of pcDNA3.1-D1prM-E plasmid, adopt the Qiaquick Gel extraction kit of QIAGEN company to reclaim the 6.7kb fragment, make this fragment from connecting and transforming the TOP10 competent cell with the T4DNA ligase of U.S. NEB company again, selected clone carries out plasmid with the Qiaprep spin miniprep kit of QIAGEN company and extracts in a small amount and connect and carry out enzyme and cut checking, resulting plasmid called after pcDNA3.1-D 1prM-E (MOD).

With restriction restriction endonuclease NotI and KasI difference double digestion pJEV-5 ' plasmid and pcDNA3.1-D1prM-E (MOD) plasmid, glue reclaims the fragment of the 728bp behind the pJEV-5 ' plasmid enzyme restriction, with its with NotI and KasI double digestion after pcDNA3.1-D1prM-E (MOD) plasmid be connected called after pJD1-2650.

And then with BglII single endonuclease digestion pJEV-5 ' plasmid and pJD1-2650 plasmid, wherein reclaim the short-movie section of the 1241bp of BglII single endonuclease digestion pJFC plasmid, be inserted in the pJD1-2650 of BglII single endonuclease digestion plasmid, enzyme is cut the plasmid that checking 1241 fragment forwards insert, thereby acquisition encephalitis/step on chimeric 5 ' half point of leather 1 type to clone called after pJD1-5 ' (Fig. 9 and 10).

3, the structure of encephalitis/step on leather 1 type full-length clone

With restriction enzyme NotI and the above-mentioned pJD1-5 ' of BspEI double digestion, reclaim the 3.7kb fragment, the plasmid clone pJFC that contains the encephalitis full-length cDNA with BspEI and XhoI double digestion, reclaim the 7.5kb fragment, with T4DNA ligase two fragments are carried out external connection, glue reclaims and connects product (11.2kb).

Also reclaim again with the product that is connected that the XhoI double digestion reclaims with NotI, use NotI and XhoI double digestion BAC53 plasmid simultaneously, reclaim the 6.4kb fragment, connect two fragments with T4DNA ligase, transform the TOP10 competent cell, extract in a small amount plasmid and carry out enzyme and cut and identify and order-checking, obtain to contain encephalitis/the step on plasmid of the chimeric full-length clone of leather 1 type, called after pJD1FC.

Enzyme is cut the result shown in Figure 11,12 and 13, according to the order-checking collection of illustrative plates, can read the pJD1FC sequence shown in SEQIDNO.8.

4, the preparation of encephalitis/step on leather 1 type embedded virus in-vitro transcription thing RNA

With the XhoI restriction enzyme linearizing of pJD1FC plasmid, with the PureLinkPCR purification kit purifying linearizing product of Invitrogen, adopt the Ribomax largescale RNA production system-SP6 of Promega company to carry out in-vitro transcription then.40 μ l reaction systems comprise: 5 * transcript buffer, 8 μ l, rATP(100mM) 2 μ l, rCTP(100mM) 2 μ l, rUTP(100mM) 2 μ l, rGTP(100mM) 0.7 μ l, m7G cap analog(40mM) 3 μ l, enzyme mix 4 μ l, linearizing product 18.3 μ l.Reaction system in 37 ℃ hatch 4h after, add 2 μ l RNase-free DNase in 37 ℃ of digestion template 30min, use the Rnease Mini kit purifying RNA product of QIAGEN company then, in-70 ℃ of preservations standby (Figure 14).

5, the rescue of encephalitis/step on leather 1 type embedded virus

Disperse the BHK21 cell with pancreatin, the centrifugal 5min of 800rpm, with precooling PBS washed cell 2 times, with 160 μ l PBS re-suspended cells, the PBS that adds the above-mentioned RNA(control cells adding of 5-10 μ g equal volume), mixing with voltage 140V, burst length 25ms, pulse 1 time, carries out electricity with the Genepulser Xcell of Bio-Rad and changes.Then cell is placed 6min on ice, change over to again in the MEM growth media, 37 ℃ of cultivations.Next day nutrient solution is replaced by MEM and keeps liquid, continue to cultivate 4～6 days, obvious CPE appears in experimental group BHK21 cell, and control cells does not have pathology (Figure 15).With sick cell and supernatant liquor multigelation 3 times, the centrifugal 10min of 4000rpm, the results supernatant liquor, after the packing in-70 ℃ of preservations, the first-generation embedded virus called after JD1(P1 of acquisition).

6, the cultivation of going down to posterity of encephalitis/step on leather 1 type embedded virus

Get above-mentioned embedded virus JD10.5ml and inoculate former generation hamster kidney cell (PHK cell), behind 37 ℃ of absorption 1h, add the MEM substratum, be cultured to cell and CPE occurs.Draw supernatant liquor, the centrifugal 10min of 4000rpm, the supernatant liquor of results are s-generation embedded virus JD1(P2), after the packing in-70 ℃ of preservations.By the same way JD1 was uploaded to for the 10th generation at the PHK cell, embedded virus is carried out every evaluation (Figure 16) therebetween.

Two, the discriminating of encephalitis/step on leather 1 type embedded virus

1, the RT-PCR of encephalitis/step on leather 1 type embedded virus identifies

Extract s-generation embedded virus JD1(P2 with the High pure viral RNA kit of Roche) RNA, and with the Super of Invitrogen

III Reverse Transcriptase is cDNA with embedded virus RNA reverse transcription.Be template with this cDNA, carry out pcr amplification with the PrimeSTAR HS DNA polymerase of TaKaRa.Primer sequence is as follows: first pair: upstream primer 5'-ACCAACATTGGACATTGAACTCT-3', downstream primer 5'-GGTCCGGACCAGTCTAGTGACAGATCTGACTC-3', product length 1570bp; Second pair: upstream primer 5'-GTGAGGACACAATGACTTAC-3', downstream primer 5'-GGTCCGGACCAGTCTAGTGACAGATCTGACTC-3', product length 2048bp; The 3rd pair: upstream primer 5'-TTGGCGCGCCATTTAGGTGACACTATAGAGAAGTTTATCTGTGTGAACTTCTT-3', downstream primer 5'-GTTGGCTGTTATCACTCTCC-3', product length 2067bp.Amplified production all meets expection (Figure 17).

2, the plaque of encephalitis/step on leather 1 type embedded virus detects

With BHK21 cell inoculation to six orifice plate, carry out plaque and detect.As diluent, respectively each generation embedded virus is carried out 10 times of dilutions with the MEM nutrient solution.Add each dilution viral liquid 400 μ l respectively, in 37 ℃ of absorption 60min.In every hole, add 1% low melting-point agarose 2ml, wait to solidify the back in 37 ℃ of cultivations.Every hole adds fixedly 60min of 4% Paraformaldehyde 96 2ml after 5 days, with the dyeing of Viola crystallina dye liquor, observes the plaque form and calculates virus titer (Figure 18) according to plaque quantity.

3, the Western blot of encephalitis/step on leather 1 type embedded virus identifies

Third generation embedded virus JD1(P3) adds 20 μ l, 5 * protein loading buffer among the 80 μ l, boiling water boils 10min behind the mixing, the centrifugal 1min of 10000rpm, get supernatant liquor and carry out the SDS-PAGE electrophoresis, albumen is transferred to nitrocellulose filter, with 5% skimmed milk room temperature sealing 1h, use dengue virus 1 type E protein polyclone antibody in 4 ℃ of overnight incubation then.PBS washes film, uses the goat anti-rabbit igg incubated at room 1.5h of AP mark then.PBS develops the color with BCIP/NBT alkaline phosphatase colouring reagents box (the green skies, Shanghai) after washing film.The result shows that embedded virus can be observed clear band at the 55kD place, and consistent with the dengue virus E protein size, the result meets expection (Figure 19).

4, the growth characteristics analysis of encephalitis/step on leather 1 type embedded virus

Keep liquid with JD1(P2 with MEM) viral liquid dilution, be 0.1,0.01,0.001 infection with MOI, the PHK cell is in 37 ℃ of absorption 120min.Add MEM and keep liquid 20ml, in 37 ℃ of cultivations.Extracted the 0.5ml supernatant liquor every 12 hours ,-70 ℃ standby, keeps liquid with 0.5ml MEM and supply volume, and sample collecting is to inoculating back 96 hours.The plaque method is measured the virus titer of each time point sample of different MOI, draws the growth curve (Figure 20) of JD1 virus in the PHK cell.

The result shows that 0.001-0.01MOI is between the best infective dose of virus, can gather in the crops the most viral liquid of high virus titer.

5, the immunogenicity experiments of encephalitis/step on leather 1 type embedded virus

(1) immunogen preparing

The third generation encephalitis of PHK cell cultures/step on leather 1 type embedded virus as immunogen.It is standby with MEM nutrient solution (Gibco) virus quantity to be adjusted to 5logPFU/ml.

(2) laboratory animal and grouping

60 female 4 the week age BALB/c mouse provided by Chengdu Institute of Biological Products Co., Ltd..Mouse is divided into 2 groups at random, 30 every group: (1) JD1 embedded virus immune group; (2) negative control group (MEM basic medium).

(3) immunization protocol

Get above-mentioned viral liquid and MEN nutrient solution, fully behind the mixing, respectively by the peritoneal immunity mouse, 500 μ l/ only.2 weeks with identical approach and dosage booster shot once behind the initial immunity.Initial immunity begins blood sampling after 3 weeks, after this per 2 weeks 1 time each 5, amount to 6 times to finishing in the 13rd week.Separation of serum, with 56 ℃ of deactivations after 10 times of the PBS dilutions 30 minutes ,-20 ℃ of preservations were standby.

(4) inspection of immune serum NAT

Above-mentioned serum sample (1:10) is carried out doubling dilution to 1:640 with serum dilution (PBS) according to 1:2, get every extent of dilution sample 200ul respectively and contain 50-100 dengue virus 1 type with volume and mix, in 37 ℃ and 1 hour, join on six orifice plates that cover with the BHK21 cell, cultivate after 5 days, with violet staining for 37 ℃.Do not do negative control to add sero-fast MEM substratum.With the serum-concentration of the high dilution that reduces by 50% viral plaque number as NAT.

The result shows, behind the encephalitis/step on leather 1 type embedded virus immune mouse, can produce the neutralizing antibody of special anti-homotype dengue virus, and antibody titer can reach 1:34.82(and see Figure 21).

Experimental result explanation, the present invention successfully make up and have obtained encephalitis/step on leather 1 type embedded virus, and this embedded virus can massive duplication, can grow at the BHK21 cell, and the NAT height of generation can be prepared as and steps on the leather vaccine.

Embodiment 3 encephalitis/step on the structure of leather 2 type embedded virus full-length cDNA plasmids, viral recovery and important biomolecule to learn CHARACTERISTICS IDENTIFICATION

One, the structure of encephalitis/step on leather 2 type embedded virus full-length cDNA plasmids

1, the DEN2prM/E protein coding gene is synthetic

Get the gene fragment prM-E(of DEN2PUO-218 strain coding E albumen shown in SEQ ID NO.5), after the Nucleotide replacement of 9 Nucleotide with the corresponding site of encephalitis b virus SA14-14-2 strain with coding E protein carboxyl groups end protein in this fragment, merge with 204 Nucleotide of encephalitis b virus SA14-14-2NS1 protein gene 5 ' end, be inserted among the carrier pMD18-T, be used for the structure of chimeric full-length clone.

2, the structure of the sub-plasmid pJE/DEN2-5 ' of encephalitis/the step on leather chimeric fragment 5 ' half point of 2 types

Synthetic gene fragment prM/E(is comprised N-terminal 204 Nucleotide of coding JEV NS1) cut with restriction restriction endonuclease KasI and BglII enzyme, reclaim the dna fragmentation of 2.1kb, simultaneously with two identical restriction restriction endonuclease cutting 5 ' half point clone pJEV5 ', and reclaim big fragment (4.0kb), two fragments are connected and transformed competence colibacillus cell TOP10, select positive colony and carry out enzyme cut and check order evaluation and called after pJD2-5 '.

3, structure and the evaluation of encephalitis/step on leather 2 type full-length cDNA plasmids

With the encephalitis that makes up/step on the sub-plasmid pJE/DEN2-5 ' of leather 2 types, 5 ' half point with the sub-plasmid pJEV3 ' of encephalitis 3 ' half point cuts with limiting restriction endonuclease BspEI and XhoI enzyme simultaneously, reclaiming size respectively is the dna fragmentation of 6.1kb and 7.5kb, connect and transformed competence colibacillus cell TOP10, select positive colony and carry out that plasmid extracts, enzyme is cut checking and called after pJD2FC is identified in the total length order-checking.

Enzyme is cut the result as shown in figure 22, according to the order-checking collection of illustrative plates, can read the sequence of pJD2FC shown in SEQ IDNO.9.

4, the acquisition of the in-vitro transcription of viral RNA, transfection and embedded virus and going down to posterity

In 37 ℃ with Xhol digestion pJD2FC 3h after, add mung-bean nuclease in 30 ℃ of effect 30min, adding final concentration is the SDS deactivation mung-bean nuclease of 1g/L, the PCR product reclaims test kit and reclaims linearizing endonuclease bamhi, be template to reclaim fragment, with in-vitro transcription test kit in-vitro transcription RNA, and reclaim test kit with RNA and reclaim RNA, behind the electrotransfection BHK21 cell (the electrotransfection condition is 140 volts of voltages), be transferred in the T-25 culturing bottle, cultivate 5d in 37 ℃, 5% CO2, collect nutrient solution supernatant, called after JD2 with the method for multigelation.Detect virus in the supernatant with the plaque detection method, and inoculate the PHK cell with the 0.5ml supernatant and carry out virus and go down to posterity.

The result shows: transfection BHK21 cell 5 days, do not see that pathology appears in cell.But can detect virus in the supernatant, virus titer is about 3log10PFU/ml.With supernatant inoculation PHK cell, about 30h, can make the PHK cell cytopathic effect (Figure 23) occur.

Two, the evaluation of encephalitis/step on leather 2 type embedded viruses

1, the RT-PCR of encephalitis/step on leather 2 type embedded viruses identifies

Get p3 for viral supernatant, with high purity viral RNA extraction agent box extracting embedded virus RNA, with primer RR5 (5'-GACTGCTTCCTGTGATTGCA-3 ') and RR13 (5'-AGATCCTGTGTTCTTCCTCACCACCAGCTACA-3 ') retrovirus cDNA, as template, carry out pcr amplification with primers F 1 and R3, F4 and R5, F6 and R7, F8 and R9, F10 and R10, F11 and R11 pairing respectively, serve extra large English Weihe River Jie Ji Bioisystech Co., Ltd behind the gained PCR fragment purification and carry out sequencing.

The result shows: PCR clip size and theory match and (are respectively 2.6kb, 2.1kb, 1.8kb, 1.7kb 1.0kb 1.8kb) (sees Figure 24), sequencing result shows to have the silent mutation of artificial introducing by C protein gene the 378th bit base (A → C), all the other do not find base mutation everywhere.

2, identified by immunofluorescence embedded virus JD2

Inoculate 3 * 104 vero cells in 96 orifice plates, next day, treat that cell grows up to individual layer, press 103PFU/ hole inoculation p3 for virus in the hole, in 37 ℃, 5% CO2 cultivated 2 days, inhaled and removed nutrient solution, PBS washs 1 cell, add fixedly 20min of methyl alcohol room temperature, discard methyl alcohol, PBS washing 3 times, add 0.2%Tritonx-100 room temperature permeable membrane 10min, PBS washing 1 time adds anti-JEV E protein monoclonal antibody (Abcam company product, 1:10 dilution), hatch 1h for 37 ℃, PBS washing 3 times, the goat-anti mouse two that adds the FITC mark resist (Santa Cruz company product, 1:100 dilution), hatch 1h for 37 ℃, PBS washing 3 times, inverted fluorescence microscope (Olympus company product) is observed and is taken pictures, and the results are shown in Figure 25.

3, JD2 plaque on the BHK21 cell forms and reaches at PHK cell growing state

Digestion BHK21 cell, treat that the cytogamy degree reaches about 80%-90%, p3 is for recombinant virus and vaccine strain in inoculation, 37 ℃ of absorption 1h, the coverture final concentration is the low melting-point agarose of 10g/L, after 37 ℃, 5%CO2 are cultivated 5d with violet staining detection virus titer, plaque form and the size (seeing Figure 26) of 10g/L.With different m.o.i. inoculation PHK cells, collected viral supernatant every 12 hours, detect virus titer, draw growth curve (Figure 27).

The result shows: DEN2 can form less plaque at the BHK21 cell, and rJEV forms the similar plaque of size with JEVSA14-14-2, and the plaque that JD2 forms is similar to rJEV.

Growth curve at the PHK cell shows: inoculate the viral liquid that lower m.o.i. is more conducive to collect higher titre, and higher m.o.i. inoculation PHK, the peak of virus appears at about 24h, and virus titer is also lower, and it is also very fast to descend.

4, the immunogenic detection of JD2

With 30 of 0.5ml virus liquid (containing 4.4log10PFU) abdominal cavity inoculation kunming mices in 4 age in week, two Zhou Houyong similarly measure booster immunization and once (do contrast with MEM simultaneously), since the 4th week, put to death 5 mouse every 2 weeks, collect serum, (plaque reductionneutralization test PRNT) detects anti-DEN2 NAT to reduce the neutralization experiment with plaque.Two-fold dilution's antiserum(antisera) (from 1:10) at first, follow that every pipe adds 100PFU virus in 37 ℃ and 1h, virus inoculation and antiserum(antisera) mixed solution are to individual layer BHK21 cell absorption 1h, supernatant discarded, add the liquid of keeping contain 10g/L low melting-point agarose and 2% new-born calf serum and cultivate 5d in 37 ℃, 5% CO2, plaque dyeing, count the plaque number in each hole, in the calculating and titre, get the highly diluted multiple of 50% neutralising capacity and tire as sero-fast neutralization, in it and antibody titer can reach 1:92(and see Figure 28).

5, the JD2 immunity is studied the mouse immune provide protection

(contain 4.4log with 0.5ml p3 virus liquid ₁₀PFU) age in peritoneal immunity 4 week kunming mice, respectively at the 2nd week of immunity and the 4th week use DEN2(NGC) strain of brain endoadaptation attacks with the side of encephalocoele injection, does contrast with MEM simultaneously, attacks back observation 14 days, adds up mortality of mice (the results are shown in Table 4).

Table 4JD2 immune effect

After the result showed the immunity of JD2 embedded virus, the mouse invasion rate was far smaller than the sickness rate of control group.

The experimental result explanation; the present invention successfully makes up and has obtained encephalitis/step on leather 2 type embedded viruses; its can be in the PHK cell massive duplication; can produce the neutralizing antibody of dengue virus; the titre of the neutralizing antibody of generation dengue virus is up to 1:92; the active immunity provide protection is strong, can be prepared as to step on the leather vaccine.

Preparation and the evaluation of embodiment 4 encephalitis/step on leather 3 type embedded viruses

One, the preparation of encephalitis/step on leather 3 type embedded viruses

1, dengue virus 3 type antigen gene prM-E fragments is synthetic

Get the gene fragment prM-E(of dengue virus 3 type PaH881-88 strains coding E albumen shown in SEQ IDNO.6), after the Nucleotide replacement of 9 Nucleotide with the corresponding site of encephalitis b virus SA14-14-2 strain with coding E protein carboxyl groups end protein in this fragment, merge with N-terminal 204 Nucleotide of encephalitis b virus SA14-14-2 strain NS1 protein gene, this fragment is inserted into the pMD18-T carrier, obtains the plasmid clone pMD-D3prM-E of dengue virus 3 type antigen gene prM-E.

2, the structure of encephalitis/step on leather 3 types 5 ' half point

With pMD-D3prM-E behind the Kas of NEB company I and Bgl II double digestion, adopt the Qiaquick Gel extraction kit of Qiagen to reclaim small segment (2.1kb), simultaneously encephalitis 5 ' half point clone pJEV-5 ' is carried out double digestion with restriction enzyme KasI and BglII, and reclaim big fragment (4.0kb), T4DNA ligase with NEB connects and conversion TOP10 competent cell with two fragments, selected clone carries out plasmid with the Qiaprep spin miniprep kit of Qiagen and extracts in a small amount, and plasmid is carried out enzyme cut checking and order-checking, called after pJD3-5 ', the order-checking back is found to have lacked 8 bases (Figure 29) at E gene 1440-1448 place.Be that template adopt to merge PCR method 8 bases of disappearance are repaired with pJD3-5 ' plasmid, with the PureLink PCR purification kit purified pcr product (about 3.5kb) of Invitrogen (Figure 30), with reclaiming fragment behind NEB Asc I and the BspE I double digestion, with the small segment (about 2.1kb) of pJEV-3 ' plasmid through BspE I and the recovery of BamH I double digestion, T4DNA ligase with NEB connects, Qiaquick Gel extraction kit with Qiagen reclaims big fragment (5.7kb), this being reclaimed fragment is connected with BAC53 carrier recovery fragment (about 6.4kb) through NEB Asc I and BamH I double digestion again, transform the DH10B competent cell, selected clone carries out plasmid with the Qiaprep spin miniprep kit of Qiagen and extracts in a small amount, and plasmid is carried out enzyme cut checking and order-checking, acquisition encephalitis/step on leather 3 types 5 ' half point clone, called after BAC53JD3-5 ' (Figure 31).

3, the pJEV-3 ' half(Sal I) structure of half point

Adopt the PCR method Xba I to 3 that from Vaccinum Encephalitidis Epidemicae strain (SA14-14-2), increase ' end sequence (fragment F11), at 3 ' end introducing Sal I and Xho I restriction enzyme site.The PCR product is reclaimed fragment after with NEB Xba I and Xho I double digestion, with with the carrier segments part that reclaims behind Xba I and the Xho I double digestion pMDJEV-3 ' half, after the T4DNA ligase connection with NEB, transform the TOP10 competent cell, selected clone carries out plasmid with the Qiaprep spin miniprep kit of Qiagen and extracts in a small amount, and plasmid is carried out enzyme cut checking and order-checking, acquisition encephalitis/step on leather 3 types 5 ' half point to clone called after pJEV-3 ' half(Sal I) (Figure 32,33).

4, the structure of the chimeric full-length clone of encephalitis/step on leather 3 types

With the encephalitis of above-mentioned structure/step on leather 3 types 5 ' half point clone BAC53JD3-5 ' with the sub-pJEV-3 ' of JEV3 ' half point (Sal I) carries out double digestion with limiting restriction endonuclease BamH I and SalI, reclaim big fragment (being about 12kb and 5.4kb respectively) respectively, connect and transform the DH10B competent cell, selected clone carries out that plasmid extracts in a small amount, enzyme is cut checking and the total length order-checking, acquisition encephalitis/step on and remove from office 3 type full length cDNA clones, called after pJD3FC.

The pJD3FC enzyme is cut result such as Figure 34 and shown in Figure 35, and is in full accord with expection; According to the order-checking collection of illustrative plates, can read the nucleotide sequence of pJD3FC shown in SEQ ID NO.10.

5, the preparation of encephalitis/step on leather 3 type embedded virus in-vitro transcription thing RNA

With BAC53JD3FC restriction enzyme Sal I linearizing, with the PureLinkPCR purification kit purifying linearizing product of Invitrogen, adopt the Ribomax large scaleRNA production system-SP6 of Promega to carry out in-vitro transcription then.40 μ l reaction systems comprise: 5 * transcriptbuffer, 8 μ l, rATP(100mM) 2 μ l, rCTP(100mM) 2 μ l, rUTP(100mM) 2 μ l, rGTP(100mM) 0.7 μ l, m7G cap analog(40mM) 3 μ l, enzyme mix 4 μ l, linearizing product 18.3 μ l.Reaction system in 37 ℃ hatch 4h after, add 2 μ l RNase-free DNase in 37 ℃ of digestion template 30min, use the Rnease Mini kit purifying RNA product of Qiagen then, in-70 ℃ of preservations standby (Figure 36).

6, the rescue of encephalitis/step on leather 3 type embedded viruses

BHK21 cell trysinization with adherent growth, with MEM substratum (Gibco) the piping and druming cell that contains 10% calf serum, the centrifugal 5min of 800rpm, with aseptic precooling PBS washed cell 2 times, with 160 μ l PBS re-suspended cells, the in-vitro transcription product RNA(control cells that adds the above-mentioned purifying of 5-10 μ g adds the PBS of equal volume), carry out the electricity commentaries on classics according to the experiment parameter of voltage 140V, burst length 25ms, pulse 1 time with the Gene pulser Xcell of Biorad behind the mixing.Then cell is placed 6min on ice, change 37 ℃ of cultivations in the MEM substratum that contains 10% calf serum again over to.Be replaced by the MEM substratum that contain 2% calf serum with substratum next day, continues to be cultured to the 5th～7 day to cytopathy occurring.With transfectional cell and supernatant liquor multigelation 3 times, the centrifugal 10min of 4000rpm, the results supernatant liquor, after the packing in-70 ℃ of preservations, the embedded virus called after JD3(P1 first time of acquisition).

7, the cultivation of going down to posterity of encephalitis/step on leather 3 type embedded viruses

Get the former generation hamster kidney cell (PHK cell) of the first-generation embedded virus JD30.5ml inoculation adherent growth of above-mentioned acquisition, behind 37 ℃ of absorption 1h, add the MEM substratum that contains 2% calf serum, continue to be cultured to cell and CPE occurs.Draw supernatant liquor, the centrifugal 10min of 4000rpm, the supernatant liquor of results are s-generation embedded virus JD3(P2), after the packing in-70 ℃ of preservations.By the same way JD3 was uploaded to for the 15th generation at the PHK cell, embedded virus is carried out every evaluation (Figure 37) therebetween.

Two, the evaluation of encephalitis/step on leather 3 type embedded viruses

1, the RT-PCR of encephalitis/step on leather 3 type embedded viruses identifies and order-checking

Extract third generation embedded virus JD3(P3 with the High pure viral RNA kit of Roche company) RNA, and with the Super of Invitrogen III Reverse Transcriptase is cDNA with embedded virus RNA reverse transcription.Be template with this cDNA, carry out pcr amplification with the PrimeSTAR HS DNApolymerase of TaKaRa.The primer is that the prM/E of 4 kinds of serotypes of dengue virus detects primer, the following D1 of primer sequence: upstream primer 5'-ACCAACATTGGACATTGAACTCT-3 ', downstream primer 5'-AGGTGGTTCTGCCTCAATGT-3 ', product length 1026bp; D2: upstream primer 5'-TCGCTCCTTCAATGACAAT-3', downstream primer 5'-CCTGTGAGTGCTGTGTGC-3', product length 814bp; D3: upstream primer 5'-CCACGGACAGGTTTGGATT-3 ', downstream primer 5'-GAACATCTTCCCAATCGAGCT-3', product length 615bp; D4: upstream primer 5'-CACAGCATGGGACAACAGTG-3', downstream primer 5'-CGTGCCAATCCACAACACT-3', product length 461bp.

The result shows to have only the D3 primer can amplify purpose band (Figure 38).The PCR product is checked order, consistent with the embedded virus expected sequence.

2, the plaque of encephalitis/step on leather 3 type embedded viruses detects

With BHK21 cell inoculation to six orifice plate, treat to carry out when the cytogamy degree reaches 70-80% plaque and detect.As diluent, respectively each generation embedded virus is carried out 10 times of gradient dilutions with serum-free MEM substratum.The substratum of BHK21 cell is removed in suction, adds the viral liquid after 400 μ l dilute respectively in each hole, and in 37 ℃ of absorption 60min, the soft jolting of every 20min once.Inhale the venom of preventing or cure a disease after absorption is finished, in every hole, add 2ml 1% low melting-point agarose (containing 2% calf serum), wait to solidify the back in 37 ℃ of cultivations.Every hole adds fixedly 60min of 2ml 4% Paraformaldehyde 96 after 5 days, then with the dyeing of Viola crystallina dye liquor, observes the plaque form and calculates virus titer (Figure 39) according to plaque quantity.

3, the drafting of encephalitis/step on leather 3 type embedded virus growth curves

Keep liquid (Gibco) with JD3(P3 with the MEM that contains 2% calf serum) to be diluted to infection multiplicity (MOI) respectively be 0.1,0.01,0.001 to viral liquid, the PHK cell of adherent growth in the inoculation T75 bottle, in 37 ℃ of absorption 120min, the soft jolting of every 20min once.Inhale the venom of preventing or cure a disease after absorption is finished, the MEM that adding 20ml contains 2% calf serum keeps liquid (Gibco), in 37 ℃ of cultivations.Extracted the 0.5ml supernatant liquor every 12 hours ,-70 ℃ of preservations are to be measured, keep liquid with 0.5ml MEM and supply volume, and sample collecting is to inoculating back 96 hours.According to the plaque method each time point sample of different MOI is carried out titer determination, draw the growth curve (Figure 40) of JD3 virus in the PHK cell.The result shows that the virus titer of different MOI inoculum sizes rises rapidly after inoculation, 48-60h reaches the highest after inoculation, after this descends rapidly.The virus titer of high MOI inoculum size peak value occurs early, and it is later that MOI is that peak value appears in the virus titer of 0.001 inoculum size, and titre is the highest.

4, the Western blot of encephalitis/step on leather 3 type embedded viruses identifies

At 80 μ l third generation embedded virus JD3(P3) in add 20 μ l, 5 * protein loading buffer, boiling water boils 10min behind the mixing, the centrifugal 1min of 10000rpm, get supernatant liquor and carry out the SDS-PAGE electrophoresis, albumen is transferred to nitrocellulose filter, with 5% skimmed milk room temperature sealing 1h, use dengue virus 3 type E protein polyclone antibodies (extent of dilution 1:40, preparation voluntarily) in 4 ℃ of overnight incubation then.PBS washes film, uses goat anti-rabbit igg (extent of dilution 1:5000, the green skies, Shanghai) the incubated at room 1.5h of AP mark then.PBS develops the color with BCIP/NBT alkaline phosphatase colouring reagents box (the green skies, Shanghai) after washing film.According to the same terms encephalitis b virus JEV (P3) is detected, in contrast.

The result shows that encephalitis b virus do not see band, and embedded virus can be observed clear band at the 55kD place, and is corresponding with the dengue virus E protein position, and the result meets expection (Figure 41).

5, the immunogenicity experiments of encephalitis/step on leather 3 type embedded viruses

(1) immunogen preparing

The third generation encephalitis that results are cultivated in the PHK cell/step on leather 3 type embedded virus JD3 supernatants, after the plaque method was measured virus titer, it was standby with MEM basic medium (Gibco) virus titer to be adjusted to 105/ml.

(2) laboratory animal and grouping

60 Healthy female BALB/c mouse in 4 age in week are provided by Chengdu Institute of Biological Products Co., Ltd..Laboratory animal is divided into 2 groups at random, 30 every group: (1) JD3 embedded virus immune group; (2) negative control group (MEM basic medium).

(3) immunization protocol

Get above-mentioned viral liquid and negative controls, fully inoculate mouse by the abdominal injection approach behind the mixing, 500ul/ only.2 weeks with identical approach and dosage booster shot once behind the initial immunity.Initial immunity begins blood sampling after 3 weeks, after this per 2 weeks 1 time each 5, amount to 6 times to finishing in the 13rd week.Separation of serum, with 56 ℃ of deactivations after 10 times of the PBS dilutions 30 minutes ,-20 ℃ of preservations were standby.

(4) inspection of immune serum NAT

Above-mentioned serum sample (1:10) is carried out doubling dilution to 1:640 with serum dilution (PBS) according to 1:2, every concentration sample is got 200ul respectively and is contained 50-100PFU dengue virus 4 types with volume and mix, behind the mixing in 37 ℃ hatch 1 hour after, join on six orifice plates that cover with the BHK21 cell, measure NAT.Do not do negative control to add sero-fast MEM substratum.With can in and the serum-concentration of the high dilution of 1/2 virus as NAT.

The result shows, behind the encephalitis/step on leather 3 type embedded virus immune mouses, can produce the neutralizing antibody of special anti-homotype dengue virus, and NAT is up to 1:56.56 and (sees Figure 42.

Description of test, the present invention successfully makes up and has obtained encephalitis/step on leather 3 type embedded viruses, its can be in the PHK cell massive duplication, can produce the neutralizing antibody of dengue virus, immunogenicity is strong, can be prepared as to step on the leather vaccine.

Preparation and the evaluation of embodiment 5 encephalitis/step on leather 4 type embedded viruses

One, the preparation of encephalitis/step on leather 4 type embedded viruses

1, dengue virus 4 type antigen gene prM-E fragments is synthetic

Get shown in the gene fragment prM-E(SEQ ID NO.7 of dengue virus 4 types 814669 strains codings E albumen) 9 Nucleotide of coding E protein carboxyl groups end protein in this fragment are replaced with the Nucleotide in the corresponding site of encephalitis b virus SA14-14-2 strain after, merge with N-terminal 204 Nucleotide of encephalitis b virus SA14-14-2 strain NS1 protein gene, then this fragment is inserted into the TOPO carrier, obtains the plasmid clone TOPO-D4prM-E of dengue virus 4 type antigen gene prM-E.

2, the structure of encephalitis/step on leather 4 types 5 ' half point

With above-mentioned TOPO-D4prM-E plasmid restriction restriction endonuclease KasI and the BglII double digestion that contains dengue virus 4 type prM-E sequences, adopt the Qiaquick Gel extraction kit of QIAGEN company to reclaim small segment (2.1kb), simultaneously encephalitis 5 ' half point clone pJEV-5 ' is carried out double digestion with restriction enzyme KasI and BglII, and reclaim big fragment (4.0kb), T4DNA ligase with NEB connects and conversion TOP10 competent cell with two fragments, selected clone carries out plasmid with the Qiaprep spinminiprep kit of QIAGEN company and extracts in a small amount, and plasmid is carried out enzyme cut checking and order-checking, acquisition encephalitis/step on leather 4 types 5 ' half point to clone called after pJD4-5 ' (Figure 43 and 44).

3, the structure of encephalitis/step on leather 4 type full-length clones

With the encephalitis of above-mentioned structure/step on leather 4 types 5 ' half point clone pJD4-5 ' with encephalitis 3 ' half point clone pJEV-3 ' half carries out double digestion with limiting restriction endonuclease BspEI and XhoI, reclaim big fragment (being respectively 6.1kb and 7.5kb) respectively, connect and transform the TOP10 competent cell, selected clone carries out that plasmid extracts in a small amount, enzyme is cut checking and the total length order-checking, acquisition encephalitis/step on and remove from office 4 type full length cDNA clones, called after pJD4FC.

Enzyme is cut result such as Figure 45 and 46, according to the order-checking collection of illustrative plates, can read the sequence of pJD4FC shown in SEQ IDNO.11.

4, the preparation of encephalitis/step on leather 4 type embedded virus in-vitro transcription thing RNA

With pJD4FC restriction enzyme XhoI linearizing, with the PureLink PCRpurification kit purifying linearizing product of Invitrogen, adopt the Ribomax large scaleRNA production system-SP6 of Promega company to carry out in-vitro transcription then.40 μ l reaction systems comprise: 5 * transcriptbuffer, 8 μ l, rATP(100mM) 2 μ l, rCTP(100mM) 2 μ l, rUTP(100mM) 2 μ l, rGTP(100mM) 0.7 μ l, m ⁷G cap analog(40mM) 3 μ l, enzyme mix 4 μ l, linearizing product 18.3 μ l.Reaction system in 37 ℃ hatch 4h after, add 2 μ l RNase-free DNase in 37 ℃ of digestion template 30min, use the Rnease Mini kit purifying RNA product of QIAGEN company then, in-70 ℃ of preservations standby (Figure 47).

5, the rescue of encephalitis/step on leather 4 type embedded viruses

BHK21 cell trysinization with adherent growth, with MEM substratum (Gibco) the piping and druming cell that contains 10% calf serum, the centrifugal 5min of 800rpm, with aseptic precooling PBS washed cell 2 times, with 160 μ l PBS re-suspended cells, the in-vitro transcription product RNA(control cells that adds the above-mentioned purifying of 5-10 μ g adds the PBS of equal volume), carry out the electricity commentaries on classics according to the experiment parameter of voltage 140V, burst length 25ms, pulse 1 time with the Gene pulser Xcell of Biorad behind the mixing.Then cell is placed 6min on ice, change 37 ℃ of cultivations in the MEM substratum that contains 10% calf serum again over to.Be replaced by the MEM substratum that contain 2% calf serum with substratum next day, continues to be cultured to the 5th～7 day, and obvious CPE appears in the BHK21 cell that changes with pJD4FC in-vitro transcription thing electricity, and control cells does not have pathology (Figure 48).With sick cell and supernatant liquor multigelation 3 times, the centrifugal 10min of 4000rpm, the results supernatant liquor, after the packing in-70 ℃ of preservations, the embedded virus called after JD4(P1 first time of acquisition).

6, the cultivation of going down to posterity of encephalitis/step on leather 4 type embedded viruses

Get the former generation hamster kidney cell (PHK cell) of the first-generation embedded virus JD40.5ml inoculation adherent growth of above-mentioned acquisition, behind 37 ℃ of absorption 1h, add the MEM substratum that contains 2% calf serum, continue to be cultured to cell and CPE occurs.Draw supernatant liquor, the centrifugal 10min of 4000rpm, the supernatant liquor of results are s-generation embedded virus JD4(P2), after the packing in-70 ℃ of preservations.By the same way JD4 was uploaded to for the 10th generation at the PHK cell, embedded virus is carried out every evaluation (Figure 49) therebetween.

Two, the RT-PCR of encephalitis/step on leather 4 type embedded viruses identifies

1, the RT-PCR of encephalitis/step on leather 4 type embedded viruses identifies and order-checking

Extract s-generation embedded virus JD4(P2 with the High pure viral RNA kit of Roche company) RNA, and with the Super of Invitrogen

III Reverse Transcriptase is cDNA with embedded virus RNA reverse transcription.Be template with this cDNA, carry out pcr amplification with the PrimeSTAR HS DNApolymerase of Takara.Primer sequence is as follows: first couple of JD4PF1:5'-CACCTGATCACGTCGGAATA-3', JD4PR1:5'-CCGCTCGAGCCCAAAGCTTCAAACTCTAGAT-3', product length 2078bp; Second pair: JD4PF2:5'-CGCCCCTACGATTCCGGACAGA-3', JD4PR2:5'-GGAAAAGGATCCGTGGTTCCAGG-3', product length 2155bp; The 3rd pair: JD4PF3:5'-TGCGGAGTCAGATCTGTCACT-3', JD4PR3:5'-CATTTTCTGTCCGGAATCGTAG-3', product length 820bp; The 4th pair: JD4PF4:5'-GAACATGGAGGATGCGTCAC-3', JD4PR4:5'-GGTCCGGACCAGTCTAGTGACAGATCTGACTC-3', product length 1608bp.The result shows the success (Figure 50) of all increasing of 4 products.The PCR product is checked order, all consistent with the embedded virus expected sequence.

2, the plaque of encephalitis/step on leather 4 type embedded virus JD4 detects

With BHK21 cell inoculation to six orifice plate, treat to carry out when the cytogamy degree reaches 70-80% plaque and detect.As diluent, respectively each generation embedded virus is carried out 10 times of gradient dilutions with serum-free MEM substratum.The substratum of BHK21 cell is removed in suction, adds the viral liquid after 400 μ l dilute respectively in each hole, and in 37 ℃ of absorption 60min, the soft jolting of every 20min once.Inhale the venom of preventing or cure a disease after absorption is finished, in every hole, add 2ml 1% low melting-point agarose (containing 2% calf serum), wait to solidify the back in 37 ℃ of cultivations.Every hole adds fixedly 60min of 2ml 4% Paraformaldehyde 96 after 5 days, then with the dyeing of Viola crystallina dye liquor, observes the plaque form and calculates virus titer (Figure 51) according to plaque quantity.

3, the drafting of encephalitis/step on leather 4 type embedded virus JD4 growth curves

Keep liquid (Gibco) with JEV/D4(P3 with the MEM that contains 2% calf serum) to be diluted to infection multiplicity (MOI) respectively be 0.1,0.01,0.001 to viral liquid, the PHK cell of adherent growth in the inoculation T75 bottle, in 37 ℃ of absorption 60min, the soft jolting of every 20min once.Inhale the venom of preventing or cure a disease after absorption is finished, the MEM that adding 20ml contains 2% calf serum keeps liquid (Gibco), in 37 ℃ of cultivations.Extracted the 0.5ml supernatant liquor every 12 hours ,-70 ℃ of preservations are to be measured, keep liquid with 0.5ml MEM and supply volume, and sample collecting is to inoculating back 96 hours.According to the plaque method each time point sample of different MOI is carried out titer determination, draw the growth curve (Figure 52) of JD4 virus in the PHK cell.The result shows that virus titer rises rapidly after inoculation, 36-48h reaches the highest after inoculation, after this descends rapidly.The virus titer of high MOI inoculum size peak value occurs early, but the corresponding peak value of different MOI inoculum sizes does not have significant difference.

4, the Western blot of encephalitis/step on leather 4 type embedded virus JD4 identifies

At 80 μ l third generation embedded virus JD4(P3) in add 20 μ l, 5 * protein loading buffer, boiling water boils 10min behind the mixing, the centrifugal 1min of 10000rpm, get supernatant liquor and carry out the SDS-PAGE electrophoresis, albumen is transferred to nitrocellulose filter, with 5% skimmed milk room temperature sealing 1h, use dengue virus 4 type E protein polyclone antibodies (extent of dilution 1:40, preparation voluntarily) in 4 ℃ of overnight incubation then.PBS washes film, uses goat anti-rabbit igg (extent of dilution 1:5000, the green skies, Shanghai) the incubated at room 1.5h of AP mark then.PBS develops the color with BCIP/NBT alkaline phosphatase colouring reagents box (the green skies, Shanghai) after washing film.According to the same terms encephalitis b virus JEV (P3) is detected, in contrast.

The result shows that encephalitis b virus do not see band, and embedded virus can be observed clear band at the 55kD place, and is corresponding with the dengue virus E protein position, result and expection consistent (Figure 53).

5, the immunogenicity experiments of encephalitis/step on leather 4 type embedded virus JD4

(1) immunogen preparing

The third generation encephalitis that results are cultivated in the PHK cell/step on leather 4 type embedded virus supernatants, after the plaque method was measured virus titer, (Gibco) was adjusted to 10 with virus titer with the MEM basic medium ⁵/ ml is standby.

(2) laboratory animal and grouping

60 Healthy female BALB/c mouse in 4 age in week are provided by Chengdu Institute of Biological Products Co., Ltd..Laboratory animal is divided into 2 groups at random, 30 every group: (1) JEV/D4 embedded virus immune group; (2) negative control group (MEM basic medium).

(3) immunization protocol

Get above-mentioned viral liquid and negative controls, fully inoculate mouse by the abdominal injection approach behind the mixing, 500ul/ only.2 weeks with identical approach and dosage booster shot once behind the initial immunity.Initial immunity begins blood sampling after 3 weeks, after this per 2 weeks 1 time each 5, amount to 6 times to finishing in the 13rd week.Separation of serum, with 56 ℃ of deactivations after 10 times of the PBS dilutions 30 minutes ,-20 ℃ of preservations were standby.

(4) inspection of immune serum NAT

Above-mentioned serum sample (1:10) is carried out doubling dilution to 1:640 with serum dilution (PBS) according to 1:2, every concentration sample is got 200ul respectively and is contained 50-100PFU dengue virus 4 types with volume and mix, behind the mixing in 37 ℃ hatch 1 hour after, join on six orifice plates that cover with the BHK21 cell, measure NAT.Do not do negative control to add sero-fast MEM substratum.With can in and the serum-concentration of the high dilution of 1/2 virus as NAT.

The result shows, behind the encephalitis/step on leather 4 type embedded virus immune mouses, can produce the neutralizing antibody of special anti-homotype dengue virus, and senior middle school and antibody titer are that 1:22.36(sees Figure 54).

Description of test, the present invention successfully makes up and has obtained encephalitis/step on leather 4 type embedded viruses, its can be in the PHK cell massive duplication, can produce the neutralizing antibody of dengue virus, immunogenicity is strong, can be prepared as to step on the leather vaccine.

To sum up, the present invention has successfully made up the infection and encephalitis B virus infection sex clone, and further made up to contain and step on leather 1 type, step on leather 2 types, step on the Japanese encephalitis/dengue chimeric virus of leather 3 types or 4-type dengue virus antigen gene prM-E, these embedded viruses can various human with production of vaccine with cell on growth and breeding, growth characteristics are similar, can be for the production of four serotypes step on the leather vaccine, and, these four kinds of embedded virus immunogenicities are strong, the titre height of the antibody that produces has favorable industrial application prospect.

Claims (15)

1. infection and encephalitis B virus infection sex clone is characterized in that: it is the recombinant vectors that comprises encephalitis b virus attenuated strain SA14-14-2 genome full-length cDNA.

2. virus infection clones according to claim 1 is characterized in that: described recombinant vectors is reorganization pACNR plasmid or recombinant bacteria artificial chromosome, and the nucleotide sequence of bacterial artificial chromosome is shown in SEQ ID NO.1.

3. virus infection clones according to claim 2 is characterized in that: 5 ' end of described full-length cDNA has prokaryotic promoter.

4. virus infection clones according to claim 3, it is characterized in that: described promotor is SP6.

5. virus infection clones according to claim 2 is characterized in that: the Transcription Termination site of 3 ' end of described full-length cDNA is restriction enzyme digestion sites.

6. virus infection clones according to claim 5, it is characterized in that: described restriction enzyme digestion sites is XhoI or SalI.

7. according to any described virus infection clones of claim 1 ~ 6, it is characterized in that: its nucleotide sequence is shown in SEQ ID NO.2 or SEQ ID NO.3.

8. embedded virus is characterized in that: it is made up by any described infection and encephalitis B virus infection sex clone of claim 1 ~ 7 and forms, and wherein the prM-E gene is dengue virus prM-E gene.

9. embedded virus according to claim 8, it is characterized in that: described dengue virus prM-E gene is the prM-E gene of dengue virus 1,2,3 or 4 types.

10. embedded virus according to claim 9, it is characterized in that: described dengue virus 1 type is dengue virus ThD0008-81 strain; Described dengue virus 2 types are dengue virus PUO-218 strain; Described dengue virus 3 types are dengue virus PaH881-88 strain; Described dengue virus 4 types are dengue virus 814669 strains.

11. embedded virus according to claim 9 is characterized in that: the nucleotide sequence of described dengue virus prM-E gene is respectively shown in SEQ ID NO.4 ~ 7.

12. any described embedded virus according to Claim 8 ~ 11 is characterized in that: its nucleotide sequence is shown in any one of SEQ ID NO.8 ~ 11.

13. the purposes of any described embedded virus of claim of claim 8 ~ 12 in the preparation dengue vaccine.

14. a dengue vaccine is characterized in that: it is to be prepared from by any described embedded virus of claim of claim 8 ~ 12.

15. the bacterial artificial chromosome of nucleotide sequence shown in SEQ ID NO.1.

Images