CN115786280A - Recombinant GI type Japanese encephalitis virus stably expressing red fluorescent protein mCherry and construction method and application thereof - Google Patents

Abstract

The invention discloses a recombinant GI type Japanese encephalitis virus stably expressing a red fluorescent protein mCherry and a construction method and application thereof. Specifically, the invention utilizes recombinant cloning technology to insert a section of C38-mCherry-T2A gene sequence SEQ ID NO.1 between 5' UTR and C gene of GI type Japanese encephalitis virus genome, and constructs a recombinant virus infectious clone containing T7 promoter. The full length of genome RNA of the recombinant virus is obtained by an in vitro transcription technology, the genome RNA is transfected into a BHK-21 cell, and when the cell has typical pathological changes, cell supernatant is collected to obtain the recombinant virus expressing the mCherry protein. The recombinant virus can stably and efficiently express the mCherry protein, and the inserted mCherry gene has genetic stability in the virus continuous passage process and does not influence the translation and processing of virus protein and the replication capacity of the virus. The recombinant GI type Japanese encephalitis virus stably expressing the red fluorescent protein mCherry has wide application value in the aspect of screening antiviral drugs.

Description

Recombinant GI type Japanese encephalitis virus stably expressing red fluorescent protein mCherry and construction method and application thereof

Technical Field

The invention relates to a recombinant GI type Japanese encephalitis virus stably expressing a red fluorescent protein mCherry, a construction method and application thereof, belonging to the technical field of molecular biology.

Background

Japanese Encephalitis Virus (JEV) belongs to the flavivirus genus of the Flaviviridae family, is a single-stranded positive-strand RNA Virus, has a genome length of about 11kb, a type I cap structure m7G (5 ') ppp (5') A at the 5 'end, and no poly (A) tail at the 3' end. The viral genome contains an Open Reading Frame (ORF) and encodes a large polyprotein that is further cleaved by host or viral proteases into three structural proteins (C, prM, E) and seven non-structural proteins (NS 1, NS2A, NS2B, NS3, NS4A, NS4B, NS 5). JEV is transmitted in nature mainly by the bite of mosquitoes, and can infect many hosts such as people, horses, pigs, birds, etc., wherein the JEV is more harmful to people and pigs. The human is susceptible to children under ten years old, the clinical symptoms are high fever, convulsion, disturbance of consciousness, pathological reflex and meningeal stimulation, and death or nerve sequelae with different degrees are left in critical cases; after the infection of the pigs, the diseases are mainly manifested as reproductive disorders, pregnant sows suffer from abortion, produce stillbirth or mummy, and boars suffer from orchitis and unilateral testicular swelling and are sterile. Therefore, JEV poses a great threat to the continuous development of the pig raising industry in China and the public health safety in China.

In the last two decades, the Japanese encephalitis virus epidemic has been a phenomenon of genotype conversion in Asian regions, particularly China. The JEV can be divided into five genotypes according to the whole genome sequence or the sequence of the E gene, namely, the genes I, II, III, IV and V (GI, I, II, III, IV and V). In 1940, the GIII strain is first separated in China, and then the GIII strain is mainly flowed in China for many years. But from the last 90 s, the GI type gradually replaces the GIII type and becomes the main epidemic strain in China. To date, china presents a situation that GI type flow behaviors dominate, and GI type and GIII type are mixed and prevalent, and the reason of genotype conversion is not clearly solved at present. Vaccine immunity is still one of important means for effectively preventing and controlling JEV infection, but the existing commercial vaccines (attenuated vaccines and inactivated vaccines) in China are developed based on GIII type strains, and the GIII type vaccines have weaker capability for preventing and controlling the infection of the GI type JEV strains. At present, no effective vaccine can prevent the infection of GI type JEV, and a specific and efficient antiviral medicament is lacking clinically, so that only symptomatic support treatment is taken as a main treatment. In recent years, GI type JEV strains have also been isolated in the clinic, making GI type JEV a potential outbreak of harm.

With the continuous development of molecular biology technology, scientists have been able to target virus modification by means of reverse genetics, which provides good tools for the deep development of related virology research. Fluorescent protein gene sequences can be inserted into the genome of the virus by using a reverse genetics technology to assemble recombinant viruses. The recombinant virus can carry a fluorescent marker or release a fluorescent signal in an infected cell, so that the virus can be traced in real time, the process of infecting the cell by the virus can be observed, and meanwhile, the method can provide help for screening antiviral drugs and researching action mechanisms. In recent years, red fluorescent protein (mCherry) has been successfully used in the construction of various recombinant viruses. Because the mCherry has stable luminescence and no cytotoxicity, does not depend on accessory factors or other matrixes in the luminescence process, and the expression of the mCherry gene has no species and cell specificity, the mCherry gene is very suitable to be used as a living reporter gene in the field of virology. However, at present, there is no recombinant GI type japanese encephalitis virus stably expressing red fluorescent protein (mCherry). The invention adopts various molecular biology techniques to obtain a recombinant GI type Japanese encephalitis virus stably expressing red fluorescent protein (mCherry), the recombinant virus has genetic stability, and has wide application value and prospect in the aspects of screening of anti-GI type Japanese encephalitis virus medicines and researching of virus replication and pathogenic mechanisms.

Disclosure of Invention

The invention aims to solve the problems and aims to provide a construction method of a recombinant GI type Japanese encephalitis virus stably expressing a red fluorescent protein mCherry.

The purpose of the invention is realized by the following steps: a preparation method of a recombinant GI type Japanese encephalitis virus stably expressing a red fluorescent protein mCherry is characterized by comprising the following steps:

(1) Constructing a full-length infectious clone carrying the mCherry gene;

inserting a C38-mCherry-T2A gene sequence between a 5' non-coding region UTR and a C gene of a GI type Japanese encephalitis virus genome, wherein the C38-mChery-T2A gene sequence is SEQ ID NO.1, so as to construct a recombinant virus genome carrying a fluorescent protein gene; the method comprises the following specific steps: amplifying the fragment SEQ ID NO.4 by using primers shown in SEQ ID NO.2 and SEQ ID NO. 3; amplifying the fragment SEQ ID NO.7 using the primers shown in SEQ ID NO.5 and SEQ ID NO. 6; recovering and detecting the amplified DNA fragment; the SEQ ID NO.1 gene segment is artificially synthesized;

20-30 bp of homologous sequence exists between adjacent DNA fragments; mixing the fragments of SEQ ID NO.1, SEQ ID NO.4 and SEQ ID NO.7 with the linearized infectious cloning vector TAR-rGI treated with Not I and Sac II enzymes in equal proportion, and carrying out homologous recombination by using NEB Gibson Assembly recombinase; subsequently, in the transformed escherichia coli Top 10, selecting a monoclonal colony for amplification and plasmid extraction, and identifying and sequencing the correct plasmid, namely the plasmid is named TAR-rGI-mCherry;

rescue of recombinant viruses;

after linearization treatment is carried out on the plasmid TAR-rGI-mCherry by using restriction enzyme Sal I, the linearized TAR-rGI-mCherry plasmid is subjected to in vitro transcription by using NEB High Scribe T7 High Yield RNA Synthesis Kit to obtain the full length of genome RNA of the recombinant virus; direct transfection of recombinant viral RNA into BHK-21 cells grown at 70% and subjecting the transfected cells to 37 ℃ containing 5% CO ₂ When the cells are cultured in a cell culture box, the recombinant GI type Japanese encephalitis virus is obtained after the cells have typical lesions and express obvious red fluorescent protein, namely the recombinant GI type Japanese encephalitis virus is named as rGI-mCherry.

The prepared GI type Japanese encephalitis virus recombinant strain expressing the red fluorescent protein mCherry.

Application of recombinant GI type Japanese encephalitis virus expressing red fluorescent protein mCherry in screening antiviral drugs.

The method is advanced, and the invention provides the recombinant GI type Japanese encephalitis virus expressing the red fluorescent protein (mCherry) obtained by the construction method. The invention determines the genetic stability of the recombinant virus, and the virus can stably express the red fluorescent protein and is verified by passage. The invention provides the application of the recombinant GI type Japanese encephalitis virus stably expressing the red fluorescent protein (mCherry), and the application value of the recombinant GI type Japanese encephalitis virus in screening antiviral drugs. A construction method of a recombinant GI type Japanese encephalitis virus stably expressing red fluorescent protein (mCherry) comprises the following steps:

(1) A section of C38-mCherry-T2A gene sequence (SEQ ID NO. 1) is inserted between the 5' non-coding region (UTR) and the C gene of the GI type Japanese encephalitis virus genome, and the SEQ ID NO.1 sequence is artificially synthesized. The mCherry gene is connected with a virus 5' non-coding region (UTR) through a nucleotide sequence of 38 amino acids (C38) at the N end of the C protein; linked to the viral C gene by a T2A sequence, the T2A sequence being from thosa asigna virus; the design is characterized in that: the nucleotide sequence of 38 amino acids (C38) at the N end of the C protein can ensure that the virus RNA forms a correct annular structure to start the translation of the virus protein; the T2A sequence can realize the co-expression of the mCherry protein and the virus protein, but is not a fusion protein, so that the assembly of progeny virus particles is not influenced, and the tracing is realized after the virus invades cells.

(2) Amplifying the fragment SEQ ID NO.4 by using primers shown in SEQ ID NO.2 and SEQ ID NO. 3; amplifying the fragment SEQ ID NO.7 by using primers shown in SEQ ID NO.5 and SEQ ID NO. 6; and recovering and detecting the amplified DNA fragments.

(3) The TAR-rGI infectious cloning vector was linearized with the restriction enzymes Not I and Sac II and the desired fragment was recovered. The recovered fragments were mixed with SEQ ID NO.1, SEQ ID NO.4, and SEQ ID NO.7 in equal proportions, and subjected to homologous recombination using NEB Gibson Assembly recombinase. Subsequently, in transformed Escherichia coli (Top 10), a single colony is picked for amplification and plasmid extraction, and the plasmid with correct sequencing is identified and named TAR-rGI-mCherry.

(4) Carrying out in-vitro transcription after single enzyme digestion of the cloned plasmid TAR-rGI-mCherry, transfecting the obtained RNA to a BHK-21 cell, and collecting cell supernatant when the cell has typical pathological changes, thus obtaining the recombinant GI type Japanese encephalitis virus rGI-mChery of the red fluorescent protein (mChery).

The invention has the following advantages and effects:

(1) The invention prepares a recombinant GI type Japanese encephalitis virus stably expressing a red fluorescent protein mCherry, the recombinant virus can stably express the fluorescent protein, and an exogenous gene (mCherry) can be stably copied and expressed without deletion in the copying process. At present, no recombinant GI type Japanese encephalitis virus stably expressing red fluorescent protein exists at home and abroad, and the invention fills the gap.

(2) The recombinant GI type Japanese encephalitis virus expressing the red fluorescent protein mCherry has strong fluorescent number, is easy to observe, and has important practical significance and wide application value for high-throughput screening analysis of antiviral drugs; .

(3) The recombinant GI type Japanese encephalitis virus expressing the red fluorescent protein mCherry can be visually observed and analyzed in a living cell state under the replication condition, and does not need to fix and immunostain cells, so that the whole operation process is simpler, more convenient and faster, the operation steps of the living virus are reduced, and the efficiency of the whole operation process is improved.

Drawings

FIG. 1 is a schematic diagram of the construction of TAR-rGI-mCherry plasmid.

FIG. 2 is a diagram of the cell pathology and the expression of fluorescent protein (mCherry) in the cell after BHK-21 cells are transfected by recombinant viral RNA.

FIG. 3A is a validation of indirect Immunofluorescence (IFA) of recombinant virus rGI-mCherry with parental virus YZ-1.

FIG. 3B is a graph of the multi-step growth of recombinant virus rGI-mCherry with parental virus YZ-1.

FIG. 3C is the morphological diagram of the recombinant virus rGI-mCherry and the parental virus YZ-1 virus plaque.

FIG. 4A is a PCR assay of the mCherry gene in different generations (P1, P5, P10) of recombinant virus rGI-mCherry.

FIG. 4B is a graph showing the expression of mCherry protein after BHK-21 cells were infected with rGI-mChery recombinant viruses of different generations (P1, P5, P10).

FIG. 5 is a graph of the results of nuclear scan analysis of red fluorescent protein and cell nuclei for inhibition of rGI-mCherry replication in BHK-21 cells by Nitroxoline at various concentrations.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. The embodiments are merely exemplary and do not limit the scope of the invention in any way.

The experimental procedures, in which specific conditions are not specified, in the following examples are generally carried out under conventional conditions such as those described in the protocols commonly used in the art, such as molecular cloning, A laboratory Manual (third edition, scientific Press, 2005), or under conditions recommended by the reagent manufacturers.

Example 1: rescue and identification of recombinant GI type Japanese encephalitis virus expressing red fluorescent protein (mCherry);

1.1 construction of full-length infectious clone carrying mCherry gene;

according to the analysis of the full-length sequence of the GI type parental virus YZ-1 strain (GenBank access number: MZ 540901), the C38-mChery-T2A gene (SEQ ID NO. 1) is inserted between the 5' UTR and the C gene of GI type Japanese encephalitis virus, and the construction strategy is shown in figure 1. The specific process is as follows:

(1) Taking an infectious clone plasmid TAR-rGI (constructed and stored in the laboratory) carrying the full length of the GI type JEV genome as a template, and amplifying a fragment SEQID NO.4 by using primers shown in SEQ ID NO.2 and SEQ ID NO. 3; amplifying the fragment SEQ ID NO.7 using the primers shown in SEQ ID NO.5 and SEQ ID NO. 6; recovering and detecting the amplified DNA fragment; the gene segment of SEQ ID NO.1 is artificially synthesized (synthesized by Nanjing Kinsley), and the same base sequence of 20-30 bp exists between adjacent DNA segments. The reaction systems of PCR are: 5 × Reaction Buffer,10 μ L; 1. Mu.L of 10mM dNTPs; 10 μ M Forward Primer,2.5 μ L; 10. Mu.M Reverse Primer, 2.5. Mu.L; template DNA, 0.5. Mu.l; q5 High-Fidelity DNA polymers, 0.5. Mu.L; nuclear-Free Water, 33. Mu.L. The amplification conditions were: 3020 cycles at 98 ℃ 30s,98 ℃ 15s,58 ℃ 15s,72 ℃ 30s,72 ℃ 10min,4 ℃ 10min.

(2) The infectious clone plasmid TAR-rGI is subjected to double digestion linearization treatment by utilizing restriction enzymes Not I and Sac II, and a plasmid vector after the digestion is recovered by utilizing a Vazyme gel recovery kit. Then adopting NEB Gibson Assembly homologous recombination kit to mix the fragments of SEQ ID NO.1, SEQ ID NO.4 and SEQ ID NO.7 with TAR-rGI vector linearized by Not I and Sac II in equal proportion for recombination, wherein the reaction system is as follows: 1, 100ng of SEQ ID NO. 1; SEQID NO.4, 100ng; SEQ ID No.7, 100ng; linearized TAR-rGI,100ng; gibson Assembly Master Mix (2X), 5. Mu.L; deionized H ₂ O was supplemented to 10. Mu.L. The reaction conditions are as follows: 50 min at 50 ℃ and 10min at 4 ℃. Transforming the recombinant product into competent Escherichia coli TOP 10, and applying the transformed Escherichia coli to kanamycin (K) ⁺ ) And (3) placing the resistant LB plate in an incubator at 26 ℃ for culturing for 48h, selecting a single colony for PCR identification, identifying a positive clone for plasmid extraction and sequencing, and naming the clone with correct sequencing as TAR-rGI-mCherry with the sequence shown in SEQ ID NO. 8.

1.2 rescue and identification of recombinant viruses;

the plasmid TAR-rGI-mCherry is linearized by restriction enzyme Sal I, the restriction enzyme digestion product is recovered, and NEB High Scribe T7 High Yield RNA Synthesis Kit is used for in vitro transcription of the restriction enzyme digested TAR-rGI-mCherry to obtain the genome RNA full length of the recombinant virus. The reaction system is as follows: linearized plasmid TAR-rGI-mCherry,500ng; NTP (CTP, GTP, ATP, UTP100 mM), 1. Mu.L; t7 RNA Polymerase Mix, 2. Mu.L; 10. XT 7 Reaction Buffer, 2. Mu.L; m7G (5 ') ppp (5') A RNA Cap Structure Analog (40 mM), 2. Mu.L; nuclean-free water was supplemented to 20. Mu.L. The reaction conditions are as follows: after 2h at 37 ℃ 2. Mu.L of Nase I (RNase-free) was added and the reaction was carried out at 37 ℃ for 15 min to remove the DNA template. The obtained recombinant virus RNA is directly transfected into BHK-21 cells, the cells are cultured in an incubator for 48 to 72 hours at 37 ℃, cells without transfected RNA are set as a control group, and the cytopathic state and red fluorescence expression conditions of the experimental group and the control group are observed through an inverted fluorescence microscope. At 48h post-transfection, cells transfected with recombinant viral RNA developed significant cytopathic effects (fig. 2) and visible significant red fluorescence expression under a fluorescence microscope (fig. 2), whereas control cells had no significant cytopathic effects with red fluorescence (fig. 2), indicating successful rescue of the recombinant virus and its designation as rGI-mCherry.

Example 2: identifying recombinant rGI-mCherry;

2.1 identification of recombinant viruses by indirect immunofluorescence assay (IFA);

the rescued recombinant viruses of example 1 were identified using indirect immunofluorescence assay (IFA). Recombinant virus rGI-mCherry rescued in example 1 and its parental virus YZ-1 were inoculated into BHK-21 cells grown to 80%, washed 3 times with PBS after 2h and replaced with fresh DMEM medium containing 2% Fetal Bovine Serum (FBS) at 37 ℃ with 5% CO ₂ The incubator of (1) was continued for 48 hours, and indirect immunofluorescence assay was performed using a monoclonal antibody against JEV NS 3.

The specific operation is as follows: DMEM medium was discarded, cells were gently washed 3 times with PBS, then cells were fixed with 4% paraformaldehyde, the fixative was discarded after 30min at room temperature and cells were washed 3 times with PBS. Then, cell blocking solution (PBS solution containing 1% BSA) was added to block the cells at room temperature for 1 hour, rabbit-derived antibody against JEV NS3 (Genetex, 500-fold dilution) was added, the cells were washed with PBS 3 times after 1 hour at room temperature, FITC-labeled secondary goat-anti-rabbit antibody diluted 1: 500 was added, the cells were protected from light at room temperature for 1 hour, and after washing the cells with PBS 3 times, the cells were observed and photographed under an inverted fluorescence microscope.

The results show that: the recombinant virus (rGI-mCherry) and the parent virus (YZ-1) both successfully express the NS3 protein, and the recombinant virus mCherry protein and the NS3 protein are co-localized in the same cell (FIG. 3A), which indicates that the recombinant virus rGI-mCherry successfully rescues and can express the carried exogenous red fluorescent protein (mCherry) gene.

2.2 Measuring the growth kinetics of the recombinant rGI-mCherry;

determination of growth kinetics of recombinant Virus rGI-mCherry, the rescued rG-mCherry in example 1 and the parental virus YZ-1 were inoculated into BHK-21 cells at a dose of 0.01MOI, and cell supernatants were harvested at 24h, 36h, 48h, 60h, and 72h post-infection and TCID was used ₅₀ The virus titer was determined and a multi-step growth curve of the virus was plotted. The results show that: the replication capacities of the recombinant rGI-mCherry and the parental virus YZ-1 are similar, the virus titer generally increases between 24h and 72h after the recombinant rGI-mCherry and the parental virus YZ-1 are infected, and the virus titer reaches the maximum after 60h (figure 3B). Meanwhile, 100-200 TCID is used for rGI-mCherry recombinant virus constructed by the invention and parent virus YZ-1 ₅₀ The dose of (2) was infected into BHK-21 cells, and after 2h of infection, cell supernatants were discarded and MEM medium containing 1% low melting agar and 2% FBS was added. After 4 days of infection, the covering material is discarded, after being washed by PBS, 0.1% crystal violet is added for dyeing for 30min, and the result shows that the recombinant virus rGI-mCherry can form virus plaques with uniform size in BHK-21 cells, and the size and the shape of the plaques are similar to those of the parent virus YZ-1 (FIG. 3C).

Example 3: the genetic stability analysis of recombinant virus rGI-mCherry comprises the following steps:

the recombinant virus rGI-mCherry in example 1 was serially passaged 10 times in BHK-21 cells to analyze the genetic stability of the exogenous mCherry gene in the recombinant virus genome. The rescued primary recombinant virus, rGI-mCherry, was infected into BHK-21 cells at a dose of 0.1 MOI. Cell samples and virus supernatant were harvested 36h after infection and defined as P1, after which 100. Mu.L of P1-passage virus fluid was added to BHK-21 cells for re-culture (defined as P2). After 10 rounds of similar passages, cell samples and cell supernatants of the P1 generation, the P5 generation and the P10 generation are collected. Extracting virus RNA of different generations in Cell supernatant by using Fastpure Cell/Tissue Total RNA Isolation Kit, then performing RT-PCR, amplifying a virus genome region containing the mCherry gene by using a specific primer (F: TAATACGACTCACTATAGGAGGAAGTTTATCTGTGT; R: CTTTCCCGAAAGTCCACACAT), and further sequencing the whole virus genome without deletion of an exogenous gene (figure 4A) along with the proliferation of the virus, wherein the exogenous mCherry gene and the virus genome have no mutation. At the same time, the cells were fixed and the expression of the red fluorescent protein was observed under a fluorescent microscope, and as a result, mCherry was expressed efficiently and stably in all of the 1 (P1), 5 (P5) and 10 (P10) generations of the recombinant virus (fig. 4B). The results show that the exogenous gene mCherry can be stably expressed in the propagation and passage processes of the virus, and the GI type recombinant Japanese encephalitis virus rGI-mCherry constructed by the invention has genetic stability.

Example 4: the application of recombinant rGI-mCherry in screening antiviral drugs comprises the following steps:

the drug Nitroxoline was dissolved in DMSO at a final concentration of 0.1% in the culture, and the cells without drug effect were treated with 0.1% DMSO as a negative control. The drugs were diluted with DMSO to different concentrations with DMEM containing 2% FBS for use. BHK-21 cells were seeded in 96-well plates in advance until the cell density reached 90%. 50uL (200 TCID) ₅₀ ) The recombinant virus rGI-mCherry expressing the red fluorescent protein was mixed with 50. Mu.L of the drug to be tested (0. Mu.M to 10. Mu.M) diluted with 2% v/v FBS DMEM medium, and the mixture was added to each well and incubated at 37 ℃ for 2 hours. Subsequently, the virus solution in each well was discarded, and DMEM medium containing different concentrations of the drug (0. Mu.M to 10. Mu.M) and 2% (v/v) FBS was added thereto at 37 ℃ and 5% (v/v) CO ₂ The incubator of (2). After 48h of culture, the cell nuclei were stained with DPAI, the cell plates were observed in a high content fluorescence microscope, and scanned and analyzed using the red fluorescent protein fluorescence channel and the cell nucleus staining fluorescence channel.

The results show that: the Nitroxoline has obvious inhibiting effect on the recombinant virus rGI-mCherry at 1-10 mu M (figure 5), and a fluorescence image shows that the fluorescence signal of the recombinant virus is gradually weakened when the concentration of the drug is increased (figure 5), so that the recombinant virus rGI-mCherry can evaluate the antiviral effect of the drug.

Claims (3)

1. A preparation method of a recombinant GI type Japanese encephalitis virus stably expressing a red fluorescent protein mCherry is characterized by comprising the following steps:

(1) Constructing a full-length infectious clone carrying the mCherry gene;

inserting a C38-mCherry-T2A gene sequence between a 5' non-coding region UTR and a C gene of a GI type Japanese encephalitis virus genome, wherein the C38-mChery-T2A gene sequence is SEQ ID NO.1, so as to construct a recombinant virus genome carrying a fluorescent protein gene; the method comprises the following specific steps: amplifying the fragment SEQ ID NO.4 by using primers shown in SEQ ID NO.2 and SEQ ID NO. 3; amplifying the fragment SEQ ID NO.7 by using primers shown in SEQ ID NO.5 and SEQ ID NO. 6; recovering and detecting the amplified DNA fragments; the SEQ ID NO.1 gene segment is artificially synthesized;

20-30 bp of homologous sequence exists between adjacent DNA fragments; mixing the fragments of SEQ ID NO.1, SEQ ID NO.4 and SEQ ID NO.7 with the linearized infectious cloning vector TAR-rGI treated with Not I and Sac II enzymes in equal proportion, and carrying out homologous recombination by using NEB Gibson Assembly recombinase; then, in the transformed escherichia coli Top 10, selecting a monoclonal colony for amplification and plasmid extraction, and identifying and sequencing the correct plasmid, namely TAR-rGI-mCherry;

rescue of recombinant viruses;

after linearization treatment is carried out on the plasmid TAR-rGI-mCherry by using restriction enzyme Sal I, the linearized TAR-rGI-mCherry plasmid is subjected to in vitro transcription by using NEB High Scribe T7 High Yield RNA Synthesis Kit to obtain the full length of genome RNA of the recombinant virus; direct transfection of recombinant viral RNA into BHK-21 cells grown at 70% and subjecting the transfected cells to 37 ℃ containing 5% CO ₂ When the cells are cultured in the cell culture box, the cells are subjected to typical pathological changes and express obvious red fluorescent protein, namely the recombinant GI type Japanese encephalitis virus is obtained and named as rGI-mCherry.

2. The recombinant GI type Japanese encephalitis virus expressing the red fluorescent protein mCherry prepared in claim 1.

3. The use of the recombinant GI type Japanese encephalitis virus of claim 2 expressing red fluorescent protein mCherry in screening antiviral drugs.

Images