CN111575319A

CN111575319A - Efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method and application thereof

Info

Publication number: CN111575319A
Application number: CN202010439225.2A
Authority: CN
Inventors: 刘文华; 朱庆锋; 陈庄; 陈中健; 刘圣杰; 吴秀菊; 戴彰言
Original assignee: Guangdong Academy Of Agricultural Sciences-Agricultural Biological Gene Research Center
Current assignee: Guangdong Academy Of Agricultural Sciences-Agricultural Biological Gene Research Center
Priority date: 2020-05-22
Filing date: 2020-05-22
Publication date: 2020-08-25
Anticipated expiration: 2040-05-22
Also published as: CN111575319B

Abstract

The invention discloses a high-efficiency CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method and application thereof. The method comprises the following steps: (1) carrying out biotin labeling on the donor DNA to obtain the donor DNA labeled by biotin; (2) uniformly mixing the fusion protein of the Cas9 protein and monovalent streptavidin, sgRNA and donor DNA marked by biotin, and standing to obtain a CRISPR RNP-donor DNA complex; (3) the CRISPR RNP-donor DNA complex is subjected to nuclear transformation to effect gene insertion or replacement. The fusion protein can be combined with the characteristic of biotin labeled donor DNA, so that CRISPR RNP and the donor DNA are commonly presented at a target site, the accurate insertion of the donor DNA at the target site or the accurate replacement of a target site gene is realized, and the fusion protein is suitable for the breeding of crops and livestock.

Description

Efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method and application thereof.

Background

In the CRISPR gene editing and breeding process, the breeding of biological excellent characters is mainly realized by three strategies: knocking out negative regulatory genes with excellent characters; single base editing and guided editing (Prime editing) controls single nucleotide change sites and a plurality of nucleotide change sites with excellent properties; and longer regulatory or coding sequences of the homologous recombination superior trait genes are listed at the allelic site or at a safe site in the genome. Gene knockout, single base editing and guided editing, and homologous recombination-based gene insertion or replacement techniques are the cornerstones of CRISPR gene editing techniques, and are playing a great role in molecular breeding practices where excellent traits are obtained by precisely writing biogenetic information.

Gene knock-out is the disruption of a gene by inserting or deleting several nucleotides to create a frame shift mutation after introducing CRISPR components in a cell to create a Double-stranded nick (DSB), activating a cell Non-homologous end-binding repair mechanism (NHEJ). Single base editing utilizes CRISPR guide effect to introduce cytosine (C) deaminase or adenine (A) deaminase at target site to realize conversion from cytosine to thymine (T) or adenine to guanine (G); the guide editing is to introduce RNA reverse transcriptase and template RNA at the same time at the target site to realize base conversion, base substitution and short sequence deletion or insertion. The gene insertion or replacement based on homologous recombination is realized by supplying exogenous DNA with homologous arms after a double-stranded nick is generated in a CRISPR component, and realizing the insertion of the exogenous DNA or the replacement of the original DNA in a target site through a cell homologous recombination repair mechanism (HDR). The gene knockout is a not very precise gene editing due to the randomness of inserting or deleting bases at a target site. Single base editing and guided editing is precise gene editing, but only effective editing of single base or limited length DNA sequences. The gene insertion or substitution based on homologous recombination is also an accurate gene editing, and can operate DNA with the size of Kb to dozens of Kb, thus having wider application prospect in the fields of medicine, synthetic biology and agriculture.

The gene insertion or substitution by using CRISPR nucleic acid protein (RNP) and donor DNA as gene editing components using a cell homologous recombination mechanism generally employs a method of: CRISPR RNP assembled in vitro of Cas9 protein and sgRNA, mixed with a proportion of donor DNA, was introduced into the nucleus by nuclear transfection (Nucleofection) or Biolistic bombardment (Biolistic bombardent), CRISPR RNP created a double-stranded nick at the target site, and the donor DNA was precisely integrated into the target site. This approach affects the accuracy and efficiency of gene insertion or replacement due to the possible temporal and spatial inconsistencies between CRISPR RNP and the donor DNA, i.e., the lack of simultaneous occurrence at the gene editing target site.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a high-efficiency gene insertion or replacement method mediated by CRISPR RNP and donor DNA co-location, firstly, the invention expresses a fusion protein (Cas9-Xten-mSA) of Cas9 and monovalent streptomycin (mSA), then biotin labels the donor DNA, CRISPR RNP and the donor DNA form a complex through the affinity of mSA and biotin, and the complex is drawn to a target site by utilizing the search function of RNP, so that after the Cas9 generates a DNA double-strand cut at the target site, the donor DNA can timely provide a template required by homologous recombination repair cut in situ, thereby improving the gene insertion or replacement efficiency.

It is another object of the present invention to provide the use of the highly efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method.

The purpose of the invention is realized by the following technical scheme:

a highly efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method, comprising the steps of:

(1) carrying out biotin labeling on the donor DNA to obtain the donor DNA labeled by biotin;

(2) uniformly mixing the Cas9 protein with a fusion protein (Cas9-Xten-mSA protein) of monovalent streptavidin (Monostreptavidin, mSA), sgRNA and biotin-labeled donor DNA, and standing to obtain a CRISPR RNP-donor DNA complex;

(3) the CRISPR RNP-donor DNA complex is subjected to nuclear transformation to effect gene insertion or replacement.

The gene insertion or substitution can be the insertion or substitution of any gene sequence; especially, gene insertion or replacement in agricultural organisms such as rice and pigs, such as replacement of herbicide sensitive gene ALS1 in rice; replacement of bacterial blight and/or rice blast susceptible genes; insertion of environmentally friendly genes in the porcine genome at the Rosa26 and/or H11 safe sites.

The bacterial leaf blight and/or rice blast susceptible gene comprises rice bacterial leaf blight and/or rice blast susceptible genes, such as OsSWEET14, OsSWEET13, OsSweet11, pi21 genes and the like.

The environment-friendly genes at the Rosa26 and/or H11 safety sites in the pig genome comprise cellulase genes bg17, eg131, xylanase genes xynB, phytase genes appA and the like.

The donor DNA in the step (1) is preferably donor DNA containing a terminal homology arm, an RNA Splice Acceptor (SA) and a coral green fluorescent protein coding sequence (ZsGreen1), and the nucleotide sequence of the donor DNA is shown in SEQ ID NO. 4.

The biotin labeling described in step (1) is preferably achieved by: and (3) performing PCR amplification by using the donor DNA as a template and using a biotin labeled primer SEQ ID NO.23 and a primer SEQ ID NO.24 to obtain the biotin labeled donor DNA.

The fusion protein of the Cas9 protein and the monovalent streptavidin (Cas9-Xten-mSA protein) in the step (2) is a Cas9-Xten-mSA fusion protein connected with a Xten linker, and the amino acid sequence of the fusion protein is shown as SEQ ID NO. 1; the Cas9-Xten-mSA protein can be obtained by expression and purification by means of conventional technical means in the field, and is preferably prepared by the following method:

(A) using pET-NLS-Cas9-6xHis plasmid as a template and SEQ ID NO.6 and SEQ ID NO.7 as primers to carry out amplification to obtain a fragment I; simultaneously, taking the sequences SEQ ID NO.8 and SEQ ID NO.9 as primers to carry out amplification to obtain a fragment II; adopting an Overlap extension PCR method, taking a mixture of the fragments I and II in equal molar ratio as a template, and amplifying by using primers SEQ ID NO.6 and SEQ ID NO.9 to obtain a fusion fragment of the fragments I and II; after the fused fragment is cut by SacI and AvrII enzyme, inserting the fused fragment into pET-NLS-Cas9-6xHis plasmid cut by the same enzyme to obtain pET-NLS-Cas9-NLS-6xHis plasmid;

(B) pET-NLS-Cas9-NLS-6xHis plasmid is taken as a template, and sequences SEQ ID NO.10 and SEQ ID NO.11 are taken as primers for amplification to obtain a fragment III; taking the Xten-mSA gene as a template and taking the sequences SEQ ID NO.12 and SEQ ID NO.13 as primers for amplification to obtain a fragment IV; adopting an Overlap Extension PCR method, taking a mixture of fragments III and IV in an equimolar ratio as a template, and amplifying by using primers SEQ ID NO.10 and SEQ ID NO.13 to obtain a fusion fragment of the fragments III and IV; after the fused fragment is digested by SacI and XhoI, inserting the digested fused fragment into pET-NLS-Cas9-NLS-6xHis plasmid to obtain expression plasmid pET-Cas 9-Xten-mSA; wherein, the nucleotide sequence of the Xten-mSA gene is shown as SEQID NO. 5;

(C) the expression plasmid pET-Cas9-Xten-mSA is transformed into escherichia coli and then cultured, IPTG is added for induction expression, bacteria are collected, ultrasonic lysis is carried out, and purification is carried out, so that Cas9-Xten-mSA protein, namely the fusion protein of Cas9 protein and monovalent streptavidin is obtained.

The Escherichia coli described in step (C) is preferably E.coli Rosetta (DE 3).

The conditions for the cultivation in the step (C) are preferably: cultured at 200rpm and 37 ℃ until OD600 becomes 0.6.

The amount of IPTG used in step (C) was calculated as its addition at a final concentration of 0.5mmol/L in the system.

The conditions for inducing expression in step (C) are: the culture was carried out at 22 ℃ and 160rpm for 16 hours.

The nucleotide sequence of the fusion protein (Cas9-Xten-mSA protein) encoding Cas9 protein and monovalent streptavidin is shown in SEQ ID NO. 2.

The sgRNA in the step (2) is an in vitro transcribed sgRNA which takes a Rosa26 locus of a pig genome as a target site, and the nucleotide sequence of the sgRNA is shown as SEQ ID No. 3; the sgRNA can be synthesized by means of conventional techniques in the art, and is preferably synthesized by the following method:

(I) taking pGEM-T easy plasmid as a template and taking sequences SEQ ID NO.15 and SEQ ID NO.16 as primers to carry out PCR amplification to obtain a sequence I;

(II) carrying out PCR amplification by taking the pX330 plasmid as a template and taking the sequences SEQ ID NO.17 and SEQ ID NO.18 as primers to obtain a sequence II;

(III) adopting an Overlap Extension PCR method, taking a mixture of a sequence I and a sequence II in an equal molar ratio as a template, and amplifying by using primers SEQ ID NO.15 and SEQ ID NO.18 to obtain a fusion fragment of the sequence I and the sequence II (namely, the fusion fragment of a DNA coding sequence containing a T7 promoter sequence, a sgRNA guide sequence and a DNA coding sequence of a sgRNA framework sequence, wherein the nucleotide sequence of the sgRNA guide sequence is shown as SEQ ID NO. 14); and then taking the fusion fragment of the sequence I and the sequence II as a template for in vitro sgRNA transcription, and carrying out in vitro transcription to obtain the sgRNA.

The molar ratio of the fusion protein of the Cas9 protein and the monovalent streptavidin (Cas9-Xten-mSA protein) to the biotin-labeled donor DNA in the step (2) is 8-32: 1; preferably 20-24: 1.

The molar ratio of the fusion protein of the Cas9 protein and the monovalent streptavidin (Cas9-Xten-mSA protein) to the sgRNA in the step (2) is 1: 1-1.2; preferably 1: 1.

The standing condition in the step (2): standing at room temperature for 15-25 min; preferably: standing at room temperature for 20 min.

The cells in the step (3) are embryonic fibroblasts; preferably porcine embryonic fibroblasts.

The transformation of the nucleus in the step (3) is preferably carried out by the following method: adding the nuclear transformation liquid of P3 Primary Cell 4D-Nucleofector X kit into cells, and uniformly mixing to obtain a mixed liquid; CRISPRRNP-donor DNA complex is then added and nuclear transformation is performed using a nuclear transfectator.

The volume ratio of the mixed solution to the CRISPR RNP-donor DNA complex is 1: 0.5-1.

The application of the efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method in gene editing.

The environment of the application is in vitro environment, such as livestock embryo fibroblasts and the like.

The livestock embryonic fibroblasts comprise porcine embryonic fibroblasts and the like.

The gene editing comprises gene insertion or gene replacement.

The efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method is applied to crop breeding.

The crops comprise rice and the like.

Compared with the prior art, the invention has the following advantages and effects:

(1) the invention provides an CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method, namely, a fusion protein of Cas9 protein and monovalent streptavidin (Monostreptavidin, mSA) is utilized to combine the characteristic of biotin labeling of donor DNA, so that CRISPR RNP and donor DNA co-appear at a target site, and the accurate insertion of the donor DNA at the target site or the accurate replacement of the target site gene are realized. The method provided by the invention is an effective method for gene insertion or replacement, and can play an important role in breeding of crops and livestock with excellent character gene editing breeding.

(2) According to the invention, Cas9-Xten-mSA fusion protein connected with an Xten linker is expressed and purified firstly, then sgRNA taking a pig genome Rosa26 site as a target site is transcribed in vitro, donor DNA containing a terminal homologous arm, an RNA splicing acceptor (Splice acceptor, SA) and a coral green fluorescent protein coding sequence (ZsGreen1) marked by biotin is prepared, and finally CRISPR RNP-donor DNA complex is assembled in vitro, and a pig embryo is subjected to nuclear transformation to form a fibroblast. In cells, CRISPRRNP after incision at target site, using cell homologous recombination repair mechanism, the donor DNA coordinated and combined on CRISPR RNP is precisely integrated on the target site, so that the Green1 gene on the donor DNA is expressed by using endogenous Rosa26 promoter, and the co-location mediated gene insertion or replacement efficiency of CRISPR RNP and donor DNA is determined by PCR product gel electrophoresis and flow cytometry analysis.

(3) The CRISPR RNP-donor DNA complex produced by the invention has improved homologous recombination efficiency, so that the gene insertion or replacement of a large fragment is more feasible in breeding practice of agricultural biological trait improvement.

(4) CRISPR RNP-donor DNA complex is introduced into embryonic fibroblasts of domestic animals such as pigs or fertilized eggs in one-cell stage by nuclear transformation or microinjection, and the embryonic fibroblasts or fertilized eggs with excellent properties can be obtained by gene insertion of safe loci or replacement of inferior genes in genomes, and are used for gene editing breeding of domestic animals such as pigs.

(5) The CRISPR RNP-donor DNA complex is introduced into the callus or young embryo of rice and other crops through gene gun bombardment, and new germplasm of rice and other crops with excellent characters can be obtained through gene insertion of safe sites or replacement of inferior genes in the genome.

Drawings

FIG. 1 is a schematic diagram of the insertion of the ZsGreen1 gene at the Rosa26 site in the pig genome.

FIG. 2 is a diagram showing the results of purification of Cas9-Xten-mSA protein (Crude: Cas9-Xten-mSA protein before purification; Purified Cas9-Xten-mSA protein).

FIG. 3 is a graph of results of in vitro transcription of Rosa26 sgRNA.

FIG. 4 is a diagram of the results of in vitro cleavage electrophoresis of CRISPR RNP (Cas 9-Xten-mSA-sgRNA).

FIG. 5 is a diagram of Cas9-Xten-mSA complexed with biotin-labeled DNA.

FIG. 6 is a diagram showing the results of gel electrophoresis detection of PCR-amplified fragments of the fibroblast cells into which the ZsGreen1 gene was inserted (Full: Full-length sequence; Left: Right).

FIG. 7 is a fluorescent image of ZsGreen1 gene inserted into fibroblasts; wherein, A is a cell fluorescence map of CRISPR RNP-donor DNA complex (sgRNA-Cas9-Xten-mSA-ZsGreen1) after nuclear transformation; b is a cell fluorescence picture of a control group CRISPRRNP-donor DNA mixture (sgRNA-Cas9+ ZsGreen1) after nuclear transformation.

FIG. 8 is a diagram showing the results of detection of ZsGreen1 gene insertion by flow cytometry.

Detailed Description

The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto. The instruments, reagents, materials and the like used in the examples are conventional instruments, reagents, materials and the like in the prior art and are commercially available in a normal way unless otherwise specified. Unless otherwise specified, the experimental methods, detection methods, and the like described in the following examples are conventional experimental methods, detection methods, and the like in the prior art. In the following examples, techniques not described in detail and not specifically indicated are all conventional technical means in the prior art, and can be performed according to the conventional experimental conditions of molecular biology and cell biology or according to the conditions suggested by the manufacturer's instructions.

The primer sequences related in the embodiment of the invention are synthesized by the company ThermoFisher Scientific China; the genes or gene fragments are synthesized by Shanghai Czeri bioengineering GmbH.

Example 1

(1) Preparation of Cas9-Xten-mSA protein

a. Construction of expression plasmid pET-Cas9-Xten-mSA

Synthesizing a DNA (SEQ ID NO.5) sequence for coding Xten-mSA, cloning the DNA sequence to a pET-NLS-Cas9-NLS-6xHis vector by an enzyme digestion connection method, and obtaining an expression plasmid pET-Cas 9-Xten-mSA; the method comprises the following specific steps:

the plasmid pET-NLS-Cas9-6xHis (Addgene) is obtained by the original company of Beijing, and the plasmid is used as a template, and a primer 5'-CGCTAGAGCTCCCGCTGCTTTTAAATATTTTG-3' (SEQ ID NO.6) and a primer 5'-GCAGCTTCAACTTTTTCTTTTTGTCACCTCCTAGCTGACTCAAATC-3' (SEQ ID NO.7) are used for amplification to obtain a fragment I; amplification was performed using primer 5'-TGACAAAAAGAAAAAGTTGAAGCTGCATCACCACCACCATCACTAATG-3' (SEQ ID NO.8) and primer 5'-GCAGCCTAGGTTAATTAAGCTGCGCTAG-3' (SEQ ID NO.9) to give fragment II. The fusion fragment of the fragments I and II is obtained by adopting an Overlap Extension PCR method, taking a mixture of the fragments I and II in equal molar ratio as a template and utilizing the primers (the primer SEQ ID NO.6 and the primer SEQ ID NO.9) to amplify. After the fusion fragment was digested with SacI and AvrII, the fragment was inserted into pET-NLS-Cas9-6XHis plasmid digested in the same manner to obtain pET-NLS-Cas9-NLS-6XHis plasmid (Cas9 protein expression plasmid).

And then, using pET-NLS-Cas9-NLS-6xHis plasmid as a template, and using a primer 5'-TTGGAGCTCCCGCTGCTTTTAAATATTTTG-3' (SEQ ID No.10) and a primer 5'-AAGAACCACCAGACAGCTTCAACTTTTTCTTT TTGTCACCTCCTAGCTG-3' (SEQ ID No.11) for amplification to obtain a fragment III. Xten-mSA sequence (SEQ ID NO.5) synthesized by Haemargiz bioengineering company is used as a template, and a primer 5'-AAAGTTGAAGCTGTCTGGTGGTTCTTCTGGTGGTTCTAGCGGCAG-3' (SEQ ID NO.12) and a primer 5'-AGACTCGAGTCATTAGTGATGGTGGTGGTGATGGGATCCAG-3' (SEQ ID NO.13) are used for amplification to obtain a fragment IV. And (3) adopting an overlapExtension PCR method, taking a mixture of the fragments III and IV in an equal molar ratio as a template, and amplifying by using a primer (SEQ ID NO.10) and a primer (SEQ ID NO.13) to obtain a fusion fragment of the fragments III and IV. After the fused fragment is digested by SacI and XhoI, the digested fused fragment is inserted into pET-NLS-Cas9-NLS-6xHis plasmid to obtain expression plasmid pET-Cas9-Xten-mSA (fusion expression plasmid of Cas9 protein and monovalent streptavidin).

b. Expression and purification of Cas9-Xten-mSA protein

Expressing Cas9-Xten-mSA fusion protein in E.coli Rosetta (DE3) (Sigma), wherein two ends of Cas9 in the fusion protein respectively contain a Nuclear Localization Signal (NLS), and the C end of the fusion protein contains a 6XHis tag, and the method comprises the following specific steps: e.coli Rosetta (DE3) was transformed with the expression plasmid pET-Cas9-Xten-mSA constructed above, and a single clone was picked up and cultured overnight. The overnight strain was transferred to a large flask of LB medium at a ratio of 1:100(v/v), cultured at 37 ℃ at 200rpm until OD600 became 0.6, and IPTG (isopropyl-. beta. -D-thiogalactoside) was added to a final concentration of 0.5mM, and cultured at 22 ℃ for another 16 hours at 160rpm, after which the strain was harvested for protein extraction.

② collecting the bacteria (the following steps are all carried out at low temperature), centrifuging at 6000rpm for 15min, removing the supernatant, suspending the precipitate with molecular sieve buffer (20mM Tris, 50mM NaCl, pH7.5, 1mM TCEP (Tris (2-carboxyethyl) phosphine)), collecting in a vial, and ultrasonically lysing on ice (6S ultrasound, 12S interval, 120 times, about 300W). The mixture was centrifuged at 15000rpm for 20min to remove the precipitate, and the supernatant was sterilized by filtration through a 0.22 μm pore filter. The supernatant was separated with Ni Sepharose High Performance (GE), and the resulting eluate was separated again with Qsepharose (Q-Sepharose, Sigma), dialyzed against a buffer of 20mM HEPES (pH7.5), 500mM KCl, 1mM TCEP, 10% (v/v) glycerol (glycerol), and concentrated with Ultracel 100K column (Millipore) to give a purified Cas9-Xten-mSA protein of about 177kDa in size (FIG. 2). The results show that: high-purity Cas9-Xten-mSA protein is obtained. The protein sequence of Cas9-Xten-mSA is shown as SEQ ID NO.1, and the gene sequence of Cas9-Xten-mSA is shown as SEQ ID NO. 2.

(2) Design of sgRNA guide sequence and in vitro transcription

The pig Rosa26 homologous gene locus is searched in an Ensembl (www.ensembl.org) database, a first intron region of the Rosa26 gene is selected as a target locus, a sgRNA guide sequence (SEQ ID NO. 14: GUGAGAGUUAUCUGACCGUA) is designed, and the mode that the ZsGreen1 gene is inserted into the Rosa26 locus in the pig genome is shown in figure 1. pGEM-T easy plasmid (Promega) is used as a template, and primers 5'-GATGTGCTGCAAGGCGATTAAGTTG-3' (SEQ ID NO.15) and 5'-AACTACGGTCAGATAACTCTCACCTATAGTGAGTCGTATTACAATTC-3' (SEQ ID NO.16) are used for amplification to obtain a sequence I. Using pX330 plasmid (Addgene) as template, amplification was performed with primer 5'-AACTACGGTCAGATAACTCTCACCTATAGTGAGTCGTATTACAATTC-3' (SEQ ID NO.17) and primer 5'-AAAAGCACCGACTCGGTGCCAC-3' (SEQ ID NO.18) to obtain sequence II. Adopting an Overlap Extension PCR method, taking a mixture of a sequence I and a sequence II in equal molar ratio as a template, and utilizing a primer SEQ IDNo.15 and a primer SEQ ID No.18, and obtaining a fusion fragment of the sequence I and the sequence II (namely, a fusion fragment of a DNA coding sequence containing a T7 promoter sequence, a sgRNA guide sequence and a DNA coding sequence of a sgRNA framework sequence). The fusion fragment is used as a template for sgRNA in vitro transcription, and MEGAscript is used^TMT7 High Yield transcription Kit (Invitrogen) was subjected to in vitro transcription to obtain 100nt of in vitro transcribed sgRNA (SEQ ID NO. 3). The obtained sgRNA was purified by MEGAclear^TMKit (Invitrogen) (FIG. 3). The results show that: sgrnas transcribed in vitro were obtained.

(3) CRISPR RNP (Cas9-Xten-mSA-sgRNA) nucleic acid proteinases are cleaved in vitro

Primers 5'-GATGGGAAATGAGTCCAGGCAACAC-3' (SEQ ID NO.19) and 5'-CATTACGGCAACTGAGCTCAGTTAC-3' (SEQ ID NO.20) are designed upstream and downstream of a first intron region sgRNA target site of the Rosa26 gene, porcine embryonic fibroblast (purchased from Guangdong Wen boar science and technology Co., Ltd.) genomic DNA is extracted, and a 639bp fragment is amplified by the primers to be used as in vitro cutting target DNA. The following reaction system was prepared: 60ng target DNA,500ng Cas9-Xten-mSA protein, 100ng sgRNA, 0.3. mu.L 10mg/ml BSA (bovine serum albumin), 3. mu.L 10 XNEBbuffer 3, add ddH₂O to a total volume of 30. mu.L. The reaction was carried out at 37 ℃ for 1 hour and at 80 ℃ for 2 minutes. CRISPR RNP excision was detected by 1.5% gel electrophoresis, and two bands of 405bp and 234bp in length appeared (FIG. 4). The results show that: the target band obtained by cutting is consistent with the expected size, and the activity of the obtained high-purity Cas9-Xten-mSA protein is verified.

(4) Binding of Cas9-Xten-mSA protein to Biotin labeled DNA

A DNA fragment 321bp in length was amplified from the genome of porcine embryonic fibroblasts (same as the above step (3)) using biotin primer 5 '-bio-CTTGGGTTTCCTGTGCAAACCATTG-3' (SEQ ID NO.21) and primer 5'-CGA GCCACATATGGACCTATACCAC-3' (SEQ ID NO.22) as biotin-labeled DNA. Cas9-Xten-mSA protein and biotin-labeled DNA were mixed together at a molar ratio of 0:1, 8:1, 16:1, 24:1, 32:1 in 1xNEB buffer3, respectively, left at room temperature for 30 minutes, and separated by 1.5% gel electrophoresis, and the complex resulting from the binding of Cas9-Xten-mSA protein and biotin-labeled DNA remained in the spot wells, and when the molar ratio of protein to DNA reached 24:1, biotin DNA was completely bound and remained in the spot wells (FIG. 5). The results show that: the Cas9-Xten-mSA protein has better biotin labeling DNA binding activity.

(5) CRISPR RNP-Donor DNA Complex preparation and transformation of porcine embryonic fibroblast nuclei

Synthesis of 5116bp Green1 Gene Donor DNA (SEQ ID NO.4) containing the left, SA-ZsGreen1-PolyA and the right homology arm (synthesized by Shanghai Jiyuri bioengineering Co., Ltd.) then design of Biotin primers 5 '-bio-GGATTGAGCAGGTGTAC GAGGAC-3' (SEQ ID NO.23) and 5'-GAGTTCCAATTATGGCTTAGCGGGTTAAG-3' (SEQ ID NO.24), amplification with Gotaq Long PCR Master Mix (Promega) using Donor DNA as template to obtain Biotin labeled Donor DNA 100pmol of Cas9-Xten-mSA protein, 100pmol of sgRNA and 5pmol of Biotin labeled Donor DNA, mixing them uniformly, standing at room temperature for 20min to form CRISPR RNP-Donor DNA complex, adding it to 3 × 10 Kiza 10 previously mixed with 20. mu. l P3 Primary 4D-Nuclear of Afector X (Lonza) nuclear transformation solution⁵Individual porcine embryonic fibroblasts (purchased from Guangdong Wen swine technologies, Inc.) were subjected to nuclear transformation using a pre-programmed CM-138 in an Amaxa 4D-Nuclear effector X Unit (Lonza) nuclear transfectator.

(6) Gel electrophoresis detection of PCR amplified fragment of ZsGreen1 gene inserted into fibroblast

Genomic DNA of the cell population transformed with CRISPR RNP-donor DNA complex in step (5) was extracted, and the Full-length sequence (Full), Left border sequence (Left) and Right border sequence (Right) of the ZsGreen1 gene inserted at the Rosa26 site were amplified using three pairs of primers (Table 1), to obtain 5116bp, 530bp and 3776bp fragments, respectively (FIG. 6). The 3 size fragments were recovered for Sanger sequencing. The results show that: the correct insertion of the ZsGreen1 gene at the Rosa26 site was successfully detected from the obtained transformed cell population.

Table 1 identification of Green1 Gene insertion PCR primers

Example 2 Nuclear transformation cell population ZsGreen1 Gene expression Observation and flow cytometry analysis

(1) After 24 hours of nuclear transformation in example 1 step (6), expression of the ZsGreen1 gene was observed under a Zeiss Axio Observer A1 fluorescent inverted microscope, and about 10% of the cells fluoresced after nuclear transformation with the CRISPR RNP-donor DNA complex (sgRNA-Cas9-Xten-mSA-ZsGreen1) (FIG. 7A); as a control, CRISPR RNP-donor DNA mixture (sgRNA-Cas9+ ZsGreen1) showed few cells that fluoresced after nuclear transformation (fig. 7B). The ZsGreen1 gene has no promoter when designing donor DNA, and only can be correctly inserted into the first intron of the Rosa26 gene through homologous recombination and can be expressed by depending on the Rosa26 gene promoter, so the fluorescent cell is a cell with the ZsGreen1 gene correctly inserted into a target site. Wherein, the nuclear transformation of CRISPR RNP and donor DNA mixture (sgRNA-Cas9+ ZsGreen1) in the control group is referred to example 1, which is as follows:

the Cas9 protein expression plasmid is pET-NLS-Cas9-NLS-6xHis plasmid, and the construction process is shown in step (1) a of example 1; the expression purification of Cas9 protein is the same as that of Cas9-Xten-mSA protein, with specific reference to example 1, step (1) b; the sequence of sgRNA is shown in SEQ ID NO.2, and the design and in vitro transcription method are the same as the step (2) of the example 1; the sequence of the donor DNA of the Green1 gene is shown in SEQ ID NO. 3; then referring to the method in step (5) of example 1, Cas9 protein, sgRNA and donor DNA were mixed uniformly to obtain CRISPR RNP-donor DNA mixture, and then nuclear transformation was performed according to the same method.

(2) The CRISPR RNP-donor DNA complex (sgRNA-Cas9-Xten-mSA-ZsGreen1) nuclear transformed porcine embryonic fibroblasts were trypsinized, centrifuged at 1000rpm for 5min to collect the cells, the supernatant was aspirated, and the cells were resuspended in PBS buffer. The cell suspension was filtered through a 50 μm nylon membrane into a flow tube in order not to clog the flow cytometer. The ratio of fluorescent cells was about 5.8% when analyzed by FACSAria II (BDBiosiens) flow cytometer (FIG. 8). The results show that: the insertion efficiency of the CRISPR RNP and the ZsGreen1 co-location mediated by the donor DNA is 5.8%.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> center for researching agricultural biological genes of Guangdong province academy of agricultural sciences

<120> a highly efficient CRISPR RNP and donor DNA co-location mediated gene insertion or substitution method and uses thereof

<160>30

<170>SIPOSequenceListing 1.0

<210>1

<211>1543

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Cas9-Xten-mSA protein sequence

<400>1

Met Pro Lys Lys Lys Arg Lys Val Met Asp Lys Lys Tyr Ser Ile Gly

1 5 10 15

Leu Asp Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu

20 25 30

Tyr Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg

35 40 45

His Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly

50 55 60

Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr

65 70 75 80

Thr Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn

85 90 95

Glu Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser

100 105 110

Phe Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly

115 120 125

Asn Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr

130 135 140

His Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg

145 150 155 160

Leu Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe

165 170 175

Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu

180 185 190

Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro

195 200 205

Ile Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu

210 215 220

Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu

225 230 235 240

Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu

245 250 255

Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu

260 265 270

Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala

275 280 285

Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu

290 295 300

Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile

305 310 315 320

Thr Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His

325 330 335

His Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro

340 345 350

Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala

355 360 365

Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile

370 375 380

Lys Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys

385 390 395 400

Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly

405 410 415

Ser Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg

420 425 430

Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile

435 440 445

Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala

450 455 460

Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr

465 470 475 480

Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala

485 490 495

Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn

500 505 510

Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val

515 520 525

Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys

530 535 540

Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu

545 550 555 560

Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr

565 570 575

Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu

580 585 590

Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile

595 600 605

Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu

610 615 620

Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile

625 630 635 640

Glu Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met

645 650 655

Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg

660 665 670

Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu

675 680 685

Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu

690 695 700

Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln

705 710 715 720

Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala

725 730 735

Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val

740 745 750

Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val

755 760 765

Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn

770 775 780

Ser Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly

785 790 795 800

Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn

805 810 815

Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val

820 825 830

Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His

835 840 845

Ile Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val

850 855 860

Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser

865 870 875 880

Glu Glu Val Val Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn

885 890 895

Ala Lys Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu

900 905 910

Arg Gly Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln

915 920 925

Leu Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp

930 935 940

Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu

945 950 955 960

Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys

965 970 975

Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His Ala

980 985 990

His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys

995 1000 1005

Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr

1010 1015 1020

Asp Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala

1025 1030 1035 1040

Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr

1045 1050 1055

Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu

1060 1065 1070

Thr Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe

1075 1080 1085

Ala Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys

1090 1095 1100

Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro

1105 1110 1115 1120

Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro

1125 1130 1135

Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu

1140 1145 1150

Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys LysLeu Lys Ser Val

1155 1160 1165

Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys

1170 1175 1180

Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys

1185 1190 1195 1200

Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn

1205 1210 1215

Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn

1220 1225 1230

Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser

1235 1240 1245

His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln

1250 1255 1260

Leu Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln

1265 1270 1275 1280

Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp

1285 1290 1295

Lys Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu

1300 1305 1310

Gln Ala Glu Asn Ile Ile His Leu Phe ThrLeu Thr Asn Leu Gly Ala

1315 1320 1325

Pro Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr

1330 1335 1340

Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile

1345 1350 1355 1360

Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp

1365 1370 1375

Lys Lys Lys Lys Leu Lys Leu Ser Gly Gly Ser Ser Gly Gly Ser Ser

1380 1385 1390

Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser

1395 1400 1405

Gly Gly Ser Ser Gly Gly Ser Met Ala Glu Ala Gly Ile Thr Gly Thr

1410 1415 1420

Trp Tyr Asn Gln Ser Gly Ser Thr Phe Thr Val Thr Ala Gly Ala Asp

1425 1430 1435 1440

Gly Asn Leu Thr Gly Gln Tyr Glu Asn Arg Ala Gln Gly Thr Gly Cys

1445 1450 1455

Gln Asn Ser Pro Tyr Thr Leu Thr Gly Arg Tyr Asn Gly Thr Lys Leu

1460 1465 1470

Glu Trp Arg Val Glu Trp Asn Asn Ser Thr Glu Asn Cys His Ser Arg

1475 1480 1485

Thr Glu Trp Arg Gly Gln Tyr Gln Gly Gly Ala Glu Ala Arg Ile Asn

1490 1495 1500

Thr Gln Trp Asn Leu Thr Tyr Glu Gly Gly Ser Gly Pro Ala Thr Glu

1505 1510 1515 1520

Gln Gly Gln Asp Thr Phe Thr Lys Val Lys Pro Ser Ala Ala Ser Gly

1525 1530 1535

Ser His His His His His His

1540

<210>2

<211>4629

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Cas9-Xten-mSA nucleotide sequence

<400>2

atgcccaaga agaagaggaa ggtgatggat aagaaatact caataggctt agatatcggc 60

acaaatagcg tcggatgggc ggtgatcact gatgaatata aggttccgtc taaaaagttc 120

aaggttctgg gaaatacaga ccgccacagt atcaaaaaaa atcttatagg ggctctttta 180

tttgacagtg gagagacagc ggaagcgact cgtctcaaac ggacagctcg tagaaggtat 240

acacgtcgga agaatcgtat ttgttatcta caggagattt tttcaaatga gatggcgaaa 300

gtagatgata gtttctttca tcgacttgaa gagtcttttt tggtggaaga agacaagaag 360

catgaacgtc atcctatttt tggaaatata gtagatgaag ttgcttatca tgagaaatat 420

ccaactatct atcatctgcg aaaaaaattg gtagattcta ctgataaagc ggatttgcgc 480

ttaatctatt tggccttagc gcatatgatt aagtttcgtg gtcatttttt gattgaggga 540

gatttaaatc ctgataatag tgatgtggac aaactattta tccagttggt acaaacctac 600

aatcaattat ttgaagaaaa ccctattaac gcaagtggag tagatgctaa agcgattctt 660

tctgcacgat tgagtaaatc aagacgatta gaaaatctca ttgctcagct ccccggtgag 720

aagaaaaatg gcttatttgg gaatctcatt gctttgtcat tgggtttgac ccctaatttt 780

aaatcaaatt ttgatttggc agaagatgct aaattacagc tttcaaaaga tacttacgat 840

gatgatttag ataatttatt ggcgcaaatt ggagatcaat atgctgattt gtttttggca 900

gctaagaatt tatcagatgc tattttactt tcagatatcc taagagtaaa tactgaaata 960

actaaggctc ccctatcagc ttcaatgatt aaacgctacg atgaacatca tcaagacttg 1020

actcttttaa aagctttagt tcgacaacaa cttccagaaa agtataaaga aatctttttt 1080

gatcaatcaa aaaacggata tgcaggttat attgatgggg gagctagcca agaagaattt 1140

tataaattta tcaaaccaat tttagaaaaa atggatggta ctgaggaatt attggtgaaa 1200

ctaaatcgtg aagatttgct gcgcaagcaa cggacctttg acaacggctc tattccccat 1260

caaattcact tgggtgagct gcatgctatt ttgagaagac aagaagactt ttatccattt 1320

ttaaaagaca atcgtgagaa gattgaaaaa atcttgactt ttcgaattcc ttattatgtt 1380

ggtccattgg cgcgtggcaa tagtcgtttt gcatggatga ctcggaagtc tgaagaaaca1440

attaccccat ggaattttga agaagttgtc gataaaggtg cttcagctca atcatttatt 1500

gaacgcatga caaactttga taaaaatctt ccaaatgaaa aagtactacc aaaacatagt 1560

ttgctttatg agtattttac ggtttataac gaattgacaa aggtcaaata tgttactgaa 1620

ggaatgcgaa aaccagcatt tctttcaggt gaacagaaga aagccattgt tgatttactc 1680

ttcaaaacaa atcgaaaagt aaccgttaag caattaaaag aagattattt caaaaaaata 1740

gaatgttttg atagtgttga aatttcagga gttgaagata gatttaatgc ttcattaggt 1800

acctaccatg atttgctaaa aattattaaa gataaagatt ttttggataa tgaagaaaat 1860

gaagatatct tagaggatat tgttttaaca ttgaccttat ttgaagatag ggagatgatt 1920

gaggaaagac ttaaaacata tgctcacctc tttgatgata aggtgatgaa acagcttaaa 1980

cgtcgccgtt atactggttg gggacgtttg tctcgaaaat tgattaatgg tattagggat 2040

aagcaatctg gcaaaacaat attagatttt ttgaaatcag atggttttgc caatcgcaat 2100

tttatgcagc tgatccatga tgatagtttg acatttaaag aagacattca aaaagcacaa 2160

gtgtctggac aaggcgatag tttacatgaa catattgcaa atttagctgg tagccctgct 2220

attaaaaaag gtattttaca gactgtaaaa gttgttgatg aattggtcaa agtaatgggg 2280

cggcataagc cagaaaatat cgttattgaa atggcacgtg aaaatcagac aactcaaaag 2340

ggccagaaaa attcgcgaga gcgtatgaaa cgaatcgaag aaggtatcaa agaattagga 2400

agtcagattc ttaaagagca tcctgttgaa aatactcaat tgcaaaatga aaagctctat 2460

ctctattatc tccaaaatgg aagagacatg tatgtggacc aagaattaga tattaatcgt 2520

ttaagtgatt atgatgtcga tcacattgtt ccacaaagtt tccttaaaga cgattcaata 2580

gacaataagg tcttaacgcg ttctgataaa aatcgtggta aatcggataa cgttccaagt 2640

gaagaagtag tcaaaaagat gaaaaactat tggagacaac ttctaaacgc caagttaatc 2700

actcaacgta agtttgataa tttaacgaaa gctgaacgtg gaggtttgag tgaacttgat 2760

aaagctggtt ttatcaaacg ccaattggtt gaaactcgcc aaatcactaa gcatgtggca 2820

caaattttgg atagtcgcat gaatactaaa tacgatgaaa atgataaact tattcgagag 2880

gttaaagtga ttaccttaaa atctaaatta gtttctgact tccgaaaaga tttccaattc 2940

tataaagtac gtgagattaa caattaccat catgcccatg atgcgtatct aaatgccgtc 3000

gttggaactg ctttgattaa gaaatatcca aaacttgaat cggagtttgt ctatggtgat 3060

tataaagttt atgatgttcg taaaatgatt gctaagtctg agcaagaaat aggcaaagca 3120

accgcaaaat atttctttta ctctaatatc atgaacttct tcaaaacaga aattacactt 3180

gcaaatggag agattcgcaa acgccctcta atcgaaacta atggggaaac tggagaaatt 3240

gtctgggata aagggcgaga ttttgccaca gtgcgcaaag tattgtccat gccccaagtc 3300

aatattgtca agaaaacaga agtacagaca ggcggattct ccaaggagtc aattttacca 3360

aaaagaaatt cggacaagct tattgctcgt aaaaaagact gggatccaaa aaaatatggt 3420

ggttttgata gtccaacggt agcttattca gtcctagtgg ttgctaaggt ggaaaaaggg 3480

aaatcgaaga agttaaaatc cgttaaagag ttactaggga tcacaattat ggaaagaagt 3540

tcctttgaaa aaaatccgat tgacttttta gaagctaaag gatataagga agttaaaaaa 3600

gacttaatca ttaaactacc taaatatagt ctttttgagt tagaaaacgg tcgtaaacgg 3660

atgctggcta gtgccggaga attacaaaaa ggaaatgagc tggctctgcc aagcaaatat 3720

gtgaattttt tatatttagc tagtcattat gaaaagttga agggtagtcc agaagataac 3780

gaacaaaaac aattgtttgt tgagcagcat aagcattatt tagatgagat tattgagcaa 3840

atcagtgaat tttctaagcg tgttatttta gcagatgcca atttagataa agttcttagt 3900

gcatataaca aacatagaga caaaccaata cgtgaacaag cagaaaatat tattcattta 3960

tttacgttga cgaatcttgg agctcccgct gcttttaaat attttgatac aacaattgat 4020

cgtaaacgat atacgtctac aaaagaagtt ttagatgcca ctcttatcca tcaatccatc 4080

actggtcttt atgaaacacg cattgatttg agtcagctag gaggtgacaa aaagaaaaag 4140

ttgaagctgt ctggtggttc ttctggtggt tctagcggca gcgagactcc cgggacctca 4200

gagtccgcca cacccgaaag ttctggtggt tcttctggtg gttctatggc ggaagcgggt 4260

atcaccggca cgtggtacaa ccagtctggt tctaccttca ccgttaccgc gggtgcggac 4320

ggtaacctga ccggtcagta cgaaaaccgt gcgcagggca ctggttgcca gaactctccg 4380

tacaccctga ccggtcgtta caacggtacc aaactggaat ggcgtgttga atggaacaac 4440

tctaccgaaa actgccactc tcgtaccgaa tggcgtggtc agtaccaggg tggtgcggaa 4500

gcgcgtatca acacccagtg gaacctgacc tacgaaggtg gttctggtcc ggcgaccgaa 4560

cagggtcagg acaccttcac caaagttaaa ccgtctgcgg cgtctggatc ccatcaccac 4620

caccatcac 4629

<210>3

<211>100

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>sgRNA

<400>3

gugagaguua ucugaccgua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggtgcuuuu 100

<210>4

<211>5116

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> donor DNA

<400>4

ggattgagca ggtgtacgag gacgagccca atttctctat attcccacag tcttgagttt 60

gtgtcacaaa ataattatag tggggtggag atgggaaatg agtccaggca acacctaagc 120

ctgattttat gcattgagac tgcgtgttat tactaaagat ctttgtgtcg caatttcctg 180

atgaagggag ataggttaaa aagcacggat ctactgagtt ttacagtcat cccatttgta 240

gacttttgct acaccaccaa agtatagcat ctgagattaa atattaatct ccaaacctta 300

ggccccctca cttgcatcct tactgacctg cacgtctagg gcgcagtagt ccagggtttc 360

cttgatgatg tcatacttat cctgtccctt ttttttccac agctcgcggt tgaggacaaa 420

ctcttcgcgg tctttccagt aagaattcct cgatcgaggg acctaagatc cgccaccatg 480

gcccagtcca agcacggcct gaccaaggag atgaccatga agtaccgcat ggagggctgc 540

gtggacggcc acaagttcgt gatcaccggc gagggcatcg gctacccctt caagggcaag 600

caggccatca acctgtgcgt ggtggagggc ggccccttgc ccttcgccga ggacatcttg 660

tccgccgcct tcatgtacgg caaccgcgtg ttcaccgagt acccccagga catcgtcgac 720

tacttcaaga actcctgccc cgccggctac acctgggacc gctccttcct gttcgaggac 780

ggcgccgtgt gcatctgcaa cgccgacatc accgtgagcg tggaggagaa ctgcatgtac 840

cacgagtcca agttctacgg cgtgaacttc cccgccgacg gccccgtgat gaagaagatg 900

accgacaact gggagccctc ctgcgagaag atcatccccg tgcccaagca gggcatcttg 960

aagggcgacg tgagcatgta cctgctgctg aaggacggtg gccgcttgcg ctgccagttc 1020

gacaccgtgt acaaggccaa gtccgtgccc cgcaagatgc ccgactggca cttcatccag 1080

cacaagctga cccgcgagga ccgcagcgac gccaagaacc agaagtggca cctgaccgag 1140

cacgccatcg cctccggctc cgccttgccc tgagtcagag ctcgctgatc agcctcgact 1200

gtgccttcta gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg 1260

gaaggtgcca ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg 1320

agtaggtgtc attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg 1380

gaagacaata gcaggcatgc tggggatgcg gtgggctcta tggcttctga ggcggaaaga 1440

acggtcagat aactctcact catactttaa gcccattttg tttgttgtac ttgctcatcc 1500

agtcccagtc ccattggctt tctcctcacc tgttttaggt agccagcaag tcatgaaatc 1560

agataagttc caccaccaat taacactacc catcttgagc ataggcccaa cagtgcattt 1620

attcctcatt tactgatgtt cgtgaatatt taccttgatt ttcatttttt tctttttctt 1680

aagctgggat tttactcctg accctattca cagtcagatg atcttgacta ccactgcgat 1740

tggacctgag gttcagcaat actccccttt atgtcttttg aatacttttc aataaatctg 1800

tttgtatttt cattagttag taactgagct cagttgccgt aatgctaata gcttccaaac 1860

tagtgtctct gtctccagta tctgataaat cttaggtgtt gctgggacag ttgtcctaaa 1920

attaagataa agcatgaaaa taactgacac aactccatta ctggctccta actacttaaa 1980

caatgcattc tatcatcaca aatgtgaaaa aggagttccc tcagtggact aaccttatct 2040

tttctcaaca cctttttctt tgcacaattt tccacacatg cctacaaaaa gtacttctct 2100

gctcaagtca cactgagttg attgctattt accgaaatca aagtaacatt atcagatctc 2160

tgtagggtgg ttccctctgg aatgctaccc tccatagtcc ttacccttca agtaaagagc 2220

atgaagactg aaatatctct gtgatctgtc atcctttaag ccagaatccc ccataaaaaa 2280

gttagtattg ctttctcctg atcccatagc aggttgaatc atagcactta tcaggttgtt 2340

gtcattgctt gcttaaattc tcctaactat ttggagcttc ttgagggcac aggttcttgt 2400

tgagtcttgt acctaagcac ctagtatagt ccttgatgtc tagccaaccc taaataaaat 2460

gcagtgagtg acatgtagat gtctttataa ggtttgatag gttggtctct caaacagttc 2520

ttttgtatgtttggtagtgc tctagattag cactggccag tataactctg atgatggaaa 2580

tgttctatag ctatgctgtc taatatggta gtcactacta acatatgtta ctgttgagcc 2640

ttggaaatat ggcttttgtg acaaaactga atttttcatg ctatgtaatt taagtctaaa 2700

ttgctactgt gtacattgtg gctgtagcca caaatttgtg ctgtggattg cagaataatt 2760

aatatggaca ttgataattt tcttttcata ctaagcagta aggaaagaaa agttgaaact 2820

ctgtggtcca tttaggttat atgtgtattt gtacttgatt ggtttgtttg aatacctatt 2880

tctatacttt agctgagagc taaagccaac aaaccagtac tgtagataac ctgctttgga 2940

caacaatgtg ttgactagtt ggatttcatc aaagaatgcc taataaattt taagaaaatg 3000

agatttcatt aaaccataat actgacataa gtttagggaa gaatcagact atatctggtg 3060

tttgtgaaac tacccctgaa tttcagtcct acaaagtttt cagttttgga aaaactttca 3120

tcagagaggg cactaagtta caggaagcca tcacaaagta agttttcatc tgatgaatta 3180

taaatttaag atatatttta ataccaaaat tctttatggt ttatgtgcta acttaaaatt 3240

tctccttaaa atatgagaac taagtacaca attgtacttg gctgtttaat gcggattccc 3300

agtccctcac acagagattc tcaattaaga ttggagagca ggggttacta gaattctttt 3360

tcaggttcct tatatgcttc tgatttggtg gcctagaaat cacaatgcta gtgcagccct 3420

catggggcta cagtatacgt atctgaaaca tgattacatc agggaaactg tatgtctaat 3480

ctactttgtc cctaaaggaa gcattttgaa aggcagaaag taatatgtga tagtttttga 3540

aacttgtagg tcacattgtt tttaaaaggg atccaagtaa gttttttttt cttttgaggg 3600

ctacacctgt ggcacatgga ggttcccagg ctaggggtta aatcagaact gcagctgcca 3660

gcctatgcca gagccacagc aatgccagat ctgagctgtg tctgcaactg tgtagctcac 3720

agcaacgctg gatccttaac ccaatgagca aggccagaga ttgaacctac aacctcgtgg 3780

ttcctagtta gatttgtttc cgctgtgcca cgatgggaac tccaagtaat ttttttttga 3840

gcaaggaagt tacctttttt gtctgttttc ccactaaatg cattcctcaa ggattcccag 3900

tttgttcttg attcctcagt gccttaacac agacctgggt tctcagtaaa tgttgatttt 3960

attgatttat atgtgaaatt gtttttcaaa taatagtttt taagtccata gaaacaatgc 4020

ttcttttatg gagatacttt aggatcatac ttgtaaccca agttgcctaa tactctgttc 4080

ataaagaaaa ctcatgcctc atggtctctg aataatacat ctgtctacca ttgagctctt 4140

ccttgggttt cctgtgcaaa ccattgcact tatcctcttc ctgtgctata cttcctcagg 4200

ctttattaca gtttttaaaa taaaccaact atctatctct ctttgaagta gagccataat 4260

aattgcatca gaacactgaa ggtttttagg ctttaatttt tttttttttt aagatattca 4320

aaatttggag ttcttgttgt ggcgcagtgg ttaacgaacc caactaggaa ccatgacgct 4380

gcaggttcgg tccctggcct cgctcagtgg gttaaggatc cagcgttgcc atgagctgtg 4440

gtataggtcc atatgtggct cggatcctgc attgctgtgg ctgtggcagc agccacaggt 4500

acgattagac ccctagcctg ggaccctcca tatgctgtgg gcgcggtcct agaaaagaaa 4560

aaaaaaaaag aaaagaaaag aaagatatac aaaatttgaa ctacgcattg tttctcttaa 4620

cagttgttat gtatggagga ggtttgttat aattacagtt tacaactctt aatccagaat 4680

atgttaggga tccacattcc cagggtaaga ctagtttgtt ttaggccaga cttaattgta 4740

cagcccattg tccagccaca tactcaggag tctcatactt tgcaggctaa aaattcttga 4800

ttttgttacc tagtagtgta ctgttcatgt tggggaactt ttttctccag aaaagtttat 4860

tatccattat cctgcctcct ttttattttc atttatttat ttatttattt ttgctttttt 4920

agggccacac ttgtggcata tggaaattcc tgggctaggg gtcaaatcag ggcttcagct 4980

gctggcctat gccacaacaa cacgggatca gagctgcatc tgcaatctat accacagctt 5040

ttggcaaccc cgtatcctta acccaatgaa tactagttgg gttcttaacc cgctaagcca 5100

taattggaac tcccgg 5116

<210>5

<211>492

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> DNA sequence of Xten-mSA

<400>5

tctggtggtt cttctggtgg ttctagcggc agcgagactc ccgggacctc agagtccgcc 60

acacccgaaa gttctggtgg ttcttctggt ggttctatgg cggaagcggg tatcaccggc 120

acgtggtaca accagtctgg ttctaccttc accgttaccg cgggtgcgga cggtaacctg 180

accggtcagt acgaaaaccg tgcgcagggc actggttgcc agaactctcc gtacaccctg 240

accggtcgtt acaacggtac caaactggaa tggcgtgttg aatggaacaa ctctaccgaa 300

aactgccact ctcgtaccga atggcgtggt cagtaccagg gtggtgcgga agcgcgtatc 360

aacacccagt ggaacctgac ctacgaaggt ggttctggtc cggcgaccga acagggtcag 420

gacaccttca ccaaagttaa accgtctgcg gcgtctggat cccatcacca ccaccatcac 480

taatgactcg ag 492

<210>6

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cgctagagct cccgctgctt ttaaatattt tg 32

<210>7

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gcagcttcaa ctttttcttt ttgtcacctc ctagctgact caaatc 46

<210>8

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

tgacaaaaag aaaaagttga agctgcatca ccaccaccat cactaatg 48

<210>9

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gcagcctagg ttaattaagc tgcgctag 28

<210>10

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ttggagctcc cgctgctttt aaatattttg 30

<210>11

<211>49

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

aagaaccacc agacagcttc aactttttct ttttgtcacc tcctagctg 49

<210>12

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

aaagttgaag ctgtctggtg gttcttctgg tggttctagc ggcag 45

<210>13

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

agactcgagt cattagtgat ggtggtggtg atgggatcca g 41

<210>14

<211>20

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gugagaguua ucugaccgua 20

<210>15

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

gatgtgctgc aaggcgatta agttg 25

<210>16

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

aactacggtc agataactct cacctatagt gagtcgtatt acaattc 47

<210>17

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

aactacggtc agataactct cacctatagt gagtcgtatt acaattc 47

<210>18

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

aaaagcaccg actcggtgcc ac 22

<210>19

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

gatgggaaat gagtccaggc aacac 25

<210>20

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

cattacggca actgagctca gttac 25

<210>21

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

cttgggtttc ctgtgcaaac cattg 25

<210>22

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

cgagccacat atggacctat accac 25

<210>23

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

ggattgagca ggtgtacgag gac 23

<210>24

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

gagttccaat tatggcttag cgggttaag 29

<210>25

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

ggattgagca ggtgtacgag gac 23

<210>26

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

gagttccaat tatggcttag cgggttaag 29

<210>27

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

gatctcgtca tcgcctccat gtcag 25

<210>28

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

gaccgcgaag agtttgtcct caac 24

<210>29

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

gattgggaag acaatagcag gcatg 25

<210>30

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

ccagtttctc acccacttca tcaag 25

Claims

1. A highly efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method, comprising the steps of:

(2) uniformly mixing the fusion protein of the Cas9 protein and monovalent streptavidin, sgRNA and donor DNA marked by biotin, and standing to obtain a CRISPR RNP-donor DNA complex;

2. The efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of claim 1, wherein:

the gene is inserted or replaced by the replacement of herbicide sensitive gene ALS1 in rice; replacement of bacterial blight and/or rice blast susceptible genes; insertion of environmentally friendly genes at Rosa26 and/or H11 safe sites in the pig genome;

the bacterial blight and/or rice blast disease genes comprise OsSWEET14, OsSWEET13, OsSweet11 and pi21 genes;

the environment-friendly genes at the Rosa26 and/or H11 safety sites in the pig genome comprise cellulase genes bg17, eg131, xylanase genes xynB and phytase genes appA.

3. The efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of claim 1, wherein:

the nucleotide sequence of the donor DNA in the step (1) is shown as SEQ ID NO. 4;

the amino acid sequence of the fusion protein of the Cas9 protein and the monovalent streptavidin in the step (2) is shown as SEQ ID NO. 1;

the nucleotide sequence of the sgRNA described in the step (2) is shown in SEQ ID No. 3.

4. The efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of claim 3, wherein:

the nucleotide sequence of the fusion protein for encoding the Cas9 protein and the monovalent streptavidin is shown as SEQ ID NO. 2.

5. The efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of claim 3, wherein:

the fusion protein of the Cas9 protein and the monovalent streptavidin, which is described in the step (2), is prepared by the following method:

(A) using pET-NLS-Cas9-6xHis plasmid as a template and SEQ ID NO.6 and SEQ ID NO.7 as primers to carry out amplification to obtain a fragment I; simultaneously, taking the sequences SEQ ID NO.8 and SEQ ID NO.9 as primers to carry out amplification to obtain a fragment II; adopting an Overlap Extension PCR method, taking a mixture of the fragments I and II in equal molar ratio as a template, and amplifying by using primers SEQID NO.6 and SEQ ID NO.9 to obtain a fusion fragment of the fragments I and II; after the fused fragment is cut by SacI and AvrII enzyme, inserting the fused fragment into pET-NLS-Cas9-6xHis plasmid cut by the same enzyme to obtain pET-NLS-Cas9-NLS-6xHis plasmid;

(B) pET-NLS-Cas9-NLS-6xHis plasmid is taken as a template, and sequences SEQ ID NO.10 and SEQ ID NO.11 are taken as primers for amplification to obtain a fragment III; taking the Xten-mSA gene as a template and taking sequences SEQ ID NO.12 and SEQ ID NO.13 as primers for amplification to obtain a fragment IV; adopting an Overlap Extension PCR method, taking a mixture of fragments III and IV in an equimolar ratio as a template, and amplifying by using primers SEQ ID NO.10 and SEQ ID NO.13 to obtain a fusion fragment of the fragments III and IV; after the fused fragment is digested by SacI and XhoI, inserting the digested fused fragment into pET-NLS-Cas9-NLS-6xHis plasmid to obtain expression plasmid pET-Cas 9-Xten-mSA; wherein, the nucleotide sequence of the Xten-mSA gene is shown as SEQID NO. 5;

(C) transforming an expression plasmid pET-Cas9-Xten-mSA into escherichia coli, culturing, adding IPTG (isopropyl-beta-D-thiogalactoside) for induction expression, collecting bacteria, carrying out ultrasonic lysis, and purifying to obtain Cas9-Xten-mSA protein, namely fusion protein of Cas9 protein and monovalent streptavidin;

the sgRNA in the step (2) is synthesized by the following method:

(III) adopting an Overlap Extension PCR method, taking a mixture with the sequence I and the sequence II in equal molar ratio as a template, and utilizing primers SEQ ID NO.15 and SEQ ID NO.18 to amplify to obtain a fusion fragment of the sequence I and the sequence II; and then taking the fusion fragment of the sequence I and the sequence II as a template for in vitro sgRNA transcription, and carrying out in vitro transcription to obtain the sgRNA.

6. The efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of claim 1, wherein:

the biotin labeling in the step (1) is realized by the following steps: performing PCR amplification by using a biotin-labeled primer SEQ ID NO.23 and a biotin-labeled primer SEQ ID NO.24 by using donor DNA as a template to obtain biotin-labeled donor DNA;

the transformation of the cell nucleus in the step (3) is realized by the following method: adding the nuclear transformation liquid of P3 Primary Cell 4D-Nucleofector X kit into cells, and uniformly mixing to obtain a mixed liquid; then CRISPRRNP-donor DNA complex is added, and then a nuclear transfection instrument is used for carrying out nuclear transformation;

7. The efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of claim 1, wherein:

the molar ratio of the Cas9 protein to the fusion protein of monovalent streptavidin to the donor DNA labeled by biotin in the step (2) is 8-32: 1;

the molar ratio of the fusion protein of the Cas9 protein and the monovalent streptavidin to the sgRNA in the step (2) is 1: 1-1.2;

the standing condition in the step (2): standing at room temperature for 15-25 min;

the cells in the step (3) are embryonic fibroblasts.

8. The efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of claim 7, wherein:

the molar ratio of the fusion protein of the Cas9 protein, the monovalent streptavidin and the biotin-labeled donor DNA in the step (2) is 20-24: 1;

the molar ratio of the fusion protein of the Cas9 protein, the monovalent streptavidin and the sgRNA in the step (2) is 1: 1;

the cells in the step (3) are porcine embryonic fibroblasts.

9. Use of the efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of any one of claims 1-8 in gene editing, wherein:

the environment of the application is in vitro environment;

the gene editing comprises gene insertion or gene replacement.

10. Use of the efficient CRISPR RNP and donor DNA co-location mediated gene insertion or replacement method of any one of claims 1-8 in crop breeding.