CN113943749A - Method for improving homologous recombination efficiency based on CRISPR gene editing system - Google Patents

Abstract

The invention provides a method for improving homologous recombination efficiency based on a CRISPR gene editing system, which comprises the steps of introducing a Cas9 plasmid fused with streptavidin and a corresponding homologous donor with biotin modification into a host cell, and further introducing an NHEJ fluorescent reporter plasmid into the host cell. According to the invention, a Cas9 plasmid fused with streptavidin, a corresponding biotin-modified homologous donor and an NHEJ fluorescent report plasmid are introduced into a CRISPR/Cas9 system for the first time to improve homologous recombination efficiency, the NHEJ-based fluorescent report plasmid can indicate all elements subjected to homologous recombination, and a primary flow analysis result shows that the homologous recombination efficiency in an enriched cell can be improved to 50-80%.

Description

Method for improving homologous recombination efficiency based on CRISPR gene editing system

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a method for improving homologous recombination efficiency based on a CRISPR gene editing system.

Background

The CRISPR/Cas system, one of the most widely used gene editing techniques at present, can generate double-strand breaks at specific sites in the genome through the guidance of single-stranded guide RNA (sgRNA), and then achieve genome editing by means of two main modifications of Non-homologous end joining (NHEJ) and homologous recombination (HDR) of host cells. Although NHEJ occurs with high efficiency, it often results in random base insertions and deletions at the break site, and does not allow precise editing. In contrast, HDR can enable precise editing of almost all forms including gene insertions, base substitutions, etc., with artificial provision of donor templates. Therefore, HDR has great application prospect in practical application, but the occurrence probability of HDR is far lower than that of NHEJ, and the development of HDR is greatly limited.

There are various methods for improving the efficiency of homologous recombination, and they can be classified into two groups in general. One is to regulate the cell cycle to a period where HDR occurs efficiently by drugs, inhibit the NHEJ repair pattern of cells by small molecule inhibitors or directly use small molecule drugs that promote the activity of HDR repair-related proteins. However, this method has the problem that drugs are required to regulate the growth state of cells, and both NHEJ and HDR are known as two important repair methods for protecting cells from damage, which are used by cells to maintain their own genome, and this method of inhibiting the other repair method by improving the repair method we want may reduce the ability of cells to resist damage, causing safety risks to various degrees. The other is to improve homologous recombination by changing the form of a donor, wherein a double-stranded donor has the advantages of high efficiency, convenient acquisition and the like, but naked 3' -OH of the donor can be a target for recognition and attack of host cell nuclease, so that the homologous recombination rate is not high.

Disclosure of Invention

In view of the above, the present invention provides a method for improving homologous recombination efficiency based on a CRISPR gene editing system, and provides a Cas9 plasmid fused with streptavidin, a corresponding biotin-modified homologous donor, and an NHEJ fluorescent reporter plasmid for improving homologous recombination efficiency for the first time.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides a method for improving homologous recombination efficiency based on a CRISPR gene editing system, which comprises the step of introducing a Cas9 plasmid fused with streptavidin and a corresponding homologous donor with biotin modification into a host cell.

In the present invention, the introduction of a NHEJ fluorescent reporter plasmid into a host cell is also encompassed.

In the present invention, as an embodiment, the Cas9 plasmid introduced with streptavidin fusion is pX330-SA-hspCas9-sgRNA or pX330-hspCas9-SA-sgRNA, and the corresponding homologous donor with biotin modification is Bio-EGFP-donor. In the invention, sgRNA in pX 330-SA-hspCs 9-sgRNA is human GAPDH site sgRNA or pig Rosa26 site sgRNA, sgRNA in pX 330-hspCs 9-SA-sgRNA is human GAPDH site sgRNA or pig Rosa26 site sgRNA, and Bio-EGFP-donor is a homologous donor of GAPDH site or pig Rosa26 site homologous donor. In the invention, pX330-SA-hspCas9-sgRNA or pX330-hspCas9-SA-sgRNA is obtained by fusing Streptavidin (SA) to the N-terminal or C-terminal of pX330-hspCas9 by a one-step cloning method with pX330-hspCas9 as a base plasmid, and then connecting the corresponding sgRNA to the pX330-SA-hspCas9 or pX330-hspCas9-SA framework in an annealing connection manner. The Bio-EGFP-donor is obtained by loading three fragments of 5 'HA, 3' HA and EGFP of homologous arms onto a pET28A vector by using an SE seamless cloning ligation kit and performing PCR amplification by using a primer with biotin modification. The 5 'HA and the 3' HA of the homologous arms are derived from genomes of porcine PK-15 cells (Rosa26 gene) or human HEK293T cells (GAPDH gene), the upstream and downstream sequences of the Rosa26 gene or the GAPDH gene are cut, and the upstream sequence is 5 'HA and the downstream sequence is 3' HA. The EGFP gene is obtained by amplification from pEGFP-C1 plasmid.

As another embodiment, the present invention also incorporates a NHEJ fluorescent reporter plasmid. In the invention, the Cas9 plasmid introduced with the fusion streptavidin is pX330-SA-hspCas9 or pX330-hspCas9-SA, the corresponding homologous donor with biotin modification is Bio-sgRNA-EGFP-donor, and the NHEJ fluorescent reporter plasmid is pCMV-SA-mCherry-NHEJ. The nucleotide sequence of pX330-SA-hspCas9 is shown in SEQ ID NO:1, the sgRNA of the human GAPDH site in the Bio-sgRNA-EGFP-donor is respectively fused to the 5 'end, the 3' end and the two ends of the Bio-EGFP-donor, the nucleotide sequence of the sgRNA of the human GAPDH site in the Bio-sgRNA-EGFP-donor fused to the two ends of the Bio-EGFP-donor is shown in SEQ ID NO:2, and the nucleotide sequence of the pCMV-SA-mCherry-NHEJ is shown in SEQ ID NO: 3. In the invention, the pX330-SA-hspCas9 or pX330-hspCas9-SA is obtained by fusing Streptavidin (SA) to the N terminal or C terminal of pX330-hspCas9 by a one-step cloning method using pX330-hspCas9 as a basic plasmid. According to the invention, the Bio-sgRNA-EGFP-donor is obtained by fusing complete sgRNAs containing U6 promoter and terminator sequences to the 5 'end, the 3' end or both ends of the Bio-EGFP-donor respectively through a fusion PCR method and performing PCR amplification through a primer with biotin modification. The pCMV-SA-mCherry-NHEJ is obtained by replacing EGFP in the pCMV-EGFP-mCherry with streptavidin monomer SA, carrying out double enzyme digestion through EcoRI and Xho I, and integrating a sgRNA target sequence containing a PAM sequence between the pCMV-SA-mChery in an annealing connection mode. The sgRNA target sequence containing the PAM sequence is T2-gRNA: ggggccactagggacaggattgg, g-Talen 1: gtcccctccaccccacagtgggg, crRNA: tttatctgtcccctccaccccacagtg are provided.

The steps and reaction systems involved in PCR amplification, plasmid digestion, annealing and ligation, and seamless cloning are all well known to those skilled in the art.

In the present invention, the host cell is preferably a porcine PK-15 cell, a human K562 cell, a human HEK293T cell.

The invention also provides a genome editing system comprising introducing into a host cell a Cas9 plasmid fused to streptavidin and a corresponding homologous donor with a biotin modification, preferably further comprising introducing into the host cell a NHEJ fluorescent reporter plasmid. In the invention, when the Cas9 plasmid introduced with the fusion of streptavidin is pX330-SA-hspCas9-sgRNA or pX330-hspCas9-SA-sgRNA, the corresponding homologous donor with biotin modification is Bio-EGFP-donor; when the Cas9 plasmid introduced with the fusogenic streptavidin is pX330-SA-hspCas9 or pX330-hspCas9-SA and the corresponding donor with biotin modification is Bio-sgRNA-EGFP-donor, the NHEJ fluorescent reporter plasmid is pCMV-SA-mCherry-NHEJ.

In the present invention, the gene editing system further comprises a polynucleotide sequence of a coding sequence manipulation system. The polynucleotide sequence of the present invention is preferably a sequence that plays a coding role in a gene editing system. The sequence manipulation longitudinal system in the invention is preferably a CRISPR/Cas system.

The invention also provides a method for realizing genome editing, which comprises expressing the genome editing system in an organism.

The invention also provides application of the gene editing system in improving homologous recombination efficiency.

Compared with the prior art, the invention has the following beneficial effects:

according to the invention, a Cas9 plasmid fused with streptavidin, a corresponding biotin-modified homologous donor and an NHEJ fluorescent report plasmid are introduced into a CRISPR/Cas9 system for the first time to improve the homologous recombination efficiency, the NHEJ-based fluorescent report plasmid can indicate all elements subjected to homologous recombination, and the preliminary flow analysis result shows that the homologous recombination efficiency in the enriched cells can be further improved to 50-80%.

The invention provides a new choice for realizing efficient homologous recombination editing by a genome editing technology, marker genes do not need to be integrated into a genome in practical application, and positive cells which really generate homologous recombination can be easily obtained only by NHEJ report plasmids which play a role outside the genome, so that the invention has higher safety, simultaneously reduces the screening difficulty and generates a certain promotion effect for the application of gene editing.

Drawings

FIG. 1 schematic representation of pX330-SA-hspCas9 (left) and pX330-hspCas9-SA (right) vectors.

FIG. 2pX330-SA-hspCas9 and pX330-hspCas9-SA restriction identification (left) and sequencing peak (right).

Fig. 3sgRNA sequencing peak plot.

FIG. 4 schematic (top) and sequencing peak (bottom) of pRosa26-EGFP-donor and pGAPDH-EGFP-donor vectors.

FIG. 5 results of Hochest staining under different conditions.

FIG. 6 is a graph of proportional flow analysis of green fluorescence 3 days after electrotransfer.

FIG. 7 is a graph of proportional flow analysis of green fluorescence after 7 days of electrotransfer.

FIG. 8 ratio of green fluorescence for 3 days (left) and 7 days (right) of PK-15 cells electroporated.

FIG. 9 fluorescence status of single cell clones (GFP field, brightfield and Merge image from left to right).

FIG. 10PCR identifies the location of the primers and the length of the amplified product fragments.

FIG. 11PCR identification primer schematic and respective electrotransfer combined PCR identification results diagram (boxes indicate biallelic editing clones).

FIG. 12 partial clone sequence alignment results (5 'HA: 5' homology arm sequence, Splicing acceptor: Splicing receptor, plain Cas 9: plain Cas9 without fusion avidin, N/C-SA: Cas9 protein with avidin fused at the N-or C-terminus).

FIG. 13 Diallelic editing clone PCR identification (left) and sequencing peak (right).

FIG. 14 is a K562 flow chart.

FIG. 15K562 histogram of green fluorescence ratios.

FIG. 16 results of donor fusion PCR amplification.

FIG. 17pCMV-SA-mCherry-NHEJ reporter vector schematic (left) and sequencing peak plot (right).

FIG. 18 shows the functional verification of pCMV-SA-mCherry-NHEJ reporter vector cells.

FIG. 19 is a flow chart of two-color analysis of NHEJ and HDR of electrotransfer K562 cells.

Detailed Description

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1 Biotin-streptavidin Strong interaction to improve homologous recombination efficiency

1. Construction of Cas9 plasmid fused with streptavidin and construction of pX330-hspCas9-SA plasmid containing gRNA

(1) Construction of a Cas9 plasmid fused with streptavidin

The streptavidin was loaded into pX330-hspCas9 using pX330-hspCas9 (all called pX330-U6-Chimeric-BB-CBh-hSpCas9) plasmid as the base vector.

A Streptavidin (SA) sequence was obtained by reference to the literature (Synchronization of secreted proteins in proteins of cells; Gaelle Boncompain; nature methods), and synthesized by Cinzhi GmbH, in which a SV40 NLS nuclear localization sequence was added to the 3' end to obtain a synthesized streptavidin fragment. And carrying out PCR amplification on the synthesized streptavidin fragment, wherein an amplification primer is hspCs 9-SA-F/hspCs 9-SA-R, the nucleotide sequence is shown as SEQ ID NO:4/SEQ ID NO:5, and sequence information near the restriction enzyme cutting site of the pX 330-hspCs 9 framework is reserved during amplification.

The pX 330-hspCs 9 skeleton is separately digested with Age I and EcoRI, streptavidin is fused to the N-terminal or C-terminal of the pX 330-hspCs 9 protein by abm one-step cloning kit, thus obtaining pX 330-SA-hspCs 9 or pX 330-hspCs 9-SA, the vector schematic diagram is shown in FIG. 1.

The successfully constructed vectors are subjected to enzyme digestion detection of EcoRI, BamHI and HindIII and sequencing verification, and the enzyme digestion identification result and sequencing graph are shown in FIG. 2. As shown in FIG. 2, both ends of the SA sequence respectively contain a BamHI restriction site and a HindIII restriction site, after double restriction, a 513bp SA sequence and a 8506bp pX330-hspCas9 vector skeleton are successfully generated, and sequencing shows that a pX330-SA-hspCas9 or a pX330-hspCas9-SA plasmid is successfully constructed.

(2) Construction of sgRNA-containing streptavidin-fused Cas9 plasmid

sgRNAs (Rosa 26-sgRNAs or GAPDH-sgRNAs) were obtained by corresponding literature (GAPDH: Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair, Xiangjun He, nucleic acids Research; Rosa26: Optimization of CRISPR/Cas 9-mediated Knock-in Strategy at the same time with the help of the nucleic acid probe 26 cells in porous fibers, Zisag Xie, Scientific Reports.), and the corresponding ligated sgRNAs were obtained by adding 5 '-CACC-3' and 5 '-AAAC-3' to the sequences of the sgRNAs, respectively. Then, corresponding sgRNAs are connected to BbsI enzyme-cut pX330-hspCas9-SA framework by means of annealing connection, primers related to the annealing connection are Rosa26-sg-F/Rosa26-sg-R and GAPDH-sg2-F/GAPDH-sg2-R, nucleotide sequences are shown as SEQ ID NO:6/SEQ ID NO:7 and SEQ ID NO:8/SEQ ID NO:9, bacteria are selected after transformation and plating and are subjected to sequencing, and the sequencing result is shown as figure 3. The results in FIG. 3 show that the sgRNA sequence is correct, and that the pX330-hspCas9 vector containing streptavidin and sgRNA was successfully constructed, which allows further experiments.

2. Construction of corresponding homologous donor and acquisition of Biotin-modified double-stranded donor

(1) Construction of the corresponding homologous donors: construction of pX330-hspCas9-SA plasmids containing gRNA requires construction of the corresponding homologous donor

The Homology Arm (HA) was obtained from the genome of porcine PK-15 cells (Rosa26 gene) or human HEK293T cells (GAPDH gene), and its upstream and downstream sequences were cleaved with 5 'HA and 3' HA, respectively. The EGFP gene is amplified from pEGFP-C1 plasmid, and then the three fragments of 5 'HA, 3' HA and EGFP obtained from Rosa26 gene or GAPDH gene are loaded on pET28A vector by using SE seamless cloning ligation kit, and the vector schematic diagram and sequencing peak diagram are shown in FIG. 4. As shown in FIG. 4, different strategies are adopted for different insertion positions, and in a porcine PK-15 cell, the EGFP gene needs to be inserted into an intron at the Rosa26 site, so that in order to ensure the correct expression of the EGFP, splicing receptors (splicing acceptors) and SV40poly (A) sequences (addge websites) need to be introduced, the splicing receptors and the SV40poly (A) sequences are introduced, the related primers are Rosa26-donor-1R/Rosa26-donor-2F and Rosa26-donor-2R/3F, the nucleotide sequences are shown as SEQ ID NO:10/SEQ ID NO:11 and SEQ ID NO:12/SEQ ID NO:13, and the annealing temperature is 60 ℃. In human K562 cells, EGFP is inserted before the stop codon of GAPDH, so that only a self-splicing peptide P2A sequence (https:// www.ncbi.nlm.nih.gov/nuccore/MT559572.1.) is required to be introduced, and the related primer is GAPDH-donor-1R/2F, the nucleotide sequence is shown as SEQ ID NO:14/SEQ ID NO:15, and the annealing temperature is 60 ℃. The sequence is found to be completely correct through sequencing verification, and subsequent experiments can be carried out.

(2) Acquisition of Biotin-modified double-stranded Donor (bio-ds-EGFP-donor)

And (2) carrying out PCR amplification on the corresponding homologous donor obtained in the step (1) by using a biotin-modified primer, wherein the amplification primer is Bio-F/R, the nucleotide sequence is shown as SEQ ID NO:16/SEQ ID NO:17, the annealing temperature is 60 ℃, double-stranded donor fragments with biotin-modified two ends are obtained, and the amplified fragments are subjected to product purification, the concentration measurement and the placing at-20 ℃ for later use.

3. The corresponding sgRNA-containing streptavidin-fused Cas9 plasmid and biotin-modified double-stranded donor were transferred into porcine PK-15 cell line by electrotransfection

Considering that the excessive plasmid dose in electrotransfection can cause massive cell death, the pX330-hspCas9-SA plasmid containing gRNA is selected as the object of study, the amount of the plasmid is 5 mug, the cell activity identification is carried out under the conditions that the ratio of the plasmid to the biotin-modified double-stranded donor is 1:1, 1:2 and 1:3 respectively, the cells 48h after electrotransformation are stained by Hochests and observed by a fluorescence microscope, and the observation result is shown in FIG. 5. As shown in fig. 5, the cell activities did not differ much from the control in the amount of 1:2 plasmid, but the number of surviving cells was significantly reduced in the ratio of 1:3, and the 1:3 combination did not improve the efficiency of homologous recombination more than 1:2 in view of the above-mentioned 3 rd step, so 5 μ g of the sgRNA-containing streptavidin-fused Cas9 plasmid was finally selected and the subsequent experiments were performed in the molar ratio of 1:2 to the biotin-modified double-stranded donor fragment.

4. Detection of homologous recombination efficiency

By comparing with the sgRNA-containing Cas9 protein without fusion of streptavidin, it was determined whether streptavidin could improve the efficiency of homologous recombination, the experimental combination table 1, and the flow analysis results are shown in fig. 6. From the results in FIG. 6, it was found that the Cas9 protein fused with streptavidin could improve the efficiency of homologous recombination after the third day of electroporation, but 4.3% of background fluorescence was present in the control group electroporated with bio-ds-EGFP-donor only, and we continued culturing the cells after electroporation to the 7 th day and analyzed the flow-type results at this time, as shown in FIG. 7, when the control group had been reduced to less than 1%. The results were then collated and plotted in a corresponding histogram as shown in table 2 and figure 8. As shown in the results of table 2 and fig. 8, the results after 3 days and 7 days are significantly different, and since the control group after seven days hardly has interference of background fluorescence, analysis is performed based on the result after 7 days, and it is found that by introducing streptavidin, the efficiency can be further improved regardless of whether streptavidin is fused at the C-terminal or the N-terminal of Cas9, and compared with the common Cas9, the efficiency of homologous recombination is approximately doubled, which indicates that the improvement of the efficiency of homologous recombination in the porcine PK-15 cell line can be indeed achieved by the strong interaction between streptavidin and biotin.

TABLE 1 electroporation PK-15/K562 plasmid combination dose (Biotin-streptavidin)

TABLE 2 PK-15 electroporation replicate results

5. Flow sorting single cell clone identification

And then verifying whether the green cells are correctly inserted positive clones or not and detecting the efficiency of biallelic gene editing, so that the green fluorescent positive cells after 7 days of electrotransformation are subjected to single cell sorting, the single cell sorting can ensure the purity of the clones, and whether the biallelic gene editing occurs in the clones or not can be accurately identified. Because of the low transfection efficiency after seven days of the pX 330-hspCs 9 group without streptavidin, and the difficulty in growth of single clone cells, only 20 clones were obtained, whereas nearly 40 clones were obtained for both combinations containing streptavidin, the number of clones obtained for each group being shown in Table 3, because the efficiency was approximately doubled.

TABLE 3 flow-type Single-cell Single-clone Numbers statistics

After the colony grows to a proper size, the fluorescence expression of the colony is observed as shown in FIG. 9, and the result shows that almost all the colonies contain green fluorescence by the observation of a fluorescence microscope.

A small number of cloned cells were subsequently lysed by NP-40 and directly subjected to PCR detection at 58 ℃ to design two identifying primers sharing the same upstream primer designed at the upstream genomic position spanning 5 'HA and downstream primers designed on EGFP and 3' HA, respectively, such that the first pair of primers (Jianding F1/R1, nucleotide sequence shown in SEQ ID NO:18/SEQ ID NO: 19) could detect whether correct targeting of green fluorescent cells had occurred, while the second pair of primers (Jianding F1/R2, nucleotide sequence shown in SEQ ID NO:18/SEQ ID NO: 20) could be used to identify whether biallelic editing had occurred, the specific positions of the primers and the PCR detection results are shown in FIGS. 10 and 11.

Because the cloned cell genome is obtained by directly cracking NP-40, the PCR amplification quality is not high, and the primer for verifying the knock-in of the single allele and the double allele has longer amplification fragment, although most of clones are edited by the single allele, two bands are obtained, but only a few of the final 1900 bp bands are amplified. Furthermore, the results of F1/R1 show that some clones have one extra band at one thousand of bp, such as #06 clone in pX330-hspCas9+ bio-ds-donor, obviously, two bands are amplified, and the sequencing of one thousand of bp shows that the direct connection of donor fragments generates multiple copies, and the sequencing of other clones randomly shows that the sequencing comparison results are shown in FIG. 12.

In order to compare the identification results of each group conveniently and intuitively, the number of biallelic gene editing clones, the number of monalleic gene editing clones and the number of negative clones were counted, as shown in table 4.

TABLE 4 PCR identification of clone number statistics

As can be seen from table 4, a total of 18 positive clones were obtained using only the combination of biotin-modified donors, but no generation of biallelic editing clones was detected. After streptavidin was introduced, 3 biallelic editing clones were detected in 38 and 36 clones at the N-and C-termini (the efficiency was 7.9% and 8.3%, respectively), and by performing PCR amplification and sequencing verification on two of the clones (# N-01 and # C-06) alone, as shown in fig. 13, the sequencing result showed only a single peak, further indicating that biallelic editing did occur.

6. Verification of homologous recombination efficiency of electrotransferred K562 cells

To further verify whether the biotin-streptavidin system is suitable for different species, another stable K562 cell line of the laboratory electrotransformation system was selected for verification, and flow analysis was performed when the fluorescence of the control group transfected with Bio-ds-donor alone was less than 1%, with the results shown in fig. 14. The flow-through results show a further improvement in HDR efficiency of about 1 fold with the addition of avidin, similar to the PK-15 results, which were subsequently repeated three times, and the results of the repetitions were collated and subjected to the T-test, as shown in table 5 and fig. 15.

TABLE 5K562 electrotransfer triplicate results

Example 2 Biotin-streptavidin Strong interaction and NHEJ repaired Red and Green vector Indirect screening homologous recombination Combined use to establish high efficiency homologous recombination method

1. Construction of a Cas9 plasmid fused with streptavidin

The construction procedure was the same as in section 1, step (1) of example 1.

2. Construction of the corresponding Biotin-modified homologous Donor (Bio-sgRNA-EGFP-donor)

(1) Construction of the original homologous donor template (Bio-EGFP-donor):

the construction procedure was the same as in section 2 (1) of example 1.

(2) Construction of the complete sgRNA plasmid containing the U6 promoter and terminator sequences (pX330-gapdh sgRNA-hspCas 9): based on pX330-hspCas9 plasmid, connecting Rosa26-gRNA or GAPDH-sgRNA to Bbs I enzyme cut pX330-hspCas9 by annealing connection to obtain pX330-Rosa26sgRNA-hspCas9 or pX330-GAPDHSgRNA-hspCas9, annealing connection primer is Rosa26-sg-F/Rosa26-sg-R or GAPDH-sg2-F/GAPDH-sg2-R, as shown in SEQ ID NO:6/SEQ ID NO:7 and SEQ ID NO:8/SEQ ID NO:9, and then the bacteria are sent for sequencing after transformation and plate coating.

(3) Construction of Bio-sgRNA-EGFP-donor: respectively fusing pX 330-GAPDHsgRNA-hspCs 9 to the 5 'end, the 3' end and the two ends of Bio-EGFP-donor by a fusion PCR method to obtain fusion plasmids, and the result is shown in FIG. 16; then, the fusion plasmid is used as a template, PCR amplification is carried out through a primer modified by biotin, and finally Bio-sgRNA-EGFP-donor is recovered in agarose gel.

The fusion PCR method comprises the following primers: taking pX330-GAPDHsgRNA-hspCas9 as a template, and primers are gRNA-GAPDH-donor-1F/gRNA-GAPDH-donor-1R and gRNA-GAPDH-donor-3F/gRNA-GAPDH-donor-3R, as shown in SEQ ID NO:21/SEQ ID NO:22 and SEQ ID NO:23/SEQ ID NO: 24; the original homologous donor is used as a template, and the primer is gRNA-GAPDH-donor-2F/gRNA-GAPDH-donor-2R, and is shown as SEQ ID NO. 25/SEQ ID NO. 26. The gRNA-GAPDH-donor-1F/gRNA-GAPDH-donor-1R and the gRNA-GAPDH-donor-3F/gRNA-GAPDH-donor-3R respectively correspond to pX330-GAPDHsgRNA-hspCas amplified at the 5 'and 3' positions of the original homologous donor template, and the annealing temperature is 60 ℃.

3. Construction of NHEJ fluorescent reporter plasmid (pCMV-SA-mCherry-NHEJ plasmid) EGFP in pCMV-EGFP-mCherry is replaced by streptavidin monomer SA, two enzyme cutting sites of xhoi and ecori are still reserved between the two sites, and the two sites are cut by ecori and xhoi, then sgRNA target sequence containing PAM sequence (sgRNA target sequence of GAPDH site of human is AGCCCCAGCAAGAGCACAAGAGG) is integrated between pCMV-SA-mCherry by annealing connection, mCherry is not expressed at first, and only after sgRNA cuts target sequence, code shift mutation occurs, mCherry reads correctly, and then emits red light, and the vector schematic diagram and sequencing peak diagram are shown in fig. 17. As can be seen from fig. 17, when the modified NHEJ fluorescent reporter plasmid is introduced into the sgRNA target site, the mCherry is terminated early, which conforms to the construction principle of the NHEJ fluorescent reporter plasmid.

Functional verification of pCMV-SA-mCherry-NHEJ: the constructed NHEJ fluorescent reporter plasmid and pX330-hspCas9-SA plasmid are transfected into 293T cells together, and corresponding sgRNA vector is added into the experimental group to verify whether the function is consistent with the expectation, and the result is shown in figure 18 by observing through a fluorescent microscope after transfection for 48 h. Fig. 18 shows that the pCMV-SA-mCherry-NHEJ fluorescent reporter plasmid does not fluoresce when sgRNA is not introduced, and only when sgRNA exists, namely after cleavage, red fluorescence can occur after NHEJ repair of host cells, indicating that vector construction is successful and indicating Cas9 and sgRNA.

4. Enrichment efficiency of homologous recombination for detecting K562 cells by electrotransformation

The 3 plasmids prepared above were electroporated into K562 cells, Cas9 selected pX330-SA-hspCas9 with streptavidin fused to the C-terminus, the electrotransport amount selected using 5 μ g, the ratio of biotin-modified homologous donor selected 1:2, pX330-hspCas9-SA plasmid, Bio-sgRNA-EGFP-donor plasmid, pCMV-SA-mCherry-NHEJ fluorescence reporter plasmid ═ 1:2 (1-3), respectively, and compared together with sgrnas coupled at different positions, a combination of pX330-hspCas9-SA, Bio-sgRNA-EGFP-donor plasmid ═ 1:2 was also used to adjust the compensation because the green fluorescence also needs to be adjusted, and the final flow analysis results are shown in fig. 18.

The ratio in fig. 19 is calculated by the following formula: NHEJ screening ratio Q1+ Q2; the ratio of HDR cells is Q4+ Q2; NHEJ screening enriched cells had a HDR proportion of Q2/(Q1+ Q2). The results of the finishing are shown in Table 6.

TABLE 6 statistics of NHEJ and HDR occurrence in K562 cells after electroporation

The results in table 6 show that with increasing NHEJ reporter plasmid, HDR proportion of NHEJ screening ratio gradually decreased and NHEJ efficiency gradually increased, and when the ratio was increased to 1:2:3, HDR efficiency began to decrease, indicating a competitive relationship between these two repair approaches. The comparison shows that the effect is better when the ratio is 1:2:2, and the NHEJ screening ratio is close to the HDR ratio, and the HDR ratio can also reach 30%. This indicates that when we sort with the fluorescence emitted by the NHEJ fluorescent reporter plasmid, approximately one third of the cells were cells that had undergone homologous recombination. Further illustrating that the method can indirectly enrich for cells undergoing homologous recombination. In addition, the efficiency of HDR enrichment can be further doubled by coupling the sgrnas to a double-stranded donor, and the results show that the combined enrichment effect with both ends coupled with the sgrnas is the best.

The above tests are combined to show that:

1. the biotin-streptavidin was introduced into the CRISPR/Cas9 system, and the results showed that the efficiency of homologous recombination was increased to 10% in human K562 cells and porcine PK-15 cells, and possibly to some extent the efficiency of biallelic editing was increased.

2. On the basis of the experiment, the sgRNA is coupled with a homologous donor template, so that a fluorescence report plasmid based on NHEJ can indicate all elements subjected to homologous recombination, and the preliminary flow analysis result shows that the homologous recombination efficiency in the enriched cells can be further improved to 50-80%.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of Henan

<120> method for improving homologous recombination efficiency based on CRISPR gene editing system

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8923

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 900

gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 960

ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcgggagtc gctgcgacgc 1020

tgccttcgcc ccgtgccccg ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg 1080

accgcgttac tcccacaggt gagcgggcgg gacggccctt ctcctccggg ctgtaattag 1140

ctgagcaaga ggtaagggtt taagggatgg ttggttggtg gggtattaat gtttaattac 1200

ctggagcacc tgcctgaaat cacttttttt caggttggac cggtgccacc atgggatccg 1260

accctagcaa agactcaaaa gctcaggtgt ccgctgccga ggctggcatt actggaacat 1320

ggtacaatca gctcgggagc acctttattg tgactgctgg agccgatgga gccctcaccg 1380

gaacatacga atctgctgtg ggaaacgccg aatcacggta cgtcctcact ggccgatacg 1440

atagtgcccc tgccaccgac ggatctggga ctgccctggg atggactgtc gcttggaaaa 1500

acaactaccg gaatgctcat tctgccacaa catggagtgg acagtacgtg ggaggcgctg 1560

aggctagaat caatacacag tggctgctca catctggcac aaccgaggca aatgcttgga 1620

aatccaccct ggtgggacat gacacattca ccaaagtgaa accctccgcc gcttcaatcg 1680

atgccgccaa aaaagccgga gtcaacaacg gcaatcctct ggatgccgtc cagcagaagc 1740

ttcccaagaa gaagaggaaa gtcggtatcc acggagtccc agcagccgac aagaagtaca 1800

gcatcggcct ggacatcggc accaactctg tgggctgggc cgtgatcacc gacgagtaca 1860

aggtgcccag caagaaattc aaggtgctgg gcaacaccga ccggcacagc atcaagaaga 1920

acctgatcgg agccctgctg ttcgacagcg gcgaaacagc cgaggccacc cggctgaaga 1980

gaaccgccag aagaagatac accagacgga agaaccggat ctgctatctg caagagatct 2040

tcagcaacga gatggccaag gtggacgaca gcttcttcca cagactggaa gagtccttcc 2100

tggtggaaga ggataagaag cacgagcggc accccatctt cggcaacatc gtggacgagg 2160

tggcctacca cgagaagtac cccaccatct accacctgag aaagaaactg gtggacagca 2220

ccgacaaggc cgacctgcgg ctgatctatc tggccctggc ccacatgatc aagttccggg 2280

gccacttcct gatcgagggc gacctgaacc ccgacaacag cgacgtggac aagctgttca 2340

tccagctggt gcagacctac aaccagctgt tcgaggaaaa ccccatcaac gccagcggcg 2400

tggacgccaa ggccatcctg tctgccagac tgagcaagag cagacggctg gaaaatctga 2460

tcgcccagct gcccggcgag aagaagaatg gcctgttcgg aaacctgatt gccctgagcc 2520

tgggcctgac ccccaacttc aagagcaact tcgacctggc cgaggatgcc aaactgcagc 2580

tgagcaagga cacctacgac gacgacctgg acaacctgct ggcccagatc ggcgaccagt 2640

acgccgacct gtttctggcc gccaagaacc tgtccgacgc catcctgctg agcgacatcc 2700

tgagagtgaa caccgagatc accaaggccc ccctgagcgc ctctatgatc aagagatacg 2760

acgagcacca ccaggacctg accctgctga aagctctcgt gcggcagcag ctgcctgaga 2820

agtacaaaga gattttcttc gaccagagca agaacggcta cgccggctac attgacggcg 2880

gagccagcca ggaagagttc tacaagttca tcaagcccat cctggaaaag atggacggca 2940

ccgaggaact gctcgtgaag ctgaacagag aggacctgct gcggaagcag cggaccttcg 3000

acaacggcag catcccccac cagatccacc tgggagagct gcacgccatt ctgcggcggc 3060

aggaagattt ttacccattc ctgaaggaca accgggaaaa gatcgagaag atcctgacct 3120

tccgcatccc ctactacgtg ggccctctgg ccaggggaaa cagcagattc gcctggatga 3180

ccagaaagag cgaggaaacc atcaccccct ggaacttcga ggaagtggtg gacaagggcg 3240

cttccgccca gagcttcatc gagcggatga ccaacttcga taagaacctg cccaacgaga 3300

aggtgctgcc caagcacagc ctgctgtacg agtacttcac cgtgtataac gagctgacca 3360

aagtgaaata cgtgaccgag ggaatgagaa agcccgcctt cctgagcggc gagcagaaaa 3420

aggccatcgt ggacctgctg ttcaagacca accggaaagt gaccgtgaag cagctgaaag 3480

aggactactt caagaaaatc gagtgcttcg actccgtgga aatctccggc gtggaagatc 3540

ggttcaacgc ctccctgggc acataccacg atctgctgaa aattatcaag gacaaggact 3600

tcctggacaa tgaggaaaac gaggacattc tggaagatat cgtgctgacc ctgacactgt 3660

ttgaggacag agagatgatc gaggaacggc tgaaaaccta tgcccacctg ttcgacgaca 3720

aagtgatgaa gcagctgaag cggcggagat acaccggctg gggcaggctg agccggaagc 3780

tgatcaacgg catccgggac aagcagtccg gcaagacaat cctggatttc ctgaagtccg 3840

acggcttcgc caacagaaac ttcatgcagc tgatccacga cgacagcctg acctttaaag 3900

aggacatcca gaaagcccag gtgtccggcc agggcgatag cctgcacgag cacattgcca 3960

atctggccgg cagccccgcc attaagaagg gcatcctgca gacagtgaag gtggtggacg 4020

agctcgtgaa agtgatgggc cggcacaagc ccgagaacat cgtgatcgaa atggccagag 4080

agaaccagac cacccagaag ggacagaaga acagccgcga gagaatgaag cggatcgaag 4140

agggcatcaa agagctgggc agccagatcc tgaaagaaca ccccgtggaa aacacccagc 4200

tgcagaacga gaagctgtac ctgtactacc tgcagaatgg gcgggatatg tacgtggacc 4260

aggaactgga catcaaccgg ctgtccgact acgatgtgga ccatatcgtg cctcagagct 4320

ttctgaagga cgactccatc gacaacaagg tgctgaccag aagcgacaag aaccggggca 4380

agagcgacaa cgtgccctcc gaagaggtcg tgaagaagat gaagaactac tggcggcagc 4440

tgctgaacgc caagctgatt acccagagaa agttcgacaa tctgaccaag gccgagagag 4500

gcggcctgag cgaactggat aaggccggct tcatcaagag acagctggtg gaaacccggc 4560

agatcacaaa gcacgtggca cagatcctgg actcccggat gaacactaag tacgacgaga 4620

atgacaagct gatccgggaa gtgaaagtga tcaccctgaa gtccaagctg gtgtccgatt 4680

tccggaagga tttccagttt tacaaagtgc gcgagatcaa caactaccac cacgcccacg 4740

acgcctacct gaacgccgtc gtgggaaccg ccctgatcaa aaagtaccct aagctggaaa 4800

gcgagttcgt gtacggcgac tacaaggtgt acgacgtgcg gaagatgatc gccaagagcg 4860

agcaggaaat cggcaaggct accgccaagt acttcttcta cagcaacatc atgaactttt 4920

tcaagaccga gattaccctg gccaacggcg agatccggaa gcggcctctg atcgagacaa 4980

acggcgaaac cggggagatc gtgtgggata agggccggga ttttgccacc gtgcggaaag 5040

tgctgagcat gccccaagtg aatatcgtga aaaagaccga ggtgcagaca ggcggcttca 5100

gcaaagagtc tatcctgccc aagaggaaca gcgataagct gatcgccaga aagaaggact 5160

gggaccctaa gaagtacggc ggcttcgaca gccccaccgt ggcctattct gtgctggtgg 5220

tggccaaagt ggaaaagggc aagtccaaga aactgaagag tgtgaaagag ctgctgggga 5280

tcaccatcat ggaaagaagc agcttcgaga agaatcccat cgactttctg gaagccaagg 5340

gctacaaaga agtgaaaaag gacctgatca tcaagctgcc taagtactcc ctgttcgagc 5400

tggaaaacgg ccggaagaga atgctggcct ctgccggcga actgcagaag ggaaacgaac 5460

tggccctgcc ctccaaatat gtgaacttcc tgtacctggc cagccactat gagaagctga 5520

agggctcccc cgaggataat gagcagaaac agctgtttgt ggaacagcac aagcactacc 5580

tggacgagat catcgagcag atcagcgagt tctccaagag agtgatcctg gccgacgcta 5640

atctggacaa agtgctgtcc gcctacaaca agcaccggga taagcccatc agagagcagg 5700

ccgagaatat catccacctg tttaccctga ccaatctggg agcccctgcc gccttcaagt 5760

actttgacac caccatcgac cggaagaggt acaccagcac caaagaggtg ctggacgcca 5820

ccctgatcca ccagagcatc accggcctgt acgagacacg gatcgacctg tctcagctgg 5880

gaggcgacaa aaggccggcg gccacgaaaa aggccggcca ggcaaaaaag aaaaagtaag 5940

aattcctaga gctcgctgat cagcctcgac tgtgccttct agttgccagc catctgttgt 6000

ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc actcccactg tcctttccta 6060

ataaaatgag gaaattgcat cgcattgtct gagtaggtgt cattctattc tggggggtgg 6120

ggtggggcag gacagcaagg gggaggattg ggaagagaat agcaggcatg ctggggagcg 6180

gccgcaggaa cccctagtga tggagttggc cactccctct ctgcgcgctc gctcgctcac 6240

tgaggccggg cgaccaaagg tcgcccgacg cccgggcttt gcccgggcgg cctcagtgag 6300

cgagcgagcg cgcagctgcc tgcaggggcg cctgatgcgg tattttctcc ttacgcatct 6360

gtgcggtatt tcacaccgca tacgtcaaag caaccatagt acgcgccctg tagcggcgca 6420

ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta 6480

gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg ctttccccgt 6540

caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg gcacctcgac 6600

cccaaaaaac ttgatttggg tgatggttca cgtagtgggc catcgccctg atagacggtt 6660

tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt ccaaactgga 6720

acaacactca accctatctc gggctattct tttgatttat aagggatttt gccgatttcg 6780

gcctattggt taaaaaatga gctgatttaa caaaaattta acgcgaattt taacaaaata 6840

ttaacgttta caattttatg gtgcactctc agtacaatct gctctgatgc cgcatagtta 6900

agccagcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg 6960

gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca 7020

ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt tttataggtt 7080

aatgtcatga taataatggt ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc 7140

ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa 7200

taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc 7260

cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa 7320

acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa 7380

ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg 7440

atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa 7500

gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc 7560

acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc 7620

atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta 7680

accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag 7740

ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca 7800

acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca acaattaata 7860

gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc 7920

tggtttattg ctgataaatc tggagccggt gagcgtggaa gccgcggtat cattgcagca 7980

ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca 8040

actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg 8100

taactgtcag accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa 8160

tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt 8220

gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat 8280

cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg 8340

gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga 8400

gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac 8460

tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt 8520

ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag 8580

cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc 8640

gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag 8700

gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca 8760

gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt 8820

cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc 8880

tttttacggt tcctggcctt ttgctggcct tttgctcaca tgt 8923

<210> 2

<211> 3445

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacacca gccccagcaa gagcacaagg ttttagagct agaaatagca agttaaaata 300

aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt tgttttagag 360

ctagaaatag caagttaaaa taaggctagt ccgtttttag cgcgtgcgcc aattctgcag 420

acaaatcctc tttctttgca gcaatgcctc ctgcaccacc aactgcttag cacccctggc 480

caaggtcatc catgacaact ttggtatcgt ggaaggactc atggtatgag agctggggaa 540

tgggactgag gctcccacct ttctcatcca agactggctc ctccctgccg gggctgcgtg 600

caaccctggg gttgggggtt ctggggactg gctttcccat aatttccttt caaggtgggg 660

agggaggtag aggggtgatg tggggagtac gctgcagggc ctcactcctt ttgcagacca 720

cagtccatgc catcactgcc acccagaaga ctgtggatgg cccctccggg aaactgtggc 780

gtgatggccg cggggctctc cagaacatca tccctgcctc tactggcgct gccaaggctg 840

tgggcaaggt catccctgag ctgaacggga agctcactgg catggccttc cgtgtcccca 900

ctgccaacgt gtcagtggtg gacctgacct gccgtctaga aaaacctgcc aaatatgatg 960

acatcaagaa ggtggtgaag caggcgtcgg agggccccct caagggcatc ctgggctaca 1020

ctgagcacca ggtggtctcc tctgacttca acagcgacac ccactcctcc acctttgacg 1080

ctggggctgg cattgccctc aacgaccact ttgtcaagct catttcctgg tatgtggctg 1140

gggccagaga ctggctctta aaaagtgcag ggtctggcgc cctctggtgg ctggctcaga 1200

aaaagggccc tgacaactct tttcatcttc taggtatgac aacgaatttg gctacagcaa 1260

cagggtggtg gacctcatgg cccacatggc ctccaaggag gccactaact tctccctgtt 1320

gaaacaagca ggggatgtcg aagagaatcc cgggccaatg gtatcaaagg gcgaagagct 1380

attcacagga gtagtaccaa ttctagtaga actagacgga gacgtaaacg gacacaaatt 1440

ctcagtacga ggagaaggag aaggagacgc aacaaacgga aagctcaccc taaagtttat 1500

ctgcacaaca ggaaagctcc cggttccttg gccaacacta gtaacaacat tcggatatgg 1560

agtagcatgc ttctcacgat atccagacca catgaaacaa cacgacttct tcaaatcagc 1620

aatgccagaa ggatatgtac aagaacgaac aatttcattc aaagacgacg gaacatataa 1680

gactagagca gaagtaaagt ttgagggaga cacactagta aaccgaattg aactaaaggg 1740

catcgacttc aaagaagacg gaaacattct aggacacaaa ctagaatata acttcaactc 1800

acacaacgta tatattacag cagacaaaca gaagaatggt attaaagcaa acttcaagat 1860

ccgtcacaac gtagaagacg gatcagtaca actagcagac cactatcaac agaatacgcc 1920

aattggagac ggaccagtac tactaccaga caaccactat ctatcacacc aatcagcact 1980

atcaaaggat cccaacgaga agcgtgatca catggtacta ctagaattcg taacagcagc 2040

aggaggatca taaccctgcc acactcagtc ccccaccaca ctgaatctcc cctcctcaca 2100

gttgccatgt agaccccttg aagaggggag gggcctaggg agccgcacct tgtcatgtac 2160

catcaataaa gtaccctgtg ctcaaccagt tacttgtcct gtcttattct agggtctggg 2220

gcagagggga gggaagctgg gcttgtgtca aggtgagaca ttcttgctgg ggagggacct 2280

ggtatgttct cctcagactg agggtagggc ctccaaacag ccttgcttgc ttcgagaacc 2340

atttgcttcc cgctcagacg tcttgagtgc tacaggaagc tggcaccact acttcagaga 2400

acaaggcctt ttcctctcct cgctccagtc ctaggctatc tgctgttggc caaacatgga 2460

agaagctatt ctgtgggcag ccccagggag gctgacaggt ggaggaagtc agggctcgca 2520

ctgggctctg acgctgactg gttagtggag ctcagcctgg agctgagctg cagcgggcaa 2580

ttccagcttg gcctccgcag ctgtgaggtc ttgagcacgt gctctattgc tttctgtgcc 2640

ctcgtgtctt atctgaggac atcgtggcca gcccctaagg tcttcaagca ggattcatct 2700

aggtaaacca agtacctaaa accatgccca aggcggtaag gactatataa tgtttaaaaa 2760

tcggtaaaaa tgcccacctc gcatagtttt gaggaagatg aactgagatg tgtcagggtg 2820

acttatttcc atcatcgtcc ttaggggaac ttgggtaggg gcaaggcgtg tagctgggac 2880

ctaggtccag acccctggct ctgccactga acggctcagt tgctttgggc agttactccc 2940

gggcctcact ttgcacgtgt gcttacctag tggagacaaa agtacatacc tcggtagagc 3000

gcgcacgcct gtaaccccag agggcctatt tcccatgatt ccttcatatt tgcatatacg 3060

atacaaggct gttagagaga taattggaat taatttgact gtaaacacaa agatattagt 3120

acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt taaaattatg 3180

ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt tcttggcttt 3240

atatatcttg tggaaaggac gaaacaccag ccccagcaag agcacaaggt tttagagcta 3300

gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg 3360

gtgctttttt gttttagagc tagaaatagc aagttaaaat aaggctagtc cgtttttagc 3420

gcgtgcgcca attctgcaga caaat 3445

<210> 3

<211> 2083

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 60

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 120

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 180

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 240

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 300

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 360

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 420

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 480

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 540

acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 600

ccggtcgcca ccatgggatc cgaccctagc aaagactcaa aagctcaggt gtccgctgcc 660

gaggctggca ttactggaac atggtacaat cagctcggga gcacctttat tgtgactgct 720

ggagccgatg gagccctcac cggaacatac gaatctgctg tgggaaacgc cgaatcacgg 780

tacgtcctca ctggccgata cgatagtgcc cctaccaccg acggatctgg gactgccctg 840

ggatggactg tcgcttggaa aaacaactac cggaatgctc attctgccac aacatggagt 900

ggacagtacg tgggaggcgc tgaggctaga atcaatacac agtggctgct cacatctggc 960

acaaccgagg caaatgcttg gaaatccacc ctggtgggac atgacacatt caccaaagtg 1020

aaaccctccg ccgcttcaat cgatgccgcc aaaaaagccg gagtcaacaa cggcaatcct 1080

ctggatgccg tccagcagaa gcttcccaag aagaagagga aagtctcgag ctgtgagagt 1140

tatctgaccg taaggtgaat tcgtgagcaa gggcgaggag gataacatgg ccatcatcaa 1200

ggagttcatg cgcttcaagg tgcacatgga gggctccgtg aacggccacg agttcgagat 1260

cgagggcgag ggcgagggcc gcccctacga gggcacccag accgccaagc tgaaggtgac 1320

caagggtggc cccctgccct tcgcctggga catcctgtcc cctcagttca tgtacggctc 1380

caaggcctac gtgaagcacc ccgccgacat ccccgactac ttgaagctgt ccttccccga 1440

gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga ccgtgaccca 1500

ggactcctcc ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg gcaccaactt 1560

cccctccgac ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct cctccgagcg 1620

gatgtacccc gaggacggcg ccctgaaggg cgagatcaag cagaggctga agctgaagga 1680

cggcggccac tacgacgctg aggtcaagac cacctacaag gccaagaagc ccgtgcagct 1740

gcccggcgcc tacaacgtca acatcaagtt ggacatcacc tcccacaacg aggactacac 1800

catcgtggaa cagtacgaac gcgccgaggg ccgccactcc accggcggca tggacgagct 1860

gtacaaggtc gacggtaccg cgggcccggg atccaccgga tctagataac tgatcataat 1920

cagccatacc acatttgtag aggttttact tgctttaaaa aacctcccac acctccccct 1980

gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa 2040

tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaa 2083

<210> 4

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcaaaaaaga aaaagggatc cgaccctagc aaagac 36

<210> 5

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atcagcgagc tctaggaatt cttaaagctt ctgctggacg gcat 44

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caccgcctta cggtcagata actctcac 28

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aaacgtgaga gttatctgac cgtaaggc 28

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caccgagccc cagcaagagc acaag 25

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aaaccttgtg ctcttgctgg ggctc 25

<210> 10

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaggccctgt gggaggaaga gaagaggtca gaagcttgta aggatgcaag tgaggg 56

<210> 11

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tcttcctccc acagggcctc gagagatctg gcagcggagc caccatggtg agcaagg 57

<210> 12

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgagtgagag ttatctgacc catagagccc accgcatcc 39

<210> 13

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gggatgcggt gggctctatg ggtcagataa ctctcact 38

<210> 14

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgacatcccc tgcttgtttc aacagggaga agttagtggc ctccttggag gccatgtgg 59

<210> 15

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gaaacaagca ggggatgtcg aagagaatcc cgggccaatg gtgagcaagg gcgagg 56

<210> 16

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gtgccgcttt ctgtctgc 18

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggcttgccaa ggactcaa 18

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gaggcgcatg ttctccaaaa 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

aacttgtggc cgttcacgtc 20

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

taaatgcact gttgggccta t 21

<210> 21

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gtgccgcttt ctgtctgcga gggcctattt cccatgat 38

<210> 22

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gcaagtcagg ggagcgtgtc atttgtctgc agaattggcg 40

<210> 23

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cgccaattct gcagacaaat gacacgctcc cctgacttgc 40

<210> 24

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

atcatgggaa ataggccctc ctggggttac aggcgtgcg 39

<210> 25

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cgcacgcctg taaccccagg agggcctatt tcccatgat 39

<210> 26

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

ggcttgccaa ggactcaaat ttgtctgcag aattggcg 38

Claims (10)

1. A method for improving homologous recombination efficiency based on a CRISPR gene editing system is characterized by comprising the step of introducing a Cas9 plasmid fused with streptavidin and a corresponding homologous donor with biotin modification into a host cell.

2. The method of claim 1, further comprising introducing into the host cell a NHEJ fluorescent reporter plasmid.

3. The method of claim 1, wherein the Cas9 plasmid introduced with the fusogenic streptavidin is pX330-SA-hspCas9-sgRNA or pX330-hspCas9-SA-sgRNA and the corresponding homologous donor with biotin modification is Bio-EGFP-donor.

4. The method of claim 2, wherein the Cas9 plasmid introduced with the fusogenic avidin is pX330-SA-hspCas9 or pX330-hspCas9-SA, the corresponding cognate donor with biotin modification is Bio-sgRNA-EGFP-donor, and the NHEJ fluorescent reporter plasmid is pCMV-SA-mCherry-NHEJ.

5. The method of claim 1, wherein the host cell comprises porcine PK-15 cells, human K562 cells, human 293T cells.

6. A genome editing system comprising a Cas9 plasmid fused to streptavidin and a corresponding homologous donor with biotin modifications.

7. The gene editing system of claim 6, further comprising a NHEJ fluorescent reporter plasmid.

8. The gene editing system of claim 6, further comprising a polynucleotide sequence encoding a sequence manipulation system, the sequence manipulation system being a CRISPR/Cas system.

9. A method for performing genome editing, comprising expressing the genome editing system according to any one of claims 6 to 8 in an organism.

10. Use of the genome editing system according to any one of claims 6 to 8 for improving the efficiency of homologous recombination.

Images