CN113943749B - Method for improving homologous recombination efficiency based on CRISPR gene editing system - Google Patents

Abstract

The invention provides a method for improving homologous recombination efficiency based on a CRISPR gene editing system, which comprises the steps of introducing a Cas9 plasmid fused with streptavidin and a corresponding homologous donor with biotin modification into a host cell, and further introducing an NHEJ fluorescence reporter plasmid into the host cell. According to the invention, the Cas9 plasmid fused with streptavidin, the corresponding homologous donor with biotin modification and the NHEJ fluorescent reporter plasmid are introduced into a CRISPR/Cas9 system for the first time, so that the homologous recombination efficiency is improved, the fluorescent reporter plasmid based on NHEJ can indicate all elements subjected to homologous recombination, and the initial flow analysis result shows that the homologous recombination efficiency in enriched cells can be improved to 50-80%.

Description

Method for improving homologous recombination efficiency based on CRISPR gene editing system

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a method for improving homologous recombination efficiency based on a CRISPR gene editing system.

Background

CRISPR/Cas systems, one of the most widely used gene editing techniques at present, can be used to effect genome editing by creating double strand breaks at specific sites in the genome by the guidance of single-stranded guide RNAs (sgrnas), followed by two major repair modes by Non-homologous end joining (Non-Homology end joining, NHEJ) of host cells and homologous recombination (HDR). Although NHEJ occurs more efficiently, it tends to result in random base insertions and deletions at the cleavage site, and precise editing is not possible. In contrast, HDR can achieve precise editing in almost all forms, including gene insertion, base substitution, etc., with the donor template provided manually. Therefore, in practical application, HDR has great application prospect, but the occurrence probability is far lower than that of NHEJ, and the development of the HDR is greatly limited.

There are various methods for improving the efficiency of homologous recombination, and they can be classified into two general categories. One is to regulate the cell cycle to a period when HDR efficiently occurs through drugs, inhibit the NHEJ repair mode of cells through small molecule inhibitors or directly use small molecule drugs which promote the activity of HDR repair related proteins. However, the problem with this type of method is that it requires the application of drugs to regulate the growth state of cells, and it is known that NHEJ and HDR are two important repair modes for protecting cells from damage by maintaining their own genomes, and this method of inhibiting another repair mode by increasing the repair modes we want may reduce the ability of cells to resist damage, resulting in a different degree of safety hazard. The other is to improve homologous recombination by changing the form of the donor, wherein the double-stranded donor has the advantages of higher efficiency, convenient acquisition and the like, but the naked 3' -OH can be a target for recognition and attack of host cell nuclease, so that the homologous recombination rate is not high.

Disclosure of Invention

In view of the above, the present invention aims to provide a method for improving homologous recombination efficiency based on a CRISPR gene editing system, and provides a Cas9 plasmid fused with streptavidin, a corresponding homologous donor with biotin modification, and a NHEJ fluorescence reporter plasmid for improving homologous recombination efficiency for the first time.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a method for improving homologous recombination efficiency based on a CRISPR gene editing system, which comprises the steps of introducing a Cas9 plasmid fused with streptavidin and a corresponding homologous donor with biotin modification into a host cell.

In the present invention, the introduction of a NHEJ fluorescent reporter plasmid into a host cell is also included.

In the present invention, as one embodiment, the Cas9 plasmid into which streptavidin is introduced is pX330-SA-hspCas9-sgRNA or pX330-hspCas9-SA-sgRNA, and the corresponding homologous donor with biotin modification is Bio-EGFP-donor. The sgRNA in the pX330-SA-hspCas9-sgRNA is human GAPDH locus sgRNA or pig Rosa26 locus sgRNA, the sgRNA in the pX330-hspCas9-SA-sgRNA is human GAPDH locus sgRNA or pig Rosa26 locus sgRNA, and the Bio-EGFP-donor human GAPDH locus homologous donor or pig Rosa26 locus homologous donor. In the invention, the pX330-SA-hspCas9-sgRNA or the pX330-hspCas9-SA-sgRNA is a plasmid based on the pX330-hspCas9, streptavidin (SA) is fused to the N end or the C end of the pX330-hspCas9 by a one-step cloning method, and then the corresponding sgRNA is connected to the pX330-SA-hspCas9 or the pX330-hspCas9-SA skeleton in an annealing connection mode. The Bio-EGFP-donor is obtained by loading three fragments of homology arm 5'HA, 3' HA and EGFP onto a pET28A vector by using a SE seamless cloning connection kit and carrying out PCR amplification by a primer with biotin modification. The homology arm 5'HA and 3' HA are derived from pig PK-15 cells (Rosa 26 genes) or human HEK293T cell (GAPDH genes) genome, and upstream and downstream sequences of the Rosa26 genes or the GAPDH genes are cut to obtain 5'HA with the upstream sequence and 3' HA with the downstream sequence. The EGFP gene is amplified from pEGFP-C1 plasmid.

As another embodiment, the invention also introduces NHEJ fluorescence reporter plasmid. In the present invention, the Cas9 plasmid into which streptavidin is introduced is pX330-SA-hspCas9 or pX330-hspCas9-SA, the corresponding homologous donor with biotin modification is Bio-sgRNA-EGFP-donor, and the NHEJ fluorescence reporter plasmid is pCMV-SA-mCherry-NHEJ. The nucleotide sequence of the pX330-SA-hspCas9 is shown as SEQ ID NO. 1, the human GAPDH locus sgRNA in the Bio-sgRNA-EGFP-donor is respectively fused to the 5 'end, the 3' end and the two ends of the Bio-EGFP-donor, the nucleotide sequence of the human GAPDH locus sgRNA in the Bio-sgRNA-EGFP-donor is shown as SEQ ID NO. 2, and the nucleotide sequence of the pCMV-SA-mCherry-NHEJ is shown as SEQ ID NO. 3. In the invention, pX330-SA-hspCas9 or pX330-hspCas9-SA is a plasmid based on pX330-hspCas9, and Streptavidin (SA) is fused to the N end or the C end of the pX330-hspCas9 by a one-step cloning method. The Bio-sgRNA-EGFP-donor disclosed by the invention is obtained by respectively fusing the complete sgRNA containing the U6 promoter and the terminator sequence to the 5 'end, the 3' end or both ends of the Bio-EGFP-donor through a fusion PCR method and carrying out PCR amplification through a primer with biotin modification. The pCMV-SA-mCherry-NHEJ is obtained by replacing EGFP in pCMV-EGFP-mCherry with streptavidin monomer SA, double digestion with EcoRI and XhoI, and integration of sgRNA target sequence containing PAM sequence between pCMV-SA-mCherry by annealing connection. The sgRNA target sequence containing the PAM sequence in the invention is T2-gRNA: ggggccactagggacaggattgg, g-Talen1: gtcccctccaccccacagtgggg, crRNA: tttatctgtcccctccaccccacagtg.

The steps and reaction systems involved in PCR amplification, plasmid digestion, annealing ligation, and seamless cloning are all well known to those skilled in the art.

In the present invention, the host cell is preferably a pig PK-15 cell, a human K562 cell, or a human HEK293T cell.

The invention also provides a genome editing system comprising introducing into a host cell a Cas9 plasmid fused with streptavidin and a corresponding homologous donor with biotin modification, preferably further comprising introducing into the host cell a NHEJ fluorescence reporter plasmid. In the invention, when the Cas9 plasmid into which streptavidin is introduced is pX330-SA-hspCas9-sgRNA or pX330-hspCas9-SA-sgRNA, the corresponding homologous donor with biotin modification is Bio-EGFP-donor; when the Cas9 plasmid into which streptavidin is introduced is pX330-SA-hspCas9 or pX330-hspCas9-SA, the corresponding homologous donor with biotin modification is Bio-sgRNA-EGFP-donor, the NHEJ fluorescence reporter plasmid is pCMV-SA-mCherry-NHEJ.

In the present invention, the gene editing system further comprises a polynucleotide sequence encoding a sequence manipulation system. The polynucleotide sequence described in the present invention is preferably a sequence that plays a role in encoding in a gene editing system. The sequence manipulation system described in the present invention is preferably a CRISPR/Cas system.

The invention also provides a method for realizing genome editing, comprising expressing the genome editing system in an organism.

The invention also provides application of the gene editing system in improving homologous recombination efficiency.

Compared with the prior art, the invention has the following beneficial effects:

according to the invention, the Cas9 plasmid fused with streptavidin, the corresponding homologous donor with biotin modification and the NHEJ fluorescent reporter plasmid are introduced into a CRISPR/Cas9 system for the first time, so that the homologous recombination efficiency is improved, the fluorescent reporter plasmid based on NHEJ can indicate all elements subjected to homologous recombination, and the initial flow analysis result shows that the homologous recombination efficiency in enriched cells can be further improved to 50% -80%.

The invention provides a new choice for realizing high-efficiency homologous recombination editing by a genome editing technology, in practical application, a marker gene is not required to be integrated into a genome, positive cells which truly generate homologous recombination can be easily obtained only through an NHEJ report plasmid which acts outside the genome, so that the invention has higher safety, reduces the difficulty of screening and produces a certain promotion effect for the application of gene editing.

Drawings

FIG. 1 shows the schematic diagrams of pX330-SA-hspCas9 (left) and pX330-hspCas9-SA (right) vectors.

FIG. 2 shows the results of the cleavage of pX330-SA-hspCas9 and pX330-hspCas9-SA (left) and the sequencing peaks (right).

FIG. 3 shows the sequencing peaks of sgRNA.

FIG. 4pRosa26-EGFP-donor and pGAPDH-EGFP-donor vectors (top) and sequencing peaks (bottom).

FIG. 5 Hochest nuclear staining results under different conditions.

FIG. 6 shows a graph of a green fluorescence proportional flow analysis after 3 days of electrotransformation.

FIG. 7 shows a graph of a green fluorescence proportional flow analysis 7 days after electrotransformation.

FIG. 8 Green fluorescence ratios of electrotransport PK-15 cells for 3 days (left) and 7 days (right).

FIG. 9 shows the fluorescence status of single cell clones (GFP field, bright field and Merge images in order from left to right).

FIG. 10PCR identifies the location of the primers and the length of the amplified product fragments.

FIG. 11PCR identification primer schematic and each electrotransformation combined PCR identification result map (boxes represent double allele editing clones).

FIG. 12 partial cloning sequence alignment (5 'HA:5' homology arm sequence, splicing acceptor: cleavage receptor, prCas 9: common Cas9 without avidin fused, N/C-SA: cas9 protein fused with avidin at either the N-or C-terminus).

FIG. 13 shows a PCR identification map (left) and a sequencing peak map (right) of a double allele editing clone.

FIG. 14 electrokinetic K562 flow chart.

FIG. 15 is a bar graph of green fluorescence ratios for K562.

FIG. 16 donor fusion PCR amplification results.

FIG. 17pCMV-SA-mCherry-NHEJ report vector schematic (left) and sequencing peak pattern (right).

FIG. 18pCMV-SA-mCherry-NHEJ report vector cell function verification.

FIG. 19 is a chart of electrotransformation of NHEJ and HDR flow two-color analysis of K562 cells.

Detailed Description

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

EXAMPLE 1 Biotin-streptavidin strong interaction to increase homologous recombination efficiency

1. Construction of streptavidin-fused Cas9 plasmid and construction of gRNA-containing pX330-hspCas9-SA plasmid

(1) Construction of streptavidin fused Cas9 plasmid

Streptavidin was loaded into pX330-hspCas9 using the pX330-hspCas9 (fully known as pX330-U6-Chimeric-BB-CBh-hSpCas 9) plasmid as the base vector.

The sequence of Streptavidin (SA) is obtained by reference (Synchronization ofsecretoryprotein traffic in populations ofcells; gaelle Boncompain; nature methods) and synthesized by Jin Wei intelligent company, and SV40 NLS nuclear localization sequence is added at the 3' end during synthesis to obtain synthesized streptavidin fragment. And (3) carrying out PCR amplification on the synthesized streptavidin fragment, wherein an amplification primer is hspCas9-SA-F/hspCas9-SA-R, the nucleotide sequence is shown as SEQ ID NO. 4/SEQ ID NO. 5, and sequence information near a pX330-hspCas9 skeleton enzyme cutting site is reserved during amplification.

The backbone of pX330-hspCas9 was cut with AgeI and EcoRI, respectively, and streptavidin was fused to the N-or C-terminus of pX330-hspCas9 protein by means of a abm one-step cloning kit, respectively, to give pX330-SA-hspCas9 or pX330-hspCas9-SA, the vector schematic of which is shown in FIG. 1.

The successfully constructed vectors were subjected to EcoRI, bamHI and HindIII cleavage detection and sequencing verification, respectively, and the cleavage identification results and the sequencing diagram are shown in FIG. 2. As shown in FIG. 2, the SA sequence contains a BamHI and HindIII cleavage site at each end, and after double cleavage, 513bp SA sequences and 8506bp pX330-hspCas9 vector backbones successfully appear, and the pX330-SA-hspCas9 or pX330-hspCas9-SA plasmids are successfully constructed by sequencing.

(2) Construction of a streptavidin-fused Cas9 plasmid containing sgRNA

The corresponding ligated sgrnas were obtained by adding 5'-CACC-3' and 5'-AAAC-3' to both ends of the sgRNA sequence, respectively, by corresponding literature (GAPDH: knock-in oflarge reporter genes in human cells via CRISPR/Cas 9-reduced moved-dependent and independent DNA repair, xiangjun He, nucleicAcids Research; rosa26: optimization ofa CRISPR/Cas 9-mediated Knock-in Strategy at thePorcine Rosa-Locus in Porcine Foetal Fibroblasts, zicon Xie, scientific reports). Then the corresponding sgRNA is connected to a Bbs I digested pX330-hspCas9-SA skeleton in an annealing connection mode, primers related to the annealing connection are Rosa26-sg-F/Rosa26-sg-R and GAPDH-sg2-F/GAPDH-sg2-R, nucleotide sequences are shown as SEQ ID NO. 6/SEQ ID NO. 7 and SEQ ID NO. 8/SEQ ID NO. 9, and after the conversion plating, the sequencing results are shown in figure 3. The results in FIG. 3 show that the sgRNA sequence is correct, and that the construction of the pX330-hspCas9 vector containing streptavidin and sgRNA was successful, and that subsequent experiments were carried out.

2. Construction of corresponding homologous donors and obtaining of biotin-modified double-stranded donors

(1) Construction of the corresponding homologous donor: construction of the gRNA-containing pX330-hspCas9-SA plasmid requires construction of the corresponding homologous donor

Homologous Arm (HA) was obtained from the genome of pig PK-15 cells (Rosa 26 gene) or human HEK293T cells (GAPDH gene), and its upstream and downstream sequences were cleaved, the upstream sequence being 5'HA and the downstream sequence being 3' HA. EGFP gene was amplified from pEGFP-C1 plasmid, and then three fragments of 5'HA, 3' HA and EGFP obtained from Rosa26 gene or GAPDH gene were loaded onto pET28A vector using SE seamless cloning ligation kit, the schematic vector diagram and sequencing peak diagram of which are shown in FIG. 4. As shown in FIG. 4, since different strategies are selected for the insertion positions, EGFP gene needs to be inserted into the intron of Rosa26 site in pig PK-15 cells, so that in order to ensure correct expression of EGFP, a shearing receptor (splicing acceptor) sequence and an SV40poly (A) sequence (adedge website) need to be introduced, the shearing receptor sequence and the SV40poly (A) sequence are respectively related to the primers Rosa26-donor-1R/Rosa26-donor-2F and Rosa26-donor-2R/3F, the nucleotide sequences are shown as SEQ ID NO:10/SEQ ID NO:11 and SEQ ID NO:12/SEQ ID NO:13, and the annealing temperature is 60 ℃. In human K562 cells, EGFP was inserted before the stop codon of GAPDH, so that only a self-cleaving peptide P2A sequence (https:// www.ncbi.nlm.nih.gov/nuccore/MT 559572.1.) was introduced, the related primer was GAPDH-donor-1R/2F, the nucleotide sequence was shown as SEQ ID NO 14/SEQ ID NO 15, and the annealing temperature was 60 ℃. The sequence is found to be completely correct through sequencing verification, and the subsequent experiment can be carried out.

(2) Obtaining of biotin-modified double-stranded donor (bio-ds-EGFP-donor)

And (3) carrying out PCR amplification on the corresponding homologous donor obtained in the step (1) by using a primer with biotin modification, wherein the amplification primer is Bio-F/R, the nucleotide sequence is shown as SEQ ID NO. 16/SEQ ID NO. 17, the annealing temperature is 60 ℃, the double-chain donor fragments with biotin modification at two ends are obtained, and the amplified fragments are subjected to product purification and then are subjected to concentration measurement and placed into-20 ℃ for standby.

3. Transferring the corresponding sgRNA-containing streptavidin-fused Cas9 plasmid and biotin-modified double-stranded donor into a pig PK-15 cell line by means of electrotransfection

Since excessive plasmid usage during electrotransfection resulted in massive cell death, cell activity was identified at a ratio of 1:1, 1:2 and 1:3 with respect to biotin-modified double stranded donor, using pX330-hspCas9-SA plasmid containing gRNA as a subject, and cells 48h after electrotransfection were stained with Hochest and observed with a fluorescence microscope, and the observation results are shown in FIG. 5. As shown in fig. 5, the cell activity was not much different at the 1:2 plasmid dose compared to the control, but the number of surviving cells was significantly reduced at the ratio of 1:3, and the 1:3 combination did not improve the efficiency of homologous recombination more than 1:2 in view of the above 3 rd step, so 5 μg of the sgRNA-containing streptavidin-fused Cas9 plasmid was finally selected for subsequent experiments at a molar ratio of 1:2 with biotin-modified double stranded donor fragments.

4. Detection of homologous recombination efficiency

Comparing with Cas9 protein containing sgRNA without fusion streptavidin, it is judged whether streptavidin can improve homologous recombination efficiency, the experimental combination table 1, and the flow analysis result is shown in FIG. 6. From the results shown in fig. 6, it was found that the Cas9 protein fused with streptavidin after the third day of electrotransformation can improve the homologous recombination efficiency, but only the control group, which had been electrotransformed with bio-ds-EGFP-donor, had 4.3% background fluorescence, we continued to culture the electrotransformed cells to day 7, and analyzed the flow-through results as shown in fig. 7, at which time the control group had been reduced to less than 1%. The results were then consolidated and the corresponding histograms were plotted as shown in table 2 and fig. 8. From the results shown in table 2 and fig. 8, it was found that the results after 3 days and 7 days are significantly different, and since the control group after seven days hardly has interference of background fluorescence, analysis was conducted based on the results after 7 days, and it was found that the efficiency was further improved by introducing streptavidin, regardless of whether streptavidin was fused to the C-terminus or the N-terminus of Cas9, and the efficiency of homologous recombination was improved approximately twice as compared with that of ordinary Cas9, indicating that the improvement of homologous recombination efficiency could indeed be achieved in the PK-15 cell line of swine by strong interaction of streptavidin with biotin.

TABLE 1 amount of electrotransport PK-15/K562 plasmid combination (biotin-streptavidin)

Table 2 PK-15 electrical transfer repeat results

5. Flow-sorting single cell clone identification

And then, verifying whether the green cells are positive clones inserted correctly, and detecting the efficiency of double allele editing, so that the green fluorescence positive cells after 7 days of electrotransformation are subjected to single cell sorting, the purity of the clones can be ensured by single cell sorting, and whether the clones are subjected to double allele editing is accurately identified. Because of the lower transfection efficiency of the streptavidin-free pX330-hspCas9 group after seven days, combined with the difficulty of single clone cell growth, only 20 clones were obtained, whereas the two combinations containing streptavidin gave nearly 40 clones each, with approximately a double increase in efficiency, the number of clones obtained per group being shown in table 3.

TABLE 3 flow type single cell sorting monoclonal quantity statistics

After the colony had grown to a suitable size, the fluorescent expression was observed as shown in FIG. 9, and the results showed that almost all clones contained green fluorescence by fluorescent microscopy.

Then, a small number of cloned cells were subjected to NP-40 lysis and then subjected to PCR detection, the annealing temperature was 58℃and two pairs of identification primers were designed together, which shared the same upstream primer designed at the upstream genomic position across the 5'HA and the downstream primer designed on the EGFP and 3' HA, respectively, so that the first pair of primers (JiandingF 1/R1, nucleotide sequence shown as SEQ ID NO:18/SEQ ID NO: 19) could be used to detect whether the correct targeting of green fluorescent cells occurred, and the second pair of primers (JiandingF 1/R2, nucleotide sequence shown as SEQ ID NO:18/SEQ ID NO: 20) could be used to identify whether the double allele editing occurred, the specific positions of the primers and the PCR detection results were shown in FIGS. 10 and 11.

Because the cloned cell genome is obtained by directly cracking NP-40, contains more impurities, has low PCR amplification quality, and verifies that primers knocked in by single and double alleles have longer amplified fragments, although most clones are edited by single alleles, two bands are obtained, but only a few clones of the final 1900 bp band are amplified. Furthermore, the F1/R1 results show that some clones were expected to have an additional band at one thousand more bp positions, for example, clone #06 in pX330-hspCas9+ bio-ds-donor was significantly amplified by two bands, and the one thousand more bp large bands were sequenced, which was found to have direct ligation of donor fragments to create multiple copies, while several other clones were sequenced at random, and the results of the sequencing alignment are shown in FIG. 12.

To facilitate visual comparison of the identification results for each group, we counted the number of bi-allele editing clones, the number of mono-allele editing clones, the number of negative clones, as shown in table 4.

TABLE 4 PCR identification cloning quantity statistics

It can be seen from table 4 that 18 positive clones were obtained in total using only the combination of biotin-modified donors, but no production of the biallelic editing clone was detected. On the other hand, after introducing streptavidin, 3 biallelic edited clones (efficacy: 7.9% and 8.3% respectively) were detected in 38 and 36 clones at the N-terminal and C-terminal, and by performing PCR amplification and sequencing of two of the clones (#N-01 and #C-06) alone, as shown in FIG. 13, the sequencing result showed only a single peak, further demonstrating that the biallelic editing did occur.

6. Verification of homologous recombination efficiency in K562 cells transfected with

To further verify whether the biotin-streptavidin system was suitable for different species, another relatively stable K562 cell line was selected for verification in the laboratory and flow analysis was performed when fluorescence was below 1% for the control group transfected with Bio-ds-donor alone, as shown in FIG. 14. Flow results showed a further approximately 1-fold increase in HDR efficiency following avidin addition, similar to PK-15 results, followed by three replicates of the experiment, the replicates were sorted and tested for T, the results shown in table 5 and fig. 15.

Table 5K 562 electrical conversion three replicates

Example 2 use of combination of Biotin-streptavidin Strong interaction and NHEJ repaired Red-Green vector Indirect screening homologous recombination to establish efficient homologous recombination method

1. Construction of streptavidin fused Cas9 plasmid

The construction procedure was the same as in section 1, step (1) of example 1.

2. Corresponding homology donor with biotin modification (Bio-sgRNA-EGFP-donor) construction

(1) Construction of original homologous donor template (Bio-EGFP-donor):

the construction procedure was the same as in example 1, section 2, step (1).

(2) Construction of the complete sgRNA plasmid (pX 330-GAPDHsgRNA-hspCas 9) containing the U6 promoter and terminator sequences: based on the plasmid pX330-hspCas9, the Rosa26-gRNA or GAPDH-sgRNA is connected to the pX330-hspCas9 cut by Bbs I in an annealing connection mode to obtain pX330-Rosa 26-sgRNA-hspCas 9 or pX330-GAPDHsgRNA-hspCas9, and the annealing connection primer is Rosa26-sg-F/Rosa26-sg-R or GAPDH-sg2-F/GAPDH-sg2-R, and is expressed as SEQ ID NO:6/SEQ ID NO:7 and SEQ ID NO:8/SEQ ID NO:9, and the PCR is performed after plate coating by conversion, and sequencing is performed by picking.

(3) Construction of Bio-sgRNA-EGFP-donor: fusion PCR method is adopted to fuse pX330-GAPDHsgRNA-hspCas9 to the 5 'end, 3' end and two ends of Bio-EGFP-donor respectively to obtain fusion plasmid, and the result is shown in FIG. 16; and then, PCR amplification is carried out by taking the fusion plasmid as a template and using a primer with biotin modification, and finally, the Bio-sgRNA-EGFP-donor is recovered by agarose gel.

The primer related to the fusion PCR method is as follows: taking pX330-GAPDHsgRNA-hspCas9 as a template, and taking primers of gRNA-GAPDH-donor-1F/gRNA-GAPDH-donor-1R and gRNA-GAPDH-donor-3F/gRNA-GAPDH-donor-3R as shown in SEQ ID NO. 21/SEQ ID NO. 22 and SEQ ID NO. 23/SEQ ID NO. 24; the original homologous donor is used as a template, and the primer is gRNA-GAPDH-donor-2F/gRNA-GAPDH-donor-2R, which is shown as SEQ ID NO. 25/SEQ ID NO. 26. The gRNA-GAPDH-donor-1F/gRNA-GAPDH-donor-1R and the gRNA-GAPDH-donor-3F/gRNA-GAPDH-donor-3R respectively correspond to pX330-GAPDHsgRNA-hspCas amplified at the 5 'and 3' positions of the original homologous donor template, and the annealing temperature is 60 ℃.

3. Construction of NHEJ fluorescent reporter plasmid (pCMV-SA-mCherry-NHEJ plasmid) EGFP in pCMV-EGFP-mCherry was replaced with streptavidin monomer SA, two cleavage sites of XhoI and EcoRI were remained between them, double cleavage was carried out by EcoRI and XhoI, and sgRNA target sequence containing PAM sequence (AGCCCCAGCAAGAGCACAAGAGG for human GAPDH site) was integrated between pCMV-SA-mCherry by annealing ligation, mCherry was not expressed first, frame shift mutation occurred only after cleavage of target sequence by sgRNA, mCherry read code was correct, and red light was then emitted, and the vector schematic and sequencing peak diagram thereof were shown in FIG. 17. From FIG. 17, it can be seen that the modified NHEJ fluorescent reporter plasmid leads to mCherry premature termination when the sgRNA target site is introduced, which accords with the construction principle of the NHEJ fluorescent reporter plasmid.

pCMV-SA-mCherry-NHEJ functional verification: the above constructed NHEJ fluorescent reporter plasmid was co-transfected with pX330-hspCas9-SA plasmid into 293T cells, and the corresponding sgRNA vector was added to the experimental group to verify whether the function was consistent with the expected, and observed by fluorescence microscopy 48 hours after transfection, the results are shown in FIG. 18. As shown in FIG. 18, the pCMV-SA-mCherry-NHEJ fluorescent reporter plasmid does not fluoresce when no sgRNA is introduced, and can fluoresce in red after repair by the NHEJ of the host cell only when the sgRNA is present, i.e., after cleavage, indicating successful vector construction and indicating Cas9 with the sgRNA.

4. Detection of homologous recombination enrichment efficiency of electrotransport K562 cells

The 3 plasmids prepared above were electrotransferred into K562 cells, and Cas9 selected for the C-terminal fusion with streptavidin pX330-SA-hspCas9, the electrotransfer amount was 5. Mu.g, the ratio of homologous donor modified with biotin was 1:2, pX330-hspCas9-SA plasmid: bio-sgRNA-EGFP-donor plasmid: pCMV-SA-mCherry-NHEJ fluorescence reporter plasmid=1:2 (1-3), and the same comparison of different positions coupled with sgRNA was performed, and the combination of pX330-hspCas9-SA: bio-sgRNA-EGFP-donor plasmid=1:2 was also used for adjustment compensation, as the green fluorescence was also required, and the final flow analysis results are shown in FIG. 18.

The ratio in fig. 19 is calculated by the following formula: NHEJ screening ratio = q1+q2; HDR cell proportion = q4+q2; NHEJ screening enriched cells ratio of HDR = Q2/(q1+q2). The results of the arrangement are shown in Table 6.

TABLE 6 statistics of NHEJ and HDR occurrences in electrotransformed K562 cells

The results in table 6 show that with increasing NHEJ reporter plasmid, the HDR duty cycle in the NHEJ selection ratio gradually decreased and the NHEJ efficiency gradually increased, and the HDR efficiency began to decrease as the ratio increased to 1:2:3, indicating a competing relationship between the two repair modes. The comparison shows that the effect is better when the ratio is 1:2:2, the NHEJ screening ratio is close to the HDR ratio, and the HDR ratio can also reach 30%. This suggests that when we sort with fluorescence from the NHEJ fluorescence reporter plasmid, about one third of the cells will be those that undergo homologous recombination. Further illustrating that the method can indirectly enrich cells for homologous recombination. In addition, the efficiency of enriching HDR can be further improved by about one time by coupling sgRNA to double-stranded donor, and the result shows that the combination enrichment effect of the sgRNA coupled at two ends is the best.

Taken together, the above experiments show that:

1. the introduction of biotin-streptavidin into the CRISPR/Cas9 system showed that the efficiency of homologous recombination was increased to 10% in human K562 cells and porcine PK-15 cells and possibly to some extent the efficiency of biallelic editing.

2. Based on the experiment, the sgRNA is coupled with a homologous donor template, so that a fluorescent reporter plasmid based on NHEJ can indicate all elements subjected to homologous recombination, and preliminary flow analysis results show that the homologous recombination efficiency in enriched cells can be further improved to 50-80%.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> university of Henan

<120> method for improving homologous recombination efficiency based on CRISPR gene editing system

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8923

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 900

gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 960

ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcgggagtc gctgcgacgc 1020

tgccttcgcc ccgtgccccg ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg 1080

accgcgttac tcccacaggt gagcgggcgg gacggccctt ctcctccggg ctgtaattag 1140

ctgagcaaga ggtaagggtt taagggatgg ttggttggtg gggtattaat gtttaattac 1200

ctggagcacc tgcctgaaat cacttttttt caggttggac cggtgccacc atgggatccg 1260

accctagcaa agactcaaaa gctcaggtgt ccgctgccga ggctggcatt actggaacat 1320

ggtacaatca gctcgggagc acctttattg tgactgctgg agccgatgga gccctcaccg 1380

gaacatacga atctgctgtg ggaaacgccg aatcacggta cgtcctcact ggccgatacg 1440

atagtgcccc tgccaccgac ggatctggga ctgccctggg atggactgtc gcttggaaaa 1500

acaactaccg gaatgctcat tctgccacaa catggagtgg acagtacgtg ggaggcgctg 1560

aggctagaat caatacacag tggctgctca catctggcac aaccgaggca aatgcttgga 1620

aatccaccct ggtgggacat gacacattca ccaaagtgaa accctccgcc gcttcaatcg 1680

atgccgccaa aaaagccgga gtcaacaacg gcaatcctct ggatgccgtc cagcagaagc 1740

ttcccaagaa gaagaggaaa gtcggtatcc acggagtccc agcagccgac aagaagtaca 1800

gcatcggcct ggacatcggc accaactctg tgggctgggc cgtgatcacc gacgagtaca 1860

aggtgcccag caagaaattc aaggtgctgg gcaacaccga ccggcacagc atcaagaaga 1920

acctgatcgg agccctgctg ttcgacagcg gcgaaacagc cgaggccacc cggctgaaga 1980

gaaccgccag aagaagatac accagacgga agaaccggat ctgctatctg caagagatct 2040

tcagcaacga gatggccaag gtggacgaca gcttcttcca cagactggaa gagtccttcc 2100

tggtggaaga ggataagaag cacgagcggc accccatctt cggcaacatc gtggacgagg 2160

tggcctacca cgagaagtac cccaccatct accacctgag aaagaaactg gtggacagca 2220

ccgacaaggc cgacctgcgg ctgatctatc tggccctggc ccacatgatc aagttccggg 2280

gccacttcct gatcgagggc gacctgaacc ccgacaacag cgacgtggac aagctgttca 2340

tccagctggt gcagacctac aaccagctgt tcgaggaaaa ccccatcaac gccagcggcg 2400

tggacgccaa ggccatcctg tctgccagac tgagcaagag cagacggctg gaaaatctga 2460

tcgcccagct gcccggcgag aagaagaatg gcctgttcgg aaacctgatt gccctgagcc 2520

tgggcctgac ccccaacttc aagagcaact tcgacctggc cgaggatgcc aaactgcagc 2580

tgagcaagga cacctacgac gacgacctgg acaacctgct ggcccagatc ggcgaccagt 2640

acgccgacct gtttctggcc gccaagaacc tgtccgacgc catcctgctg agcgacatcc 2700

tgagagtgaa caccgagatc accaaggccc ccctgagcgc ctctatgatc aagagatacg 2760

acgagcacca ccaggacctg accctgctga aagctctcgt gcggcagcag ctgcctgaga 2820

agtacaaaga gattttcttc gaccagagca agaacggcta cgccggctac attgacggcg 2880

gagccagcca ggaagagttc tacaagttca tcaagcccat cctggaaaag atggacggca 2940

ccgaggaact gctcgtgaag ctgaacagag aggacctgct gcggaagcag cggaccttcg 3000

acaacggcag catcccccac cagatccacc tgggagagct gcacgccatt ctgcggcggc 3060

aggaagattt ttacccattc ctgaaggaca accgggaaaa gatcgagaag atcctgacct 3120

tccgcatccc ctactacgtg ggccctctgg ccaggggaaa cagcagattc gcctggatga 3180

ccagaaagag cgaggaaacc atcaccccct ggaacttcga ggaagtggtg gacaagggcg 3240

cttccgccca gagcttcatc gagcggatga ccaacttcga taagaacctg cccaacgaga 3300

aggtgctgcc caagcacagc ctgctgtacg agtacttcac cgtgtataac gagctgacca 3360

aagtgaaata cgtgaccgag ggaatgagaa agcccgcctt cctgagcggc gagcagaaaa 3420

aggccatcgt ggacctgctg ttcaagacca accggaaagt gaccgtgaag cagctgaaag 3480

aggactactt caagaaaatc gagtgcttcg actccgtgga aatctccggc gtggaagatc 3540

ggttcaacgc ctccctgggc acataccacg atctgctgaa aattatcaag gacaaggact 3600

tcctggacaa tgaggaaaac gaggacattc tggaagatat cgtgctgacc ctgacactgt 3660

ttgaggacag agagatgatc gaggaacggc tgaaaaccta tgcccacctg ttcgacgaca 3720

aagtgatgaa gcagctgaag cggcggagat acaccggctg gggcaggctg agccggaagc 3780

tgatcaacgg catccgggac aagcagtccg gcaagacaat cctggatttc ctgaagtccg 3840

acggcttcgc caacagaaac ttcatgcagc tgatccacga cgacagcctg acctttaaag 3900

aggacatcca gaaagcccag gtgtccggcc agggcgatag cctgcacgag cacattgcca 3960

atctggccgg cagccccgcc attaagaagg gcatcctgca gacagtgaag gtggtggacg 4020

agctcgtgaa agtgatgggc cggcacaagc ccgagaacat cgtgatcgaa atggccagag 4080

agaaccagac cacccagaag ggacagaaga acagccgcga gagaatgaag cggatcgaag 4140

agggcatcaa agagctgggc agccagatcc tgaaagaaca ccccgtggaa aacacccagc 4200

tgcagaacga gaagctgtac ctgtactacc tgcagaatgg gcgggatatg tacgtggacc 4260

aggaactgga catcaaccgg ctgtccgact acgatgtgga ccatatcgtg cctcagagct 4320

ttctgaagga cgactccatc gacaacaagg tgctgaccag aagcgacaag aaccggggca 4380

agagcgacaa cgtgccctcc gaagaggtcg tgaagaagat gaagaactac tggcggcagc 4440

tgctgaacgc caagctgatt acccagagaa agttcgacaa tctgaccaag gccgagagag 4500

gcggcctgag cgaactggat aaggccggct tcatcaagag acagctggtg gaaacccggc 4560

agatcacaaa gcacgtggca cagatcctgg actcccggat gaacactaag tacgacgaga 4620

atgacaagct gatccgggaa gtgaaagtga tcaccctgaa gtccaagctg gtgtccgatt 4680

tccggaagga tttccagttt tacaaagtgc gcgagatcaa caactaccac cacgcccacg 4740

acgcctacct gaacgccgtc gtgggaaccg ccctgatcaa aaagtaccct aagctggaaa 4800

gcgagttcgt gtacggcgac tacaaggtgt acgacgtgcg gaagatgatc gccaagagcg 4860

agcaggaaat cggcaaggct accgccaagt acttcttcta cagcaacatc atgaactttt 4920

tcaagaccga gattaccctg gccaacggcg agatccggaa gcggcctctg atcgagacaa 4980

acggcgaaac cggggagatc gtgtgggata agggccggga ttttgccacc gtgcggaaag 5040

tgctgagcat gccccaagtg aatatcgtga aaaagaccga ggtgcagaca ggcggcttca 5100

gcaaagagtc tatcctgccc aagaggaaca gcgataagct gatcgccaga aagaaggact 5160

gggaccctaa gaagtacggc ggcttcgaca gccccaccgt ggcctattct gtgctggtgg 5220

tggccaaagt ggaaaagggc aagtccaaga aactgaagag tgtgaaagag ctgctgggga 5280

tcaccatcat ggaaagaagc agcttcgaga agaatcccat cgactttctg gaagccaagg 5340

gctacaaaga agtgaaaaag gacctgatca tcaagctgcc taagtactcc ctgttcgagc 5400

tggaaaacgg ccggaagaga atgctggcct ctgccggcga actgcagaag ggaaacgaac 5460

tggccctgcc ctccaaatat gtgaacttcc tgtacctggc cagccactat gagaagctga 5520

agggctcccc cgaggataat gagcagaaac agctgtttgt ggaacagcac aagcactacc 5580

tggacgagat catcgagcag atcagcgagt tctccaagag agtgatcctg gccgacgcta 5640

atctggacaa agtgctgtcc gcctacaaca agcaccggga taagcccatc agagagcagg 5700

ccgagaatat catccacctg tttaccctga ccaatctggg agcccctgcc gccttcaagt 5760

actttgacac caccatcgac cggaagaggt acaccagcac caaagaggtg ctggacgcca 5820

ccctgatcca ccagagcatc accggcctgt acgagacacg gatcgacctg tctcagctgg 5880

gaggcgacaa aaggccggcg gccacgaaaa aggccggcca ggcaaaaaag aaaaagtaag 5940

aattcctaga gctcgctgat cagcctcgac tgtgccttct agttgccagc catctgttgt 6000

ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc actcccactg tcctttccta 6060

ataaaatgag gaaattgcat cgcattgtct gagtaggtgt cattctattc tggggggtgg 6120

ggtggggcag gacagcaagg gggaggattg ggaagagaat agcaggcatg ctggggagcg 6180

gccgcaggaa cccctagtga tggagttggc cactccctct ctgcgcgctc gctcgctcac 6240

tgaggccggg cgaccaaagg tcgcccgacg cccgggcttt gcccgggcgg cctcagtgag 6300

cgagcgagcg cgcagctgcc tgcaggggcg cctgatgcgg tattttctcc ttacgcatct 6360

gtgcggtatt tcacaccgca tacgtcaaag caaccatagt acgcgccctg tagcggcgca 6420

ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta 6480

gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg ctttccccgt 6540

caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg gcacctcgac 6600

cccaaaaaac ttgatttggg tgatggttca cgtagtgggc catcgccctg atagacggtt 6660

tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt ccaaactgga 6720

acaacactca accctatctc gggctattct tttgatttat aagggatttt gccgatttcg 6780

gcctattggt taaaaaatga gctgatttaa caaaaattta acgcgaattt taacaaaata 6840

ttaacgttta caattttatg gtgcactctc agtacaatct gctctgatgc cgcatagtta 6900

agccagcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg 6960

gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca 7020

ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt tttataggtt 7080

aatgtcatga taataatggt ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc 7140

ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa 7200

taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc 7260

cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa 7320

acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa 7380

ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg 7440

atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa 7500

gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc 7560

acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc 7620

atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta 7680

accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag 7740

ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca 7800

acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca acaattaata 7860

gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc 7920

tggtttattg ctgataaatc tggagccggt gagcgtggaa gccgcggtat cattgcagca 7980

ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca 8040

actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg 8100

taactgtcag accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa 8160

tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt 8220

gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat 8280

cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg 8340

gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga 8400

gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac 8460

tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt 8520

ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag 8580

cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc 8640

gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag 8700

gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca 8760

gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt 8820

cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc 8880

tttttacggt tcctggcctt ttgctggcct tttgctcaca tgt 8923

<210> 2

<211> 3445

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacacca gccccagcaa gagcacaagg ttttagagct agaaatagca agttaaaata 300

aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt tgttttagag 360

ctagaaatag caagttaaaa taaggctagt ccgtttttag cgcgtgcgcc aattctgcag 420

acaaatcctc tttctttgca gcaatgcctc ctgcaccacc aactgcttag cacccctggc 480

caaggtcatc catgacaact ttggtatcgt ggaaggactc atggtatgag agctggggaa 540

tgggactgag gctcccacct ttctcatcca agactggctc ctccctgccg gggctgcgtg 600

caaccctggg gttgggggtt ctggggactg gctttcccat aatttccttt caaggtgggg 660

agggaggtag aggggtgatg tggggagtac gctgcagggc ctcactcctt ttgcagacca 720

cagtccatgc catcactgcc acccagaaga ctgtggatgg cccctccggg aaactgtggc 780

gtgatggccg cggggctctc cagaacatca tccctgcctc tactggcgct gccaaggctg 840

tgggcaaggt catccctgag ctgaacggga agctcactgg catggccttc cgtgtcccca 900

ctgccaacgt gtcagtggtg gacctgacct gccgtctaga aaaacctgcc aaatatgatg 960

acatcaagaa ggtggtgaag caggcgtcgg agggccccct caagggcatc ctgggctaca 1020

ctgagcacca ggtggtctcc tctgacttca acagcgacac ccactcctcc acctttgacg 1080

ctggggctgg cattgccctc aacgaccact ttgtcaagct catttcctgg tatgtggctg 1140

gggccagaga ctggctctta aaaagtgcag ggtctggcgc cctctggtgg ctggctcaga 1200

aaaagggccc tgacaactct tttcatcttc taggtatgac aacgaatttg gctacagcaa 1260

cagggtggtg gacctcatgg cccacatggc ctccaaggag gccactaact tctccctgtt 1320

gaaacaagca ggggatgtcg aagagaatcc cgggccaatg gtatcaaagg gcgaagagct 1380

attcacagga gtagtaccaa ttctagtaga actagacgga gacgtaaacg gacacaaatt 1440

ctcagtacga ggagaaggag aaggagacgc aacaaacgga aagctcaccc taaagtttat 1500

ctgcacaaca ggaaagctcc cggttccttg gccaacacta gtaacaacat tcggatatgg 1560

agtagcatgc ttctcacgat atccagacca catgaaacaa cacgacttct tcaaatcagc 1620

aatgccagaa ggatatgtac aagaacgaac aatttcattc aaagacgacg gaacatataa 1680

gactagagca gaagtaaagt ttgagggaga cacactagta aaccgaattg aactaaaggg 1740

catcgacttc aaagaagacg gaaacattct aggacacaaa ctagaatata acttcaactc 1800

acacaacgta tatattacag cagacaaaca gaagaatggt attaaagcaa acttcaagat 1860

ccgtcacaac gtagaagacg gatcagtaca actagcagac cactatcaac agaatacgcc 1920

aattggagac ggaccagtac tactaccaga caaccactat ctatcacacc aatcagcact 1980

atcaaaggat cccaacgaga agcgtgatca catggtacta ctagaattcg taacagcagc 2040

aggaggatca taaccctgcc acactcagtc ccccaccaca ctgaatctcc cctcctcaca 2100

gttgccatgt agaccccttg aagaggggag gggcctaggg agccgcacct tgtcatgtac 2160

catcaataaa gtaccctgtg ctcaaccagt tacttgtcct gtcttattct agggtctggg 2220

gcagagggga gggaagctgg gcttgtgtca aggtgagaca ttcttgctgg ggagggacct 2280

ggtatgttct cctcagactg agggtagggc ctccaaacag ccttgcttgc ttcgagaacc 2340

atttgcttcc cgctcagacg tcttgagtgc tacaggaagc tggcaccact acttcagaga 2400

acaaggcctt ttcctctcct cgctccagtc ctaggctatc tgctgttggc caaacatgga 2460

agaagctatt ctgtgggcag ccccagggag gctgacaggt ggaggaagtc agggctcgca 2520

ctgggctctg acgctgactg gttagtggag ctcagcctgg agctgagctg cagcgggcaa 2580

ttccagcttg gcctccgcag ctgtgaggtc ttgagcacgt gctctattgc tttctgtgcc 2640

ctcgtgtctt atctgaggac atcgtggcca gcccctaagg tcttcaagca ggattcatct 2700

aggtaaacca agtacctaaa accatgccca aggcggtaag gactatataa tgtttaaaaa 2760

tcggtaaaaa tgcccacctc gcatagtttt gaggaagatg aactgagatg tgtcagggtg 2820

acttatttcc atcatcgtcc ttaggggaac ttgggtaggg gcaaggcgtg tagctgggac 2880

ctaggtccag acccctggct ctgccactga acggctcagt tgctttgggc agttactccc 2940

gggcctcact ttgcacgtgt gcttacctag tggagacaaa agtacatacc tcggtagagc 3000

gcgcacgcct gtaaccccag agggcctatt tcccatgatt ccttcatatt tgcatatacg 3060

atacaaggct gttagagaga taattggaat taatttgact gtaaacacaa agatattagt 3120

acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt taaaattatg 3180

ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt tcttggcttt 3240

atatatcttg tggaaaggac gaaacaccag ccccagcaag agcacaaggt tttagagcta 3300

gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg 3360

gtgctttttt gttttagagc tagaaatagc aagttaaaat aaggctagtc cgtttttagc 3420

gcgtgcgcca attctgcaga caaat 3445

<210> 3

<211> 2083

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 60

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 120

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 180

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 240

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 300

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 360

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 420

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 480

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 540

acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 600

ccggtcgcca ccatgggatc cgaccctagc aaagactcaa aagctcaggt gtccgctgcc 660

gaggctggca ttactggaac atggtacaat cagctcggga gcacctttat tgtgactgct 720

ggagccgatg gagccctcac cggaacatac gaatctgctg tgggaaacgc cgaatcacgg 780

tacgtcctca ctggccgata cgatagtgcc cctaccaccg acggatctgg gactgccctg 840

ggatggactg tcgcttggaa aaacaactac cggaatgctc attctgccac aacatggagt 900

ggacagtacg tgggaggcgc tgaggctaga atcaatacac agtggctgct cacatctggc 960

acaaccgagg caaatgcttg gaaatccacc ctggtgggac atgacacatt caccaaagtg 1020

aaaccctccg ccgcttcaat cgatgccgcc aaaaaagccg gagtcaacaa cggcaatcct 1080

ctggatgccg tccagcagaa gcttcccaag aagaagagga aagtctcgag ctgtgagagt 1140

tatctgaccg taaggtgaat tcgtgagcaa gggcgaggag gataacatgg ccatcatcaa 1200

ggagttcatg cgcttcaagg tgcacatgga gggctccgtg aacggccacg agttcgagat 1260

cgagggcgag ggcgagggcc gcccctacga gggcacccag accgccaagc tgaaggtgac 1320

caagggtggc cccctgccct tcgcctggga catcctgtcc cctcagttca tgtacggctc 1380

caaggcctac gtgaagcacc ccgccgacat ccccgactac ttgaagctgt ccttccccga 1440

gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga ccgtgaccca 1500

ggactcctcc ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg gcaccaactt 1560

cccctccgac ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct cctccgagcg 1620

gatgtacccc gaggacggcg ccctgaaggg cgagatcaag cagaggctga agctgaagga 1680

cggcggccac tacgacgctg aggtcaagac cacctacaag gccaagaagc ccgtgcagct 1740

gcccggcgcc tacaacgtca acatcaagtt ggacatcacc tcccacaacg aggactacac 1800

catcgtggaa cagtacgaac gcgccgaggg ccgccactcc accggcggca tggacgagct 1860

gtacaaggtc gacggtaccg cgggcccggg atccaccgga tctagataac tgatcataat 1920

cagccatacc acatttgtag aggttttact tgctttaaaa aacctcccac acctccccct 1980

gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa 2040

tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaa 2083

<210> 4

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gcaaaaaaga aaaagggatc cgaccctagc aaagac 36

<210> 5

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atcagcgagc tctaggaatt cttaaagctt ctgctggacg gcat 44

<210> 6

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

caccgcctta cggtcagata actctcac 28

<210> 7

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

aaacgtgaga gttatctgac cgtaaggc 28

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

caccgagccc cagcaagagc acaag 25

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aaaccttgtg ctcttgctgg ggctc 25

<210> 10

<211> 56

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gaggccctgt gggaggaaga gaagaggtca gaagcttgta aggatgcaag tgaggg 56

<210> 11

<211> 57

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

tcttcctccc acagggcctc gagagatctg gcagcggagc caccatggtg agcaagg 57

<210> 12

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

tgagtgagag ttatctgacc catagagccc accgcatcc 39

<210> 13

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

gggatgcggt gggctctatg ggtcagataa ctctcact 38

<210> 14

<211> 59

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

cgacatcccc tgcttgtttc aacagggaga agttagtggc ctccttggag gccatgtgg 59

<210> 15

<211> 56

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

gaaacaagca ggggatgtcg aagagaatcc cgggccaatg gtgagcaagg gcgagg 56

<210> 16

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

gtgccgcttt ctgtctgc 18

<210> 17

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

ggcttgccaa ggactcaa 18

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

gaggcgcatg ttctccaaaa 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

aacttgtggc cgttcacgtc 20

<210> 20

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

taaatgcact gttgggccta t 21

<210> 21

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

gtgccgcttt ctgtctgcga gggcctattt cccatgat 38

<210> 22

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

gcaagtcagg ggagcgtgtc atttgtctgc agaattggcg 40

<210> 23

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

cgccaattct gcagacaaat gacacgctcc cctgacttgc 40

<210> 24

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

atcatgggaa ataggccctc ctggggttac aggcgtgcg 39

<210> 25

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

cgcacgcctg taaccccagg agggcctatt tcccatgat 39

<210> 26

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

ggcttgccaa ggactcaaat ttgtctgcag aattggcg 38

Claims (7)

1. A method for improving homologous recombination efficiency based on a CRISPR gene editing system, comprising introducing into a host cell a Cas9 plasmid fused with streptavidin and a corresponding homologous donor having biotin modification containing sgRNA;

also included is introducing a NHEJ fluorescent reporter plasmid into the host cell;

the NHEJ fluorescence reporter plasmid is pCMV-SA-mCherry-NHEJ;

construction of the NHEJ fluorescence reporter plasmid: EGFP in pCMV-EGFP-mCherry is replaced by streptavidin monomer SA, then the sgRNA target sequence containing PAM sequence is integrated between pCMV-SA-mCherry by means of annealing connection, mCherry does not express first, only after the sgRNA cuts the target sequence, frame shift mutation occurs, mCherry reads correctly, and then red light is emitted.

2. The method of claim 1, wherein the streptavidin-fused Cas9 plasmid is pX330-SA-hspCas9 or pX330-hspCas9-SA and the corresponding homologous donor with biotin modification comprising sgRNA is Bio-sgRNA-EGFP-donor.

3. The method of claim 1, wherein the host cell comprises a porcine PK-15 cell, a human K562 cell, a human 293T cell.

4. A genome editing system comprising the streptavidin-fused Cas9 plasmid of claim 1 and a corresponding homologous donor having biotin modifications comprising sgRNA; also included is the NHEJ fluorescence reporter plasmid of claim 1.

5. The genome editing system of claim 4 further comprising a polynucleotide sequence encoding a sequence manipulation system that is a CRISPR/Cas system.

6. A method of effecting genome editing comprising expressing the genome editing system of claim 4 or 5 in an organism.

7. Use of the genome editing system of claim 4 or 5 to increase the efficiency of homologous recombination.