CN114672504A - Preparation method and application of Cas9-RNAi RNP with efficient homologous directional repair activity - Google Patents

Abstract

The invention discloses a preparation method of Cas9-RNAi RNP with efficient homologous directional repair activity, wherein a key protein Ligase 4 of an NHEJ pathway is selected to be transiently inhibited, the 3' end of gRNA of Cas9RNP is prolonged to construct a similar structure of shRNA, and the Cas-RNAi RNP carrying specific sgRNA-shRNA is obtained by using a technology of expressing the Cas9RNP by using an escherichia coli cell one-step method. The Cas-RNAi RNP realizes the functional combination of gene editing and RNA interference, and designs shRNA base sequence aiming at the Ligase 4 gene so as to temporarily inhibit an NHEJ pathway, thereby realizing high-efficiency HDR repair.

Description

Preparation method and application of Cas9-RNAi RNP with efficient homologous directional repair activity

Technical Field

The invention relates to a preparation method and application of Cas9-RNAi RNP with efficient homologous directional repair activity, and belongs to the field of recombinant proteins.

Background

The CRISPR system is derived from the acquired immune system of bacteria and archaea, and is capable of targeted cleavage of re-invading foreign genetic material under the guidance of crRNA. Inspired by this process, researchers developed a genome editing technology named CRISPR/Cas 9. The main components of the system are Cas9 protein and single-stranded guide RNA (sgRNA), Cas9 protein reaches a target gene under the guiding action of base complementary pairing of the sgRNA and a specific gene sequence, and Double Strand Break (DSB) is caused by DNA cleavage through HNH and RuvC domains. In mammalian cells, the two major pathways for repairing such DSBs are non-homologous end joining (NHEJ), which predominates for the generation of insertion or deletion mutations, and homologous-directed repair (HDR), which is a repair with very low frequency of precise repair in terms of template DNA. Due to high efficiency and easy operability, the CRISPR/Cas9 system is widely applied to function research, disease diagnosis, disease model establishment and gene therapy, brings great convenience to basic research in multiple subject fields, and provides a way for clinical treatment of gene diseases.

The CRISPR/Cas9 system is a powerful gene editing tool, but if the Double Strand Break (DSB) introduced by the CRISPR/Cas9 system is not repaired timely and accurately, the effect of gene therapy is affected, and the stability of the genome is seriously damaged, so that the consequences such as chromosome rearrangement, development disorder, cell canceration and the like are caused. Among mammalian cells, DBS repair is primarily undertaken by two major competing and complementing repair pathways, NHEJ and HDR. Due to high levels of protein abundance and kinetics, NHEJ dominates almost the entire cell cycle, and is responsible for maintaining genome stability. NHEJ often introduces uncontrolled mutations by inserting or deleting portions of the nucleotides to form microhomologous ends. And (3) carrying out multi-step reaction on the homologous template needing to be repaired in HDR through homologous arm mediated strand displacement reaction to finally obtain an accurate repairing result consistent with the template. By using the HDR repair pathway, we can insert specific fragments or precisely modify single bases on the genome by editing techniques such as CRISPR, but the HDR efficiency is very low in practical application. Inhibition of the NHEJ pathway has been shown to be one way to improve HDR efficiency. As the most central Ligase of NHEJ pathway, Ligase 4 has been studied for a number of times to show that inhibition of the function of Ligase 4 can significantly improve HDR efficiency. However, the inhibition of the NHEJ pathway in the whole cell range or continuously causes the cell to fail to repair other DNA damage in time, which results in the ectopic rearrangement of chromatin, the death of cell cancer and the like. Therefore, the improvement of HDR repair efficiency after CRISPR gene editing is a difficult problem to be solved urgently at present.

Furthermore, CRISPR/Cas9 gene editing currently relies primarily on viral packaging, plasmid transfection, or mRNA delivery means to deliver and continue expression of the Cas9 gene to the body. Compared with DNA/RNA-based delivery technology, the delivery of therapeutic ribonucleoprotein complexes (RNPs) into the body for gene editing reduces the potential toxicity of the protein and the risk of gene integration, thus greatly improving the safety of gene therapy. The invention aims to establish a method for preparing a CRISPR/Cas9 nucleic acid protein complex with high safety and high HDR gene editing efficiency.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to obtain a preparation method and application of Cas9-RNAi RNP with efficient homologous directional repair activity.

In order to realize one of the above purposes, the technical scheme of the preparation method of the Cas9-RNAi RNP with efficient homologous directional repair activity adopted by the invention is as follows:

the preparation method comprises the following steps:

a) constructing an expression plasmid of Cas9-RNAi RNP;

b) transforming the expression plasmid formed in the step a) into an expression strain, and inducing expression;

c) splitting the thallus collected in the step b), and purifying by one step to obtain Cas9-RNAi RNP extended from the 3' end of the gRNA.

Preferably, the Cas9-RNAi RNP expression plasmid is obtained by modifying Ptac-Cas9-T7-sgRNA as a vector framework, and is characterized in that the Cas9 protein and the gRNA-shRNA can complete self-assembly in escherichia coli cells and can rapidly prepare stable Cas9-RNAi RNP by a one-step method.

Preferably, the step a) is specifically as follows:

the 3' end of the gRNA is prolonged, an shRNA sequence is introduced to form an sgRNA-shRNA structure, the sgRNA-shRNA structure and the Cas9 protein are constructed on the same plasmid, and the stable Cas9-RNAi RNP is formed by self-assembly in an escherichia coli cell.

Preferably, SalI enzyme cutting sites are arranged at two ends of the sgRNA-shRNA, so that different targeting sequences can be conveniently replaced. Linker and Drosha recognition sites were designed between the sgRNA and shRNA in order to release the shRNA by cleavage of the Drosha protein.

Preferably, the expression strain of step b) is RNase III deficient E.coli HT 115.

Further preferably, the step b) is specifically:

cas9-RNAi RNP expression plasmid containing the sgRNA-shRNA structure needs to be transformed into RNase III-deficient Escherichia coli HT115 DE3, and then double-resistance labeling screening is carried out on target colonies according to tetracycline resistance and plasmid resistance of the Escherichia coli.

The preparation method also comprises a verification step of Cas9-RNAi RNP, and specifically comprises the following steps:

i. In vitro enzyme digestion experiments verify the in vitro activity of the Cas9-RNAi RNP;

detecting the integrity of sgRNA-shRNA in the purified Cas9-RNAi RNP;

transfecting Cas9-RNAi RNP into HEK293T cell line by lipofectin, testing the interfering effect on the target gene, and HDR efficiency of genome editing.

Preferably, the HEK293T cell line is a human embryonic kidney cell 293T cell overexpressing blue fluorescent protein BFP.

Preferably, step iii is specifically:

transfecting Cas9 RNP into HEK293T cell line, detecting interference effects and HDR efficiency of genome editing;

cas9-RNAi RNP was transfected into HEK293T cell line and the interference effect and HDR efficiency of genome editing were examined.

Preferably, Cas9 gene editing targets the BFP gene, both of which provide an exogenous single-stranded DNA donor upon transfection, under which conditions HDR repair can convert BFP-expressing cells to Green Fluorescent Protein (GFP) -expressing cells.

Preferably, both the artificially synthesized siRNA and the shRNA in Cas9-RNAi RNP target Ligase 4, a key protein of the NHEJ pathway.

The invention also discloses an application of the shRNA obtained by the preparation method, and the shRNA sequence is used for temporarily inhibiting the NHEJ pathway, so that the high-efficiency HDR repair is realized.

The invention selects to transiently inhibit the key protein Ligase 4 of the NHEJ pathway. The 3' end of the gRNA of the Cas9 RNP is extended to construct a similar structure of shRNA, and a Cas9 RNP technology is expressed by using an escherichia coli cell one-step method, so that the Cas-RNAi RNP carrying the specific sgRNA-shRNA is obtained. Cas-RNAi RNP achieves functional combination of gene editing and RNA interference. The shRNA base sequence aiming at the Ligase 4 gene is designed to temporarily inhibit the NHEJ pathway, so that the high-efficiency HDR repair is realized.

Compared with the prior art, the invention can produce the following beneficial effects:

1. cas9-RNAi RNP designed by the invention is self-assembled in Escherichia coli HT115 strains, and can be purified to a large amount of RNPs with good activity by a one-step method, and no RNase inhibitor is required to be added in the whole process, so that the preparation time of RNP is shortened from three days to one day, and the cost is reduced by more than 10 times.

2. The sgRNA-shRNA can be processed into siRNA by Drosha and Dicer proteins after being transferred to mammalian cells, so that multidimensional genome operation can be performed, and target genes can be edited and knocked down.

3. In the embodiment of the invention, a specific shRNA sequence aiming at the Ligase 4 gene is introduced at the 3' end of the gRNA, so that the Homology Directed Repair (HDR) efficiency can be effectively improved.

Gene perturbation methods such as RNAi and CRISPR/Cas9 technologies have been developed as powerful tools to understand specific gene functions and cure genetic diseases. The invention provides a Cas9 RNP tool kit with powerful functions for genome engineering and gene function analysis.

Drawings

FIG. 1 is a schematic diagram of Cas9-RNAi RNP expression plasmid constructed in an example provided by the present invention;

FIG. 2 shows the preparation and purification of Cas9-RNAi RNP and its activity verification. (a) Performing nickel column affinity purification; (b) detecting the in vitro activity;

FIG. 3 is a 8% Urea/TBE polyacrylamide gel electrophoresis assay for integrity of sgRNA-shRNA in RNP;

FIG. 4 is a schematic diagram of the mechanism by which Cas9-RNAi RNP transfection into cells acts;

FIG. 5 is a measurement of the relative expression level of the intracellular Ligase 4 gene;

FIG. 6 HDR efficiency test of Cas9-RNAi RNP genome editing. (a) Cas9-RNAi RNP-mediated HDR repair fluorescence microscopy images; (b) results of sequencing analysis of Cas9-RNAi RNP-mediated HDR repair.

Detailed Description

The preparation method and application of the Cas9-RNAi RNP with efficient homologous directional repair activity provided by the invention are further detailed and completely described in the following by combining the embodiment. The following examples are illustrative only and are not to be construed as limiting the invention.

The experimental procedures in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were all commercially available unless otherwise specified.

The embodiment of the invention relates to the following main materials: the plasmid clone strain is Escherichia coli XL10-Gold, the protein expression strain is Escherichia coli HT115 DE3, Ptac-cas9-T7sgRNA plasmid, Pfu DNApolymerase, Phanta Super-Fidelity DNApolymerase, Proteinase K, T5 exonuclease, restriction endonuclease (NEB company) and human embryonic kidney cell 293T cell line over-expressing Blue Fluorescent Protein (BFP), and the above materials are all stored in the laboratory.

The reagents and buffers involved in the embodiments of the present invention are as follows: cas9 protein lysis Buffer (Tris-HCl 20mM pH 8.0, NaCl 500mM, TCEP 0.5mM), Cas9 protein elution Buffer (Tris-HCl 20mM pH 8.0, NaCl 250mM, TCEP 0.5mM), Cas9 protein storage Buffer (Tris-HCl 20mM pH 8.0, NaCl 150mM, TCEP 1mM, 10% glycerol), imidazole Buffer (20-500mM concentration gradient), 3.110 XBuffer (NEB company), primers purchased from Shanghai bioengineering Co., Ltd.

Example 1 construction of Cas9-RNAi RNP expression plasmid

1. The Ptac-cas9-T7sgRNA plasmid preserved in the laboratory is used as a vector framework, and is cut by restriction enzyme SalI. The SpCas9 gene sequence already exists on the plasmid, and only the sgRNA-shRNA sequence needs to be connected behind the SalI enzyme cutting site.

2. Designing sgRNA-shRNA sequences of a target BFP gene and an interference Ligase 4 gene, wherein the total length is 210 nt. 5 pairs of primers are synthesized, and sgRNA-shRNA fragments are constructed by annealing of homologous arms and then are subjected to PCR amplification. When the sgRNA sequence and the shRNA sequence are replaced, only 2 pairs of primers need to be redesigned, and the other 3 pairs of primers are kept unchanged. In the overlap PCR, the primers except the head and tail primers are mixed and diluted 10 times, the number of cycles of the overlap PCR is about 10, and the head and tail primers are used as templates to perform PCR amplification of a target DNA fragment, and the number of cycles is about 15.

The primer design was as follows (5'→ 3'):

F-1(SEQ ID NO:1)：GTACTGAGAGTGCACCATAGTAATACGACTCACTATAGG

R-2(SEQ ID NO:2)：

ACGGCGTGCAGTGCTTCAGCCCTATAGTGAGTCGTATTACTATGGTGC

F-3(SEQ ID NO:3)：

GCTGAAGCACTGCACGCCGTGTTTTAGAGCTAGAAATAGCAAGTTAAAA

newR-4(SEQ ID NO:4)：

CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT

newF-5(SEQ ID NO:5)：

GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTCCGACTCGA

newR-6(SEQ ID NO:6)：

TCTCTTGAACATACGTTCACCATCTAGCTGCCTACTGCTCGAGTCGG

AAAGCACCG

LIG4F-7(SEQ ID NO:7)：

TGGTGAACGTATGTTCAAGAGACATACGTTCACCATCTAGCTTTTT

TCTAGCATA

LIG4R-8(SEQ ID NO:8)：

GACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGAAAAAA

LIG4F-9(SEQ ID NO:9)：

CTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGACTA

LIG4R-10(SEQ ID NO:10)：

TCACACCGCATACGTCAAAGCAACCATAGTCCAAAAAACCCC

overlapping PCR reaction system

3. And (3) carrying out homologous end digestion on the annealed bridging fragment and the linear fragment of the Ptac-cas9-T7sgRNA plasmid for 5min in an ice water bath by using T5 exonuclease, carrying out conventional transformation on a product to obtain an escherichia coli Gold competent cell, and selecting a single colony for sequencing detection.

Example 2Cas 9-expression purification and Activity test ex vivo of RNAi RNP

As shown in figure 1, Cas9-RNAi RNP expression plasmid constructed in example 1 is transformed into Escherichia coli expression strain HT115 DE3 competent cell, and ampicillin and tetracycline double-antibody screening is adopted to obtain the target expression strain. Inoculating the strain into a liquid culture medium containing the double antibody, culturing overnight in a shaker at 37 ℃ and 220rpm, transferring to 1L of liquid culture medium containing the corresponding antibiotic according to a ratio of 1:100, and culturing at 37 ℃ and 220rpm until OD600 is 0.6-0.8. Adding IPTG with the final concentration of 1mM, and transferring the mixture to a shaking table at 220rpm at 18 ℃ for induction for 16-18 hours. After induction is finished, thalli are collected and broken, a large amount of Cas9-RNAi RNP is rapidly prepared by a Ni bead affinity purification one-step method, and SDS-PAGE electrophoretic analysis is carried out. The purification result is shown in FIG. 2(a), the size of the SpCas9 protein is 167kDa, and the eluted proteins at 300, 400 and 500mM are very pure, so the eluates of several gradients are collected, concentrated, ultrafiltered and stored at-80 ℃ after liquid exchange for later use.

For in vitro endonuclease activity assays, Cas RNP purified from e.coli was used directly to digest plasmids containing the target dsDNA sequences. An in vitro cleavage experiment was performed with reference to the NEB official website information, and 0.1pmol of the target DNA, 1.2pmol of Cas9-RNAi RNP, 1. mu.L of NEB Buffer 3.1 and a suitable amount of sterile water were added to complete the system, taking 10. mu.L as an example. The reaction was carried out at 37 ℃ for 30min, then at 80 ℃ for 10min for inactivation, and agarose gel electrophoresis was carried out to detect the cleavage activity of RNP, the results are shown in FIG. 2 (b). It is believed that 1.2pmol Cas9 RNP completely cleaves 0.1pmol plasmid at 37 ℃ for 30min, and that this RNP can be used in gene editing experiments in cells. Therefore, the RNP has good activity of cleaving the target DNA site.

Example 3 detection of integrity of sgRNA-shRNA in Cas9-RNAi RNP

In order to determine whether the protein obtained in example 2 contains intact sgRNA-shRNA, the purified Cas9-RNAi RNP was treated with proteinase K, and the result of polyacrylamide gel nucleic acid electrophoresis was shown in fig. 3. The theoretical size of the sgRNA-shRNA is about 210nt, and the electrophoresis result is consistent with the expected result.

The result of the embodiment shows that the constructed Cas9-RNAi RNP expression plasmid is transformed into Escherichia coli HT115(DE3) to be correctly expressed, and SpCas9 RNP which is self-assembled in the Escherichia coli and contains a sgRNA-shRNA structure can be further obtained through Ni bead affinity purification.

Example 4RT-qPCR analysis of silencing Effect of shRNA on target Gene

When HEK 293T cells expressing BFP protein are transfected, cells transfected by adding Cas9 protein (without sgRNA), NC siRNA or LIG4 siRNA are used as a control, experimental groups are sgBFP RNP (which refers to RNP containing sgRNA targeting BFP), sgBFP-shLIG4 RNP (which refers to RNP containing sgRNA targeting BFP and sgRNA-shRNA targeting shRNA Ligase 4) and sgBFP RNP plus LIG4 siRNA, and each experimental group provides an exogenously synthesized single-stranded DNA donor. The mechanism of action of transfection of Cas9-RNAi RNP into cells is schematically shown in FIG. 4. The components are transfected into HEK 293T cells through Lipofectamine CRISPMA, the cells are placed into an incubator containing 5% carbon dioxide at 37 ℃ to be incubated for 4-5 hours, then the cells are replaced by a fresh complete culture medium, and the cells are continuously cultured for 48 hours.

The cells fluorescing green were initially observed under the fluorescence microscope in example 5. The cells were divided into two parts, one part was extracted for total RNA, a certain amount of RNA was reverse-transcribed into cDNA after RNA concentration was determined, and RT-qPCR analysis was performed to compare the levels of the Ligase 4 gene mRNA in these groups of transfected cells, the results are shown in FIG. 5. The mRNA level of the intracellular Ligase 4 gene is reduced by about fifty percent after being transfected into RNP carrying shLIG4, which shows that the Cas9-RNAi RNP basically realizes the knocking-down effect similar to that of the siRNA method.

Example 5Cas 9-HDR efficiency detection for RNAi RNP genome editing

The HEK293T cell line of the human embryonic kidney cell expressing Blue Fluorescent Protein (BFP) constructed in the laboratory is used as a report cell line, and the 67 th CAT (His) is changed into TAC (Tyr), so that the BFP can be converted into GFP. Based on the result, ssDNA repair templates are designed and synthesized, and have the sequence (SEQ ID NO: 11):

GTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTACGTCAGGGTGGTCACGAGGGTGGGCCAGGGCACG

upon delivery of Cas9 RNP and ssDNA donors into cells, BFP-HEK293 cells will be converted to GFP expressing HEK293 cells once correct gene repair has occurred, and therefore the efficiency of HDR can be calculated from the number of GFP cells/total number of cells. FIG. 6(a) shows the results of fluorescence microscope observation.

Another part of the cells are collected, subjected to genome extraction, and then recovered from the fragment gel near the target site amplified on the genome, and sent to Shanghai for sequencing. The sequencing results were analyzed, and the results are shown in FIG. 6 (b). In conclusion, compared with the wild-type Cas9 RNP alone, the design of Cas9-RNAi RNP in the present invention can effectively improve HDR efficiency, and in this example, the HDR efficiency of gene editing at an exogenous gene in HEK 293T cells can be improved by 24%.

Finally, it is necessary to explain here: the above embodiments are only used for further elaborating the technical solutions of the present invention, and should not be understood as limiting the scope of the present invention, and the insubstantial modifications and adaptations made by those skilled in the art based on the above descriptions of the present invention are within the scope of the present invention.

Sequence listing

<110> Wuhan Bonwo Biotechnology Co., Ltd

<120> preparation method and application of Cas9-RNAi RNP with efficient homologous directional repair activity

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtactgagag tgcaccatag taatacgact cactatagg 39

<210> 2

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acggcgtgca gtgcttcagc cctatagtga gtcgtattac tatggtgc 48

<210> 3

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctgaagcac tgcacgccgt gttttagagc tagaaatagc aagttaaaa 49

<210> 4

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctttttcaag ttgataacgg actagcctta ttttaacttg ctatttct 48

<210> 5

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gttatcaact tgaaaaagtg gcaccgagtc ggtgctttcc gactcga 47

<210> 6

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tctcttgaac atacgttcac catctagctg cctactgctc gagtcggaaa gcaccg 56

<210> 7

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tggtgaacgt atgttcaaga gacatacgtt caccatctag cttttttcta gcata 55

<210> 8

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gacccgttta gaggccccaa ggggttatgc tagaaaaaa 39

<210> 9

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cttggggcct ctaaacgggt cttgaggggt tttttggact a 41

<210> 10

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcacaccgca tacgtcaaag caaccatagt ccaaaaaacc cc 42

<210> 11

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gtggtcgggg tagcggctga agcactgcac gccgtacgtc agggtggtca cgagggtggg 60

ccagggcacg 70

Claims (9)

1. A preparation method of Cas9-RNAi RNP with efficient homologous directional repair activity is characterized by comprising the following steps:

a) constructing an expression plasmid of Cas9-RNAi RNP;

b) transforming the expression plasmid formed in the step a) into an expression strain, and inducing expression;

c) cracking the thallus collected in the step b), and purifying by one step to obtain Cas9-RNAiRNP carrying 3' end extended gRNA.

2. The preparation method according to claim 1, wherein the step a) is specifically:

the 3' end of the gRNA is prolonged, an shRNA sequence is introduced to form an sgRNA-shRNA structure, the sgRNA-shRNA structure and the Cas9 protein are constructed on the same plasmid, and the stable Cas9-RNAi RNP is formed by self-assembly in an escherichia coli cell.

3. The preparation method of claim 2, wherein the sgRNA-shRNA has SalI cleavage sites at both ends, and Linker and Drosha recognition sites are designed between the sgRNA and the shRNA.

4. The method according to claim 1, wherein the expression strain of step b) is RNase III-deficient E.coli HT 115.

5. The preparation method according to claim 1, wherein the step b) is specifically:

cas9-RNAi RNP expression plasmid containing sgRNA-shRNA structure needs to be transformed into RNase III deficient Escherichia coli HT115 DE3, and then double resistance marking selection of target colonies is carried out according to tetracycline resistance and plasmid resistance of Escherichia coli.

6. The preparation method of claim 1, further comprising the step of verifying Cas9-RNAi RNP, specifically:

i. in vitro enzyme digestion experiments verify the in vitro activity of the Cas9-RNAi RNP;

detecting the integrity of the sgRNA-shRNA in the purified Cas9-RNAi RNP;

transfecting Cas9-RNAi RNP into HEK293T cell line by lipofectin, testing the interfering effect on the target gene, and HDR efficiency of genome editing.

7. The method of claim 6, wherein the HEK293T cell line is a human embryonic kidney cell 293T cell that overexpresses the blue fluorescent protein BFP.

8. The method according to claim 6, wherein step iii is specifically:

Cas9 RNP was transfected into HEK293T cell line to detect interference effects and HDR efficiency of genome editing;

cas9-RNAi RNPs were transfected into HEK293T cell line and tested for interference effects and HDR efficiency of genome editing.

9. Application of Cas9-RNAi RNP obtained by the preparation method according to any one of claims 1-8, wherein the Cas9-RNAi RNP sequence is used for temporarily inhibiting an NHEJ pathway, so that efficient HDR repair is realized.

Images