CN111363036A

CN111363036A - Recombinant antibody of anti-heart fatty acid binding protein

Info

Publication number: CN111363036A
Application number: CN201811594226.3A
Authority: CN
Inventors: 孟媛; 钟冬梅; 谢剑坤; 游辉; 范凌云
Original assignee: Dongguan Pengzhi Biotechnology Co Ltd
Current assignee: Dongguan Pengzhi Biotechnology Co Ltd
Priority date: 2018-12-25
Filing date: 2018-12-25
Publication date: 2020-07-03
Anticipated expiration: 2038-12-25
Also published as: CN111363036B

Abstract

The invention relates to a novel isolated binding protein containing an H-FABP antigen binding domain, and researches on the aspects of preparation, application and the like of the binding protein. The binding protein has strong activity and high affinity with human H-FABP protein, and can be widely applied to the field of detection of H-FABP protein.

Description

Recombinant antibody of anti-heart fatty acid binding protein

Technical Field

The invention relates to the technical field of immunity, in particular to a recombinant antibody for resisting heart-type fatty acid binding protein.

Background

Fatty Acid Binding Proteins (FABPs) are a group of multi-derived small molecule proteins, mainly present in tissues capable of taking and utilizing fatty acids, and are classified into nine types, i.e., heart type (H), liver type (L), and fat type (a), according to their tissue specificities. The Heart-type Fatty Acid-binding protein (H-FABP) is mainly distributed in myocardial cells, exists in myocardial cytoplasm, is a soluble protein consisting of 132 amino acids, has the molecular weight of 15kDa, accounts for about 4-8% of all soluble proteins of the Heart, is mainly involved in myocardial energy metabolism regulation and control, and has high specificity on the myocardial cells due to morphological and immunological differences. The diagnosis sensitivity to myocardial damage is high, the myocardial damage can be sensitively reflected, after myocardial ischemic injury appears, H-FABP can be found in blood within 1 to 3 hours of attack, the peak value is reached within 6 to 8 hours, and the plasma level is recovered to be normal within 24 to 30 hours.

The molecular weight is small, the specificity is good, the rapid release can be realized during myocardial damage and ischemia, the detection is considered to be expected to become a detection index for early diagnosis of Acute Coronary Syndrome (ACS), and is one of the best detection indexes for Acute Myocardial Infarction (AMI), and the detection of abnormal change of a myocardial marker is a necessary condition for diagnosing AMI. The traditional myocardial injury markers comprise myoglobin (Mb), serum creatine kinase isoenzyme B (CKMB), myocardial troponin (cTnI) and the like, but compared with H-FABP, Mb has poor specificity, CKMB and cTnI are released slowly when the myocardium is injured, and both the markers have limitations on early diagnosis of AMI. Therefore, the H-FABP has wide application in the aspects of early diagnosis of AMI, prediction of relapse of AMI, prediction of AMI area, monitoring of success of reperfusion after AMI, assessment of prognosis of heart failure and the like, and can improve diagnostic sensitivity by being combined with troponin for detection, thereby having more diagnostic value on AMI.

At present, the monoclonal antibody for detecting FABP in China has defects in sensitivity and specificity and has a larger improvement space.

Disclosure of Invention

The invention relates to a novel isolated binding protein containing an H-FABP antigen binding domain, and researches on the aspects of preparation, application and the like of the binding protein.

The antigen binding domain comprises at least one complementarity determining sequence selected from the group consisting ofA zone; or; has at least 80% sequence identity to the complementarity determining region of the amino acid sequence described below and has K with cardiac fatty acid binding protein_D≤1.028×10^-9Affinity of mol/L;

CDR-VH1 is G-X1-T-F-X2-N-X3-G-M-S, wherein,

x1 is Y or F, X2 is T or S, X3 is Y or F;

CDR-VH2 is I-S-S-X1-G-X2-Y-T-X3-Y-P-D-S-V, wherein,

x1 is G or A, X2 is S or T, X3 is F or Y;

CDR-VH3 is R-X1-D-G-X2-Y-H-F-Y-X3-M-X4-Y, wherein,

x1 is Q or N, X2 is R or K, X3 is S or T, X4 is E or D;

the complementarity determining region CDR-VL1 is S-Q-X1-V-X2-T-X3-V-A, wherein,

x1 is E or D, X2 is G, S or T, X3 is A or P;

the complementarity determining region CDR-VL2 is S-A-X1-Y-X2-Y-T, wherein,

x1 is T or S, X2 is K or R;

the CDR-VL3 is Q-X1-H-X2-N-T-P-X3-T,

wherein X1 is Q or N, X2 is Y or F, and X3 is I, V or L.

An important advantage is that the binding protein is highly active and has a high affinity for the human H-FABP protein.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is an electrophoretogram of a monoclonal antibody against a recombinant antibody against a human cardiac fatty acid binding protein of the present invention.

Detailed Description

The present invention may be understood more readily by reference to the following description of certain embodiments of the invention and the detailed description of the examples included therein.

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such embodiments are necessarily varied. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Noun definitions

"isolated binding protein comprising an antigen binding domain" broadly refers to all proteins/protein fragments that comprise a CDR region. The term "antibody" includes polyclonal and monoclonal antibodies and antigenic compound-binding fragments of these antibodies, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies and minimal recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".

The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region (VL or VH) is composed of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The extent of the framework regions and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of immunological interest), E.Kabat et al, U.S. department of Health and human services (U.S. department of Health and human services), (1983), and Chothia. The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.

As used herein, the "framework" or "FR" regions mean the regions of the antibody variable domain excluding those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3 and FR 4).

Typically, the variable domains VL/VH of the heavy and light chains are obtained by linking the CDRs and FRs numbered as follows in a combinatorial arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR 4.

As used herein, the term "purified" or "isolated" in relation to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its native medium or native form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally bound to or normally mixed with it or in solution. Isolated polypeptides include the naturally-produced polypeptide contained in a cell lysate, the polypeptide in purified or partially purified form, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous host cell or culture. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

Exemplary embodiments of the invention

The present invention relates to an isolated binding protein comprising an antigen binding domain, wherein the antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences set forth in seq id nos; or; has at least 80% sequence identity to the complementarity determining region of the amino acid sequence described below and has K with cardiac fatty acid binding protein_D≤1.028×10^-9Affinity of mol/L;

CDR-VH1 is G-X1-T-F-X2-N-X3-G-M-S, wherein,

x1 is Y or F, X2 is T or S, X3 is Y or F;

CDR-VH2 is I-S-S-X1-G-X2-Y-T-X3-Y-P-D-S-V, wherein,

x1 is G or A, X2 is S or T, X3 is F or Y;

CDR-VH3 is R-X1-D-G-X2-Y-H-F-Y-X3-M-X4-Y, wherein,

x1 is Q or N, X2 is R or K, X3 is S or T, X4 is E or D;

x1 is E or D, X2 is G, S or T, X3 is A or P;

the complementarity determining region CDR-VL2 is S-A-X1-Y-X2-Y-T, wherein,

x1 is T or S, X2 is K or R;

the complementarity determining region CDR-VL3 is Q-X1-H-X2-N-T-P-X3-T, wherein,

x1 is Q or N, X2 is Y or F, and X3 is I, V or L.

In some embodiments, the antigen binding domain has at least 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to a complementarity determining region of an amino acid sequence having K to a cardiac fatty acid binding protein_D≤1.028×10^-9mol/L，K_DThe value may also be selected to be 2 × 10^- ⁸mol/L、1×10^-10mol/L、2×10^-10mol/L、3×10^-10mol/L、4×10^-10mol/L、4.5×10^-10mol/L、5×10^-10mol/L、6×10^-10mol/L、7×10^-10mol/L、8×110^-10mol/L、9×10^-10mol/L、1×10^-11mol/L、3×10^-11mol/L、7×10^-11mol/L、8×10^-11mol/L、9×10^-11mol/L or 1 × 10^-8mol/L；

Or 8.857 × 10^-11mol/L≤K_D≤1.028×10^-9mol/L；

Wherein the affinity is determined according to the method of the present specification.

In some embodiments:

in the complementarity determining region CDR-VH1, X1 is F;

in the complementarity determining region CDR-VH2, X1 is G;

in the complementarity determining region CDR-VH3, X3 is T;

in the complementarity determining region CDR-VL1, X3 is A;

in the complementarity determining region CDR-VL2, X1 is S;

in the complementarity determining region CDR-VL3, X1 is Q.

In some embodiments, in the complementarity determining region CDR-VH1, X2 is T.

In some embodiments, in the complementarity determining region CDR-VH1, X2 is S.

In some embodiments, in the complementarity determining region CDR-VH1, X3 is Y.

In some embodiments, in the complementarity determining region CDR-VH1, X3 is F.

In some embodiments, in the complementarity determining region CDR-VH2, X2 is S.

In some embodiments, in the complementarity determining region CDR-VH2, X2 is T.

In some embodiments, in the complementarity determining region CDR-VH2, X3 is F.

In some embodiments, in the complementarity determining region CDR-VH2, X3 is Y.

In some embodiments, in the complementarity determining region CDR-VH3, X1 is Q.

In some embodiments, in the complementarity determining region CDR-VH3, X1 is N.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is R.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is K.

In some embodiments, in the complementarity determining region CDR-VH3, X4 is E.

In some embodiments, in the complementarity determining region CDR-VH3, X4 is D.

In some embodiments, in the complementarity determining region CDR-VL1, X1 is E.

In some embodiments, in the complementarity determining region CDR-VL1, X1 is D.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is G.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is S.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is T.

In some embodiments, in the complementarity determining region CDR-VL2, X2 is K.

In some embodiments, in the complementarity determining region CDR-VL2, X2 is R.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is Y.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is F.

In some embodiments, in the complementarity determining region CDR-VL3, X3 is I.

In some embodiments, in the complementarity determining region CDR-VL3, X3 is V.

In some embodiments, in the complementarity determining region CDR-VL3, X3 is L.

In some embodiments, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:

in some embodiments, the binding protein includes at least 3 CDRs (e.g., 3 CDRs of a heavy chain, or 3 CDRs of a light chain); alternatively, the binding protein comprises at least 6 CDRs.

In some embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.

In some embodiments, the binding protein is a "functional fragment" of an antibody, e.g., a nanobody, F (ab')₂Fab', Fab, Fv, scFv, diabody and antibody minimal recognition unit.

scFv (sc ═ single chain), bispecific antibodies (diabodies).

The term "functional fragment" as used herein refers in particular to an antibody fragment having the same specificity for H-FABP as the parent antibody. In addition to the above functional fragments, any fragment having an increased half-life is also included.

These functional fragments typically have the same binding specificity as the antibody from which they are derived. As the person skilled in the art deduces from the description of the invention, the antibody fragment of the invention may be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction cleavage of disulfide bonds.

Antibody fragments can also be obtained by peptide synthesis by recombinant genetic techniques also known to those skilled in the art or by, for example, automated peptide synthesizers, such as those sold by Applied BioSystems and the like.

In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence shown in SEQ ID NOS: 1-4, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence shown in SEQ ID NOS: 5-8.

In addition to the amino acid sequences disclosed herein above, the framework regions may be derived from human species to constitute humanized antibodies.

In some embodiments, the binding protein further comprises an antibody constant region sequence.

In some embodiments, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.

In some embodiments, the constant region is derived from a mouse;

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

According to one aspect of the invention, the invention also relates to an isolated nucleic acid molecule, which is DNA or RNA, encoding a binding protein as described above.

According to one aspect of the invention, the invention also relates to a vector comprising a nucleic acid molecule as described above.

The invention further comprises at least one nuclear construct, e.g. a plasmid, further an expression plasmid, encoding a nucleic acid molecule as described above, the construction of which vector will be described in one embodiment of the present application.

According to one aspect of the invention, the invention also relates to a host cell transformed with a vector as described above.

The host cell may be a eukaryotic cell, such as a mammalian cell.

In some embodiments, the host cell is a CHO cell.

According to one aspect of the invention, the invention also relates to a method for producing a binding protein as described above, said method comprising the steps of:

the host cells as described above are cultured in a medium and under suitable culture conditions, and the binding protein so produced is recovered from the medium or from the cultured host cells.

According to one aspect of the invention, the invention also relates to the use of a binding protein as described above for the preparation of a diagnostic agent or kit for the diagnosis of cardiopulmonary related diseases, or for the prognosis or observation of a treatment for cardiopulmonary related disease;

the cardiopulmonary related diseases include acute myocardial infarction, acute coronary syndrome, pulmonary embolism, evaluation of the degree of heart failure, congestive heart failure.

According to one aspect of the invention, the invention also relates to a method of detecting a cardiac fatty acid binding protein antigen in a test sample comprising:

a) contacting a cardiac fatty acid binding protein antigen in the test sample with a binding protein of claim above under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex; and

b) detecting the presence of said immune complex, the presence of said complex indicating the presence of said cardioid fatty acid binding protein antigen in said test sample;

in this embodiment, the binding protein may be labeled with an indicator that indicates the strength of the signal, so that the complex is readily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

in this embodiment, the binding protein is in the form of a first antibody that forms a partner antibody with the second antibody for binding to a different epitope of H-FABP;

the second antibody may be labeled with an indicator showing the intensity of the signal so that the complex is easily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the cardioid fatty acid binding protein antigen;

in this embodiment, the binding protein serves as an antigen for the second antibody, which may be labeled with an indicator of signal intensity to allow the complex to be readily detected.

In some embodiments, the indicator that shows signal intensity comprises any one of a fluorescent substance, a quantum dot, a digoxigenin-labeled probe, biotin, a radioisotope, a radiocontrast agent, a paramagnetic ion fluorescent microsphere, an electron-dense substance, a chemiluminescent label, an ultrasound contrast agent, a photosensitizer, colloidal gold, or an enzyme.

In some embodiments, the fluorescent species include Alexa 350, Alexa 405, Alexa 430, Alexa488, Alexa 555, Alexa 647, AMCA, aminoacridine, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4 ', 5' -dichloro-2 ', 7' -dimethoxyfluorescein, 5-carboxy-2 ', 4', 5', 7' -tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, dansyl chloride, fluorescein, HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-1, 3-diazole), Any one of Oregon Green 488, Oregon Green 500, Oregon Green514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresol fast violet, cresol Blue violet, brilliant cresol Blue, p-aminobenzoic acid, erythrosine, phthalocyanine, azomethine, cyanine, xanthine, succinyl fluorescein, rare earth metal cryptate, europium tripyridyldiamine, europium cryptate or chelate, diamine, bispyanine, La Jolla Blue dye, allophycocyanin, allocyanonin B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin R, REG, rhodamine Green, rhodamine isothiocyanate, rhodamine red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine, and Texas red.

In some embodiments, the radioisotope comprises¹¹⁰In、¹¹¹In、¹⁷⁷Lu、¹⁸F、⁵²Fe、⁶²Cu、⁶⁴Cu、⁶⁷Cu、⁶⁷Ga、⁶⁸Ga、⁸⁶Y、⁹⁰Y、⁸⁹Zr、⁹⁴mTc、⁹⁴Tc、⁹⁹mTc、¹²⁰I、¹²³I、¹²⁴I、¹²⁵I、¹³¹I、^154-158Gd、³²P、¹¹C、¹³N、¹⁵O、¹⁸⁶Re、¹⁸⁸Re、⁵¹Mn、⁵²mMn、⁵⁵Co、⁷²As、⁷⁵Br、⁷⁶Br、⁸²mRb and⁸³sr.

In some embodiments, the enzyme comprises any one of horseradish peroxidase, alkaline phosphatase, and glucose oxidase.

In some embodiments, the fluorescent microspheres are: the polystyrene fluorescent microsphere is internally wrapped with rare earth fluorescent ion europium.

According to one aspect of the invention, the invention also relates to a kit comprising a binding protein as described above.

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

This example provides an exemplary method for the preparation of recombinant antibodies against human heart fatty acid binding proteins.

S10, constructing an expression plasmid:

restriction enzyme, Prime Star DNA polymerase in this example was purchased from Takara;

the MagExtractor-RNA extraction kit was purchased from TOYOBO;

BD SMART^TMRACE cDNA Amplification Kit was purchased from Takara;

pMD-18T vector was purchased from Takara;

the plasmid extraction kit is purchased from Tiangen corporation;

primer synthesis and gene sequencing were done by Invitrogen;

the Anti-FABP 9E5 monoclonal antibody is secreted as an existing hybridoma cell strain, and is recovered for later use.

S11, design and synthesis of primers:

5' RACE upstream primers for heavy and light chain amplification:

SMARTER II A Oligonucleotide：

5’>AAGCAGTGGTATCAACGCAGAGTACXXXXX<3’；

5'-RACE CDS Primer(5'-CDS)：5’>(T)₂₅VN<3’(N＝A,C,G,orT；V＝A,G,orC)；

Universal Primer A Mix(UPM):

5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’；

Nested Universal Primer A(NUP):

5’>AAGCAGTGGTATCAACGCAGAGT<3’；

mIg-kR：5’>CTAACACTCATTCCTGTTGAAGCTCTTGACAAT<3’；

mIg-HR：5’>TCATTTACCAGGAGAGTGGGAGAGGC<3’。

s12, antibody variable region gene cloning and sequencing:

RNA is extracted from a hybridoma cell strain secreting anti-FABP 9E5 monoclonal antibody, first strand cDNA synthesis is carried out by SMARTER II A Oligopuleotide and 5' -CDS primers in a SMARTERTMRACE cDNA Amplification Kit kit and the kit, an obtained first strand cDNA product is used as a PCR amplification template, Light Chain genes are amplified by Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIg-kR primers, the Heavy Chain genes are amplified by Universal Primer Mix (UPM), Nested Universal Primer A (NUP) and mIg-kR primers, target bands of about 0.72KB are amplified by the Primer pair of the Light Chain, target bands of about 1.4KB are amplified by the Primer pair of the Heavy Chain, the target bands are purified and recovered by agarose electrophoresis, products are inserted into a Taq-18 KB DNA polymerase after an anti-FABP 9E5 monoclonal antibody reaction is carried out, and Invitrogen clones are obtained and are cloned into a HevK vector, and Invitrogen clone genes are detected after 35 Taq-18 Taq DNA polymerase is added.

Sequence analysis of S13, Anti-FABP 9E5 antibody variable region genes:

putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene fragment amplified by the Light Chain, the VL gene sequence is 324bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the HeavyChain primer pair, the VH gene sequence is 363bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.

S14, construction of recombinant antibody expression plasmid:

pcDNA^TM3.4

vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, BamHI, EcoRI and the like are introduced into the expression vector and named as pcDNA3.4A expression vector, and the vector is called as 3.4A expression vector for short in the following; according to the sequencing result of the antibody variable region gene in the pMD-18T, VL and VH gene specific primers of the anti-FABP 9E5 antibody are designed, wherein two ends of the primers are respectively provided with HindIII and EcoRI enzyme cutting sites and protective bases, and the primers are as follows:

FABP-9E5-HF：5’>CCCAAGCTTATGGAATGCAGCTGTGTCATGCTCTTCTTC<3’；

FABP-9E5-HR:5’>CCCGAATTCTCATTTACCAGGAGAGTGGGAGAGGC<3’；

FABP-9E5-LF:5’>CCCAAGCTTATGAAGTTGCCTGTTAGGCTGTTGG<3’；

FABP-9E5-LR:5’>CCCGAATTCCTAACACTCATTCCTGTTGAAGCTCTTGACAA<3’；

a0.75 KB Light Chain gene fragment and a 1.42KB Heavy Chain gene fragment were amplified by PCR amplification. The gene fragments of the Heavy Chain and the Light Chain are subjected to double enzyme digestion by HindIII/EcoRI respectively, the 3.4A vector is subjected to double enzyme digestion by HindIII/EcoRI, the Heavy Chain gene and the Light Chain gene are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the Heavy Chain and the Light Chain are respectively obtained.

S2. Stable cell strain screening

Transient transfection of CHO cell with S21 recombinant antibody expression plasmid and determination of expression plasmid activity

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells 1.43 × 10 were conditioned⁷cells/ml are put into a centrifuge tube, 100ul of plasmid is mixed with 700ul of cells, the mixture is transferred into an electric rotating cup and is electrically rotated, sampling and counting are carried out on days 3, 5 and 7, and sampling and detecting are carried out on day 7.

The coating solution diluted the recombinant FABP protein (self-produced, 140618) to the indicated concentration, 100uL per well, overnight at 4 ℃; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), beating to dry at 37 deg.C for 1h and 120uL per well; adding diluted cell supernatant at 100 uL/well at 37 deg.C for 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100uL per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 uL/hole), adding a developing solution B (50 uL/hole), and carrying out 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 uL/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader. The results show that the reaction OD after the cell supernatant is diluted 1000 times is still larger than 1.0, and the reaction OD of the wells without the cell supernatant is smaller than 0.1, which indicates that the antibodies generated after the plasmid is transiently transformed have activity on recombinant FABP protein.

Linearization of S22 recombinant antibody expression plasmid

The following reagents were prepared: 50ul Buffer, 100 ug/tube DNA, 10ul Puv I enzyme and sterile water to 500ul, and performing enzyme digestion in water bath at 37 ℃ overnight; sequentially extracting with equal volume of phenol/chloroform/isoamyl alcohol (lower layer) 25:24:1 and then chloroform (water phase); precipitating with 0.1 volume (water phase) of 3M sodium acetate and 2 volumes of ethanol on ice, rinsing with 70% ethanol, removing organic solvent, re-melting with appropriate amount of sterilized water after ethanol is completely volatilized, and finally measuring concentration.

S23 recombinant antibody expression plasmid stable transfection, pressurized screening of stable cell strain

The plasmid is diluted to 400ng/ml with ultrapure water, CHO cells 1.43 × 107cells/ml are adjusted to be in a centrifuge tube, 100ul plasmid and 700ul cells are mixed, the mixture is transferred into an electric rotating cup, the electric rotating is carried out, the next day is counted, and 25umol/L MSX 96 holes are subjected to pressure culture for about 25 days.

Observing the clone hole marked with cells under microscope, recording the confluency, taking culture supernatant, detecting, selecting cell strain with high antibody concentration and relative concentration, transferring to 24 holes, transferring to 6 holes after 3 days, preserving and culturing after 3 days, adjusting cell density to 0.5 × 10⁶culturing cells/ml in 2.2ml, preserving seeds in 2ml at cell density of 0.3 × 106cells/ml, detecting the supernatant of 6-hole batch culture in 7 days, selecting antibody and cell with small diameterThe cell strain is transferred to TPP for seed preservation and passage.

S3. recombinant antibody production

S31 cell expanding culture

After the cells are recovered, the cells are cultured in a shaking flask with the specification of 125ml, the inoculation volume is 30ml, the culture medium is 100% Dynamis culture medium, and the cells are placed in a shaking table with the rotation speed of 120r/min, the temperature of 37 ℃ and the carbon dioxide of 8%. Culturing for 72h, inoculating and expanding culture at an inoculation density of 50 ten thousand cells/ml, wherein the expanding culture volume is calculated according to production requirements, and the culture medium is 100% Dynamis culture medium. Then the culture is expanded every 72 h. When the cell amount meets the production requirement, the production is carried out by strictly controlling the inoculation density to be about 50 ten thousand cells/ml.

S32 shake flask production and purification

Shake flask parameters: the rotating speed is 120r/min, the temperature is 37 ℃, and the carbon dioxide is 8 percent. Feeding in a flowing mode: daily feeding was started when the culture was carried out for 72h in a shake flask, 3% of the initial culture volume was fed daily to HyCloneTM Cell BoostTM Feed 7a, and one thousandth of the initial culture volume was fed daily to Feed 7b, up to day 12 (day 12 feeding). Glucose was supplemented with 3g/L on the sixth day. Samples were collected on day 13. Affinity purification was performed using a proteinA affinity column. Mu.g of the purified antibody was subjected to reducing SDS-PAGE, and 4. mu.g of an external control antibody was used as a control, and the electrophoretogram was shown in FIG. 1. Two bands were shown after reducing SDS-PAGE, 1 with 50kD Mr and 28kD Mr (light chain).

Example 2

Upon analysis, the complementarity determining region (WT) of the heavy chain:

CDR-VH1 is G-Y (X1) -T-F-T (X2) -N-Y (X3) -G-M-S;

CDR-VH2 is I-S-S-A (X1) -G-S (X2) -Y-T-F (X3) -Y-P-D-S-V;

CDR-VH3 is R-Q (X1) -D-G-R (X2) -Y-H-F-Y-S (X3) -M-E (X4) -Y;

complementarity determining regions of the light chain:

CDR-VL1 is S-Q-E (X1) -V-G (X2) -T-P (X3) -V-A;

CDR-VL2 is S-A-T (X1) -Y-K (X2) -Y-T;

CDR-VL3 is Q-N (X1) -H-Y (X2) -N-T-P-I (X3) -T;

wherein, (X1), (X2), (X3) and (X4) are all the sites to be mutated.

TABLE 1 mutant sites associated with antibody Activity

The inventors performed the above-described mutation of the CDR sites in WT to obtain a more active antibody.

Diluting the recombinant FABP protein (self-produced, 140618) to 1ug/ml by the coating solution to carry out microplate coating, wherein each well is 100uL, and the temperature is kept overnight at 4 ℃; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), beating to dry at 37 deg.C for 1h and 120uL per well; adding diluted FABP monoclonal antibody at a concentration of 100 uL/well at 37 deg.C for 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100uL per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 uL/hole), adding a developing solution B (50 uL/hole), and carrying out 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 uL/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader.

TABLE 2 antibody Activity assay data

As can be seen from the above table, the activity effect of mutation 1 is the best, so that mutation sites with better potency are screened by using mutation 1 as a framework sequence (ensuring that the activity of the antibody obtained by screening is similar to that of mutation 1, about + -10% of the antibody activity), and partial results are as follows.

TABLE 3 mutation sites related to antibody affinity

Affinity assay

Performing enzyme-free indirect method data in the same way of activity identification, and performing four gradient 2ug/ml, 1ug/ml, 0.5ug/ml and 0.25 ug/ml; the antibody was diluted in a 2-fold gradient starting at 200ng/ml to 0.195ng/ml loading. And obtaining the OD values corresponding to different antibody concentrations under the conditions of no coating concentration. Under the same coating concentration, the antibody concentration is used as an abscissa and the OD value is used as an ordinate, logarithmic mapping is carried out, and the antibody concentration at 50% of the maximum OD value is calculated according to a fitting equation; substitution into the formula: k ═ n-1)/(2 × (n × Ab '-Ab)) the reciprocal of the affinity constant was calculated, where Ab and Ab' respectively represent the antibody concentration at 50% of maximum OD value at the corresponding coating concentration (Ag, Ag '), and n ═ Ag/Ag'; every two coating concentrations can be combined to calculate a K value, six K values can be obtained finally, the average value of the K values is taken, and the reciprocal value is calculated to be the affinity constant KD.

Table 4 affinity assay data

As can be seen from table 4, the mutation sites listed in table 3 have little effect on the affinity of the antibody.

To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.

TABLE 5 mutations with WT as backbone

Table 6 affinity assay data

From the analyses in tables 5 and 6, the association between the mutation site and other sites was not significant on the premise that the antibody activity was ensured.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Dongguan City of Pengzhi Biotech Co., Ltd

<120> a recombinant antibody against heart-type fatty acid binding protein

<160>12

<170>PatentIn version 3.3

<210>1

<211>25

<212>PRT

<213>Mus musculus

<400>1

Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser Thr Ser Val Gly

1 5 10 15

Asp Arg Val Ser Ile Thr Cys Lys Ala

20 25

<210>2

<211>15

<212>PRT

<213>Mus musculus

<400>2

Trp Tyr Gln Gln Ile Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr

1 5 10 15

<210>3

<211>32

<212>PRT

<213>Mus musculus

<400>3

Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr

1 5 10 15

Phe Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys

20 25 30

<210>4

<211>11

<212>PRT

<213>Mus musculus

<400>4

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg

1 5 10

<210>5

<211>25

<212>PRT

<213>Mus musculus

<400>5

Glu Val Gln Leu Val Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser

20 25

<210>6

<211>15

<212>PRT

<213>Mus musculus

<400>6

Trp Val Arg Gln Thr Pro Asp Lys Arg Leu Glu Trp Val Ala Thr

1 5 10 15

<210>7

<211>33

<212>PRT

<213>Mus musculus

<400>7

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

1 5 10 15

Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Met Tyr Tyr Cys

20 25 30

Ala

<210>8

<211>11

<212>PRT

<213>Mus musculus

<400>8

Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

1 5 10

<210>9

<211>106

<212>PRT

<213>Mus musculus

<400>9

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

1 5 10 15

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

20 2530

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

35 40 45

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

50 55 60

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

65 70 75 80

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

85 90 95

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210>10

<211>323

<212>PRT

<213>Mus musculus

<400>10

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala Gln Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro

195 200 205

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln

210215 220

Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val

225 230 235 240

Ser Leu Thr Cys Met Ile Thr Asn Phe Phe Pro Glu Asp Ile Thr Val

245 250 255

Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln

260 265 270

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn

275 280 285

Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val

290 295 300

Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His

305 310 315 320

Ser Pro Gly

<210>11

<211>214

<212>PRT

<213> Artificial sequence

<400>11

Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser Thr Ser Val Gly

1 5 10 15

Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Glu Val Gly Thr Pro

20 25 30

Val Ala Trp Tyr Gln Gln Ile Pro Gly Gln Ser Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Thr Tyr Lys Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala

65 70 75 80

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn His Tyr Asn Thr Pro Ile

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Ala Asp Ala Ala

100 105 110

Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Leu Thr Ser Gly

115 120 125

Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro Lys Asp Ile

130 135 140

Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly Val Leu

145 150 155 160

Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser

165 170 175

Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr

180 185 190

Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro Ile Val Lys Ser

195 200 205

Phe Asn Arg Asn Glu Cys

210

<210>12

<211>444

<212>PRT

<213> Artificial sequence

<400>12

Glu Val Gln Leu Val Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr Asn Tyr

20 25 30

Gly Met Ser Trp Val Arg Gln Thr Pro Asp Lys Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Ser Ala Gly Ser Tyr Thr Phe Tyr Pro Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Arg Gln Asp Gly Arg Tyr His Phe Tyr Ser Met Glu Tyr Trp Gly

100 105 110

Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser

115 120 125

Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val

130 135 140

Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val

145 150 155 160

Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala

165 170 175

Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro

180 185 190

Ser Ser Thr Trp Pro Ser Gln Thr Val Thr Cys Asn Val Ala His Pro

195 200 205

Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly

210 215 220

Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile

225 230 235 240

Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys

245 250 255

Val Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln

260 265 270

Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Lys

275 280 285

Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu

290 295 300

Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg

305 310 315 320

Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

325 330 335

Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro

340 345 350

Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr

355 360 365

Asn Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln

370 375 380

Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly

385 390 395 400

Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu

405 410 415

Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn

420 425 430

His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly

435 440

Claims

1. An isolated binding protein comprising an antigen binding domain, wherein the antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences recited in seq id nos: or; has at least 80% sequence identity to the complementarity determining region of the amino acid sequence described below and has K with cardiac fatty acid binding protein_D≤1.028×10^-9Affinity of mol/L;

CDR-VH1 is G-X1-T-F-X2-N-X3-G-M-S, wherein,

x1 is Y or F, X2 is T or S, X3 is Y or F;

CDR-VH2 is I-S-S-X1-G-X2-Y-T-X3-Y-P-D-S-V, wherein,

x1 is G or A, X2 is S or T, X3 is F or Y;

CDR-VH3 is R-X1-D-G-X2-Y-H-F-Y-X3-M-X4-Y, wherein,

x1 is Q or N, X2 is R or K, X3 is S or T, X4 is E or D;

x1 is E or D, X2 is G, S or T, X3 is A or P;

the complementarity determining region CDR-VL2 is S-A-X1-Y-X2-Y-T, wherein,

x1 is T or S, X2 is K or R;

x1 is Q or N, X2 is Y or F, X3 is I, V or L;

preferably:

in the complementarity determining region CDR-VH1, X1 is F;

in the complementarity determining region CDR-VH2, X1 is G;

in the complementarity determining region CDR-VH3, X3 is T;

in the complementarity determining region CDR-VL1, X3 is A;

in the complementarity determining region CDR-VL2, X1 is S;

in the complementarity determining region CDR-VL3, X1 is Q;

preferably, in the complementarity determining region CDR-VH1, X2 is T;

preferably, in the complementarity determining region CDR-VH1, X2 is S;

preferably, in the complementarity determining region CDR-VH1, X3 is Y;

preferably, in the complementarity determining region CDR-VH1, X3 is F;

preferably, in the complementarity determining region CDR-VH2, X2 is S;

preferably, in the complementarity determining region CDR-VH2, X2 is T;

preferably, in the complementarity determining region CDR-VH2, X3 is F;

preferably, in the complementarity determining region CDR-VH2, X3 is Y;

preferably, in the complementarity determining region CDR-VH3, X1 is Q;

preferably, in the complementarity determining region CDR-VH3, X1 is N;

preferably, in the complementarity determining region CDR-VH3, X2 is R;

preferably, in the complementarity determining region CDR-VH3, X2 is K;

preferably, in the complementarity determining region CDR-VH3, X4 is E;

preferably, in the complementarity determining region CDR-VH3, X4 is D;

preferably, in the complementarity determining region CDR-VL1, X1 is E;

preferably, in the complementarity determining region CDR-VL1, X1 is D;

preferably, in the complementarity determining region CDR-VL1, X2 is G;

preferably, in the complementarity determining region CDR-VL1, X2 is S;

preferably, in the complementarity determining region CDR-VL1, X2 is T;

preferably, in the complementarity determining region CDR-VL2, X2 is K;

preferably, in the complementarity determining region CDR-VL2, X2 is R;

preferably, in the complementarity determining region CDR-VL3, X2 is Y;

preferably, in the complementarity determining region CDR-VL3, X2 is F;

preferably, in the complementarity determining region CDR-VL3, X3 is I;

preferably, in the complementarity determining region CDR-VL3, X3 is V;

preferably, in the complementarity determining region CDR-VL3, X3 is L;

preferably, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:

2. the isolated binding protein comprising an antigen binding domain according to claim 1, wherein at least 3 CDRs are included in the binding protein; alternatively, the binding protein comprises at least 6 CDRs;

preferably, the binding protein is a nanobody, F (ab')₂One of, Fab', Fab, Fv, scFv, diabody, and antibody minimal recognition unit;

preferably, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 which have the sequences shown in SEQ ID NO. 1-4 in sequence, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 which have the sequences shown in SEQ ID NO. 5-8 in sequence.

3. The isolated binding protein comprising an antigen binding domain according to claim 1 or 2, wherein the binding protein further comprises an antibody constant region sequence;

preferably, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD;

preferably, the species of the constant region is from a cow, horse, cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fight, or human;

preferably, the constant region is derived from a mouse;

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

4. An isolated nucleic acid molecule which is DNA or RNA encoding the binding protein of any one of claims 1 to 3.

5. A vector comprising the nucleic acid molecule of claim 4.

6. A host cell transformed with the vector of claim 5.

7. A method of producing the binding protein of any one of claims 1 to 3, comprising the steps of:

culturing the host cell of claim 6 in a culture medium and under suitable culture conditions, and recovering the binding protein so produced from the culture medium or from the cultured host cell.

8. Use of a binding protein according to any one of claims 1 to 3 in the preparation of a diagnostic agent or kit for the diagnosis of cardiopulmonary-related diseases, or for the prognosis or observation of treatment of cardiopulmonary-related diseases;

9. A method of detecting a cardiac fatty acid binding protein antigen in a test sample, comprising:

a) contacting a cardiac fatty acid binding protein antigen in the test sample with the binding protein of claim 3 under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex; and

preferably, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

preferably, in step a), a second antibody is further included in the immune complex, and the second antibody binds to the cardiac fatty acid binding protein antigen.

10. A kit comprising the binding protein of any one of claims 1 to 3.