CN112724251B - Binding protein containing C-reactive protein antigen binding domain - Google Patents
Binding protein containing C-reactive protein antigen binding domain Download PDFInfo
- Publication number
- CN112724251B CN112724251B CN201911028232.7A CN201911028232A CN112724251B CN 112724251 B CN112724251 B CN 112724251B CN 201911028232 A CN201911028232 A CN 201911028232A CN 112724251 B CN112724251 B CN 112724251B
- Authority
- CN
- China
- Prior art keywords
- mutations
- cdr
- binding protein
- complementarity determining
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/54—F(ab')2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4737—C-reactive protein
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/04—Endocrine or metabolic disorders
- G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/10—Musculoskeletal or connective tissue disorders
- G01N2800/101—Diffuse connective tissue disease, e.g. Sjögren, Wegener's granulomatosis
- G01N2800/102—Arthritis; Rheumatoid arthritis, i.e. inflammation of peripheral joints
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/10—Musculoskeletal or connective tissue disorders
- G01N2800/101—Diffuse connective tissue disease, e.g. Sjögren, Wegener's granulomatosis
- G01N2800/104—Lupus erythematosus [SLE]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/20—Dermatological disorders
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/20—Dermatological disorders
- G01N2800/205—Scaling palpular diseases, e.g. psoriasis, pytiriasis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/24—Immunology or allergic disorders
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/26—Infectious diseases, e.g. generalised sepsis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/30—Psychoses; Psychiatry
- G01N2800/304—Mood disorders, e.g. bipolar, depression
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/32—Cardiovascular disorders
Abstract
The invention relates to an isolated binding protein containing a C-reactive protein antigen binding domain, and researches on the aspects of preparation, application and the like of the binding protein. The binding protein has strong activity and high affinity with human C-reactive protein, and can be widely applied to the detection of the C-reactive protein.
Description
Technical Field
The invention relates to the technical field of immunization, in particular to an isolated binding protein containing a C-reactive protein antigen binding domain.
Background
C-reactive protein (CRP), an Acute phase reaction protein (Acute phase protein), found that the serum of an Acute infection patient can have a precipitation reaction with C polysaccharide on the cell wall of pneumococcus in 1930 by Tillett and Fransic of the AVERY laboratory of Loncher research institute of Rockwell, and then proved that the protein involved in the reaction is called C-reactive protein. CRP belongs to one of the members of the penetrator family, has a relative molecular mass of 115KD-140KD, is formed by combining 5 identical subunits in a non-covalent bond mode to form a symmetrical annular pentasphere, surrounds a hole-shaped structure in the middle, has a concave surface containing a ligand binding site, and has 206 amino acid residues in each subunit. In inflammation, infection and tissue injury, CRP is secreted into human blood after being synthesized mainly by liver under stimulation of cell factor (such as interleukin-6, tumor necrosis factor) and the like, and the half-life period in blood is about 19h. Peripheral blood lymphocytes are also able to synthesize small amounts of CRP.
CRP has multiple biological functions and participates in multiple self-physiological and pathophysiological processes. CRP has a high affinity for phosphatidylcholine residues and can bind to a variety of self-ligands (e.g., plasma cell lipoproteins, cell membranes of injured cells, micronuclein particles, opsonin cells, etc.) or foreign ligands (e.g., polysaccharides, phospholipids and components of microorganisms such as bacteria, fungi, parasites, etc.). CRP, when bound to these ligands, activates only the primary phase of the classical pathway of complement activation, limiting the development and magnitude of the late inflammatory response of complement activation. In addition, CRP can increase lymphocyte activity, enhance phagocytosis of macrophage to various bacteria and foreign matters, inhibit platelet aggregation, and resist inflammation.
With the progress of detection technology, the relationship between acute phase-reaction protein, in particular CRP, and acute infection, tissue vascular injury and the like is more and more emphasized, and many research results show that the protein is one of the most important proteins in the acute phase-reaction protein and is also an important marker of human infection, and the change condition of the content in the body of the protein has strong correlation with the occurrence and development of the following diseases such as infectious diseases, cardiovascular diseases, autoimmune diseases, malignant tumors, depression and the like.
1) Serum CRP levels are a sensitive and objective indicator of bacterial infection. In general, the CRP concentration of the organism is lower, the CRP in the serum of newborn is less than 2mg/L, and the CRP in the serum of children and normal adults is less than or equal to 10mg/L. In infectious diseases, CRP concentration can rapidly rise within 6-8h and peak at 24-48 h. The high peak value can reach hundreds of times of the normal value. But sharply decreases after the infection is eliminated, and can be recovered within a week.
CRP levels also have a relationship with the extent of infection and severity of infection. Various bacterial infections can cause the elevation of CRP level, 10-99mg/L indicates focal or superficial infection, and more than or equal to 100mg/L indicates severe conditions such as septicemia or invasive infection. Thus, serum CRP levels can be used to predict the severity of infectious diseases, length of hospitalization, prognosis, and recurrence.
2) CRP can be used for differential diagnosis of bacterial and viral infections. CRP levels are elevated significantly upon bacterial infection and elevated more normally or mildly upon viral infection, and thus CRP may also aid in the differential diagnosis of bacterial and non-bacterial infections.
3) CRP is associated with early diagnosis and prognosis of autoimmune diseases. CRP can be elevated in the active phase of most connective tissue diseases. Connective tissue diseases are autoimmune diseases, including systemic lupus erythematosus, rheumatoid arthritis and the like, and although the causes, the pathologies, the expression forms and the treatment modes are different, autoimmune inflammations play an important role in the occurrence and development processes of the diseases. CRP is one of the important prediction indexes of joint destruction and prognosis in the early stage of rheumatoid arthritis.
4) CRP, which can reflect the components of atherosclerotic plaques and predict the likelihood of plaque rupture, is an independent predictor of cardiovascular disease. CRP level of patients with coronary heart disease and acute coronary syndrome is obviously increased, and the increased level has obvious correlation with the degree of coronary arteriosclerosis obstruction, the occurrence and prognosis of coronary heart disease terminal events and the degree of congestive heart failure.
5) CRP is associated with differential diagnosis and evaluation of tumors. The CRP level of the malignant tumor patients is mostly increased, and the combined detection of CRP and AFP can be used for differential diagnosis of liver cancer and liver benign diseases. CRP is of great significance for the treatment of tumors and the evaluation of the effect of surgery, and is helpful for the clinical evaluation of the tumor progress.
6) Elevation of CRP is closely associated with metabolic syndrome. In recent years, diabetes is also considered to be a chronic low-grade inflammatory disease mediated by cytokines, many inflammatory factors such as CRP are remarkably increased in patients with type II diabetes, CRP level in serum is closely related to increase of incidence rate of type II diabetes in population, and polymorphism of CRP gene is also related to incidence of diabetes.
In view of the important role of CRP in many fields, the detection of CRP has important clinical significance for the diagnosis, prognosis, evaluation, etc. of the above-mentioned diseases. At present, more CRP measuring methods exist, such as immunoprecipitation, immunoturbidimetry, labeled immunoassay, etc., among which immunoturbidimetry is most commonly used. The above-mentioned conventional immunoassay methods all require the use of a monoclonal antibody against CRP.
For a long time, murine monoclonal antibodies produced by hybridoma technology have been widely used in research, clinical diagnosis and therapy. However, as the mouse peritoneal cavity is adopted for hybridoma production, the influence of mouse individuals is particularly large, the production is unstable, the batch difference is large, the mouse autoantibody purification difficulty is large, and the existing anti-CRP antibody has low activity and poor affinity and cannot be well applied to CRP detection, so that the field has strong demand for the detection antibody which can be specifically combined with CRP and has good activity and affinity.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The invention provides an isolated binding protein with good activity and high affinity, which comprises a C-reactive protein (CRP) antigen binding domain, and a preparation method and application thereof.
The present invention provides an isolated binding protein comprising a C-reactive protein antigen binding domain comprising at least one complementarity determining region of an amino acid sequence; or; having at least 80% sequence homology with the complementarity determining regions of the amino acid sequence;
CDR-VH1 is G-X1-T-F-T-X2-Y-X3-M-N, wherein,
x1 is Y or W, X2 is Q or N, X3 is I, V or L;
CDR-VH2 is W-X1-N-T-X2-T-G-E-P-T-Y-A-X3-X4-F-K, wherein,
x1 is L, V or I, X2 is D, N, E or Q, X3 is E or D, X4 is D or E;
CDR-VH3 is A-L-S-X1-S-R-L-X2-W-Y-X3-D-V, wherein,
x1 is I or L, X2 is N, H or Q, X3 is Y or F;
the CDR-VL1 is R-A-S-X1-S-V-X2-A-S-X3-Y-G-X4-M-H, wherein,
x1 is Q or N, X2 is S or T, X3 is F, W or Y;
CDR-VL2 is Y-X1-S-X2-L-E-S, wherein,
x1 is I, A or L, X2 is N or Q;
CDR-VL3 is Q-X1-S-W-E-X2-P-X3-T, wherein,
x1 is H or N, X2 is I, V or L, and X3 is C or S.
Further, the present invention provides an isolated binding protein comprising a C-reactive protein antigen binding domain, wherein:
in the CDR-VH1, X1 is Y;
in the CDR-VH2, X4 is D;
in the CDR-VH3, X1 is L;
in the complementarity determining region CDR-VL1, X3 is G;
in the complementarity determining region CDR-VL2, X2 is N;
in the complementarity determining region CDR-VL3, X1 is H;
in some embodiments, in the complementarity determining region CDR-VH1, X2 is independently selected from Q;
in some embodiments, in the complementarity determining region CDR-VH1, X2 is independently selected from N;
in some embodiments, in the complementarity determining region CDR-VH1, X3 is independently selected from I;
in some embodiments, in the complementarity determining region CDR-VH1, X3 is independently selected from V;
in some embodiments, in the complementarity determining region CDR-VH1, X3 is independently selected from L;
in some embodiments, in the complementarity determining region CDR-VH2, X1 is independently selected from L;
in some embodiments, in the complementarity determining region CDR-VH2, X1 is independently selected from V;
in some embodiments, in the complementarity determining region CDR-VH2, X1 is independently selected from I;
in some embodiments, in the complementarity determining region CDR-VH2, X2 is independently selected from D;
in some embodiments, in the complementarity determining region CDR-VH2, X2 is independently selected from N;
in some embodiments, in the complementarity determining region CDR-VH2, X2 is independently selected from E;
in some embodiments, in the complementarity determining region CDR-VH2, X2 is independently selected from Q;
in some embodiments, in the complementarity determining region CDR-VH2, X3 is independently selected from E;
in some embodiments, in the complementarity determining region CDR-VH2, X3 is independently selected from D;
in some embodiments, in the complementarity determining region CDR-VH3, X2 is independently selected from N;
in some embodiments, in the complementarity determining region CDR-VH3, X2 is independently selected from H;
in some embodiments, in the complementarity determining region CDR-VH3, X2 is independently selected from Q;
in some embodiments, in the complementarity determining region CDR-VH3, X3 is independently selected from Y;
in some embodiments, in the complementarity determining region CDR-VH3, X3 is independently selected from F;
in some embodiments, in the complementarity determining region CDR-VL1, X1 is independently selected from Q;
in some embodiments, in the complementarity determining region CDR-VL1, X1 is independently selected from N;
in some embodiments, in the complementarity determining region CDR-VL1, X2 is independently selected from S;
in some embodiments, in the complementarity determining region CDR-VL1, X2 is independently selected from T;
in some embodiments, in the complementarity determining region CDR-VL1, X4 is independently selected from F;
in some embodiments, in the complementarity determining region CDR-VL1, X4 is independently selected from W;
in some embodiments, in the complementarity determining region CDR-VL1, X4 is independently selected from Y;
in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from I;
in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from a;
in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from L;
in some embodiments, in the complementarity determining region CDR-VL3, X2 is independently selected from I;
in some embodiments, in the complementarity determining region CDR-VL3, X2 is independently selected from V;
in some embodiments, in the complementarity determining region CDR-VL3, X2 is independently selected from L;
in some embodiments, in the complementarity determining region CDR-VL3, X3 is independently selected from C;
in some embodiments, in the complementarity determining region CDR-VL3, X3 is independently selected from S.
In some embodiments, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:
in some embodiments, the binding protein has a K with CRP D Affinity less than or equal to 9.66E-09 mol/L.
In some embodiments, the binding protein comprises at least 3 CDRs (alternatively, 3 CDRs of a heavy chain, or 3 CDRs of a light chain).
In some embodiments, the binding protein comprises at least 6 CDRs.
In some embodiments of the present invention, the substrate is,the binding protein is nano antibody, F (ab') 2 Fab', fab, fv, scFv (sc = single chain), diabodies (diabodies), or minimal recognition units for antibodies.
In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 having the sequences shown in SEQ ID NOS: 1-4 in order, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 having the sequences shown in SEQ ID NOS: 5-8 in order.
In some embodiments, the binding protein further comprises an antibody constant region sequence.
In some embodiments, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions IgG1, igG2, igG3, igG4, igA, igM, igE, igD.
In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.
In some embodiments, the constant region is derived from a mouse.
In some embodiments, the light chain constant region sequence is set forth in SEQ ID NO 9 and the heavy chain constant region sequence is set forth in SEQ ID NO 10.
In some embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.
In another aspect, the invention also relates to an isolated nucleic acid molecule, which is DNA or RNA, which encodes a binding protein as described above.
In one aspect, the invention also relates to a vector comprising a nucleic acid molecule provided by the invention.
In another aspect, the present invention also relates to a host cell transformed with a vector as described above.
In some embodiments, the host cell includes bacterial, eukaryotic, yeast and baculovirus systems.
In some embodiments, the host cell is a eukaryotic cell, further a mammalian cell.
Mammalian cell lines useful for expression in the art include: chinese Hamster Ovary (CHO) cells, heLa cells, melengus kidney cells, NS0 mouse myeloma cells, and many others.
In some embodiments, the host cell is a CHO cell.
According to one aspect of the invention, the invention also relates to a method for producing a binding protein as described above, said method comprising the steps of:
the host cell as described above is cultured in suitable culture conditions and the binding protein as described above is recovered from the culture medium or from the cultured host cell.
According to one aspect of the invention, the invention also relates to the use of a binding protein as described above for the preparation of a diagnostic agent or kit for the diagnosis of a disease associated with a change in CRP levels.
In some embodiments, the disease associated with a change in CRP level is an infectious disease, a cardiovascular disease, an autoimmune disease, a tumor, and depression.
In some embodiments, the infectious disease comprises a bacterial infection, a fungal infection, or a viral infection.
In some embodiments, the autoimmune disease comprises systemic lupus erythematosus, multiple sclerosis, type I diabetes, psoriasis, ulcerative colitis, sjogren's syndrome, scleroderma, polymyositis, rheumatoid inflammation, mixed connective tissue, primary biliary cirrhosis, autoimmune hemolytic anemia, hashimoto's thyroiditis, addisons disease, vitiligo, graves disease, myasthenia gravis, ankylosing spondylitis, allergic osteoarthritis, allergic vasculitis, autoimmune neutropenia, idiopathic thrombocytopenic purpura, lupus nephritis, chronic atrophic gastritis, autoimmune infertility, endometriosis, pasture disease, pemphigus, discoid lupus erythematosus, or compact deposit disease.
According to one aspect of the invention, the invention also relates to a method of detecting a CRP antigen in a test sample, comprising:
a) Contacting a CRP antigen in the test sample with a binding protein described herein under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex;
b) Detecting the presence of the immune complex.
In the above embodiments, the presence of the immune complex in step b) is indicative of the presence of the CRP antigen in the test sample.
In the above embodiments, the binding protein may be labeled with an indicator showing signal intensity to allow the immune complex to be easily detected.
In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;
in this embodiment, the binding protein forms a partner antibody with the second antibody in the form of a first antibody for binding to a different epitope of CRP;
the second antibody may be labeled with an indicator showing the intensity of the signal so that the complex is easily detected.
In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the CRP antigen;
in this embodiment, the binding protein serves as an antigen for the second antibody, which may be labeled with an indicator of signal intensity to allow the complex to be readily detected.
Further, another aspect of the present invention also relates to a detection reagent or kit comprising the binding protein as described above.
In some embodiments, the reagent or kit further comprises one or more of a buffer, a stabilizer, a diluent, or a carrier.
The isolated binding protein provided by the invention has strong activity and high affinity with CRP (especially human CRP), and is suitable for detecting CRP content, especially human CRP content. Meanwhile, the binding protein obtained by the recombination method has small individual difference, small batch difference and stable quality, and is more beneficial to quality control and detection stability. And has better affinity compared with the common CRP antibody on the market.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is an electrophoretogram of a monoclonal antibody against human CRP in example 1 of the present invention.
Detailed Description
The present invention may be understood more readily by reference to the following description of certain embodiments of the invention and the detailed description of the examples included therein.
Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such embodiments are necessarily varied. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
Definition of terms
"isolated binding protein comprising an antigen binding domain" and "binding protein" refer broadly to all proteins/protein fragments comprising CDR regions including Fab, F (ab') 2, fd, fv, scFv, diabodies, minimum recognition units for antibodies, and single chain derivatives of these antibodies and fragments. The term "antibody" includes polyclonal and monoclonal antibodies, as well as antigenic compound-binding fragments of such antibodies.
The "F (ab ') 2" and "Fab'" moieties can be produced by treating Ig with proteases such as pepsin and papain, and includes antibody fragments produced by digestion of immunoglobulins in the vicinity of disulfide bonds that exist between hinge regions within each of the 2 heavy chains. For example, papain cleaves IgG upstream of disulfide bonds between hinge regions present within each of 2 heavy chains to produce 2 cognate antibody fragments in which a light chain consisting of VL and CL (light chain constant region) and a heavy chain fragment consisting of VH and CH γ regions (in the constant region of the heavy chain) are linked by disulfide bonds at their C-terminal regions. Each of these 2 homologous antibody fragments is called Fab'. Proteases also cleave IgG upstream of the disulfide bonds between hinge regions present within each of the 2 heavy chains to produce antibody fragments: the fragment is slightly larger than the 2 above-mentioned fragments in which the Fab' is linked at the hinge region. This antibody fragment is designated F (ab') 2.
The Fab fragment also contains the constant domain of the light chain and the first constant domain of the heavy chain (CH 1). Fab' fragments differ from Fab fragments in that several residues are added at the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region. Fab '-SH refers herein to a Fab': wherein the cysteine residues of the constant domain carry a free thiol group. F (ab ') 2 antibody fragments were originally produced as Fab' fragment pairs, which have a hinge cysteine between them. Other chemical couplings of antibody fragments are also known.
"Fv" refers to antibody fragments that contain an intact antigen recognition and antigen binding site. This region consists of a dimer of one heavy and one light chain variable domain, either tightly non-covalently or covalently bound (disulfide-linked Fv has been described in the art, reiter et al (1996) Nature Biotechnology 14 1239-1245. In this configuration, the 3 CDRs of each variable domain interact to define an antigen binding site on the surface of the VH-VL dimer. The combination of one or more CDRs from each VH and VL chain together confer antigen binding specificity to the antibody.
The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region (VL or VH) is composed of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The extent of the framework regions and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest), E.Kabat et al, U.S. department of Health and Human Services (U.S.. Department of Health and Human Services), (1983), and Chothia. The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.
Although the 2 domains of the Fv fragment (VL and VH) are encoded by separate genes, they can be joined using recombinant methods by synthetic linkers that enable them to be made into a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv), "single chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of an antibody, and in some embodiments, the Fv polypeptide additionally comprises a polypeptide linker between the VH and VL domains that enables the sFv to form the desired structure for antigen binding.
The more highly conserved portions of the variable domains are referred to as "backbones", "frameworks" or "FRs". The variable domains of the unmodified heavy and light chains each contain 4 FRs (FR 1, FR2, FR3 and FR 4) which mainly adopt a β -sheet configuration interspersed with 3 CDRs which form loops and in some cases join β -sheet moieties. The CDRs in each chain are held close together by the FRs and, together with the CDRs from the other chains, facilitate the formation of the antigen binding site of the antibody.
As used herein, "framework region", "framework" or "FR" region means the regions of the antibody variable domain excluding those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions (FR 1, FR2, FR3 and FR 4) separated by CDRs.
In general, the variable domains VL/VH of the heavy and light chains can be obtained by linking the CDRs and FRs, numbered as follows, in a combined arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
The type of antibody can be selected from IgG1, igG2, igG3, igG4, igA, igM, igE, and IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".
The term "purified" or "isolated" in relation to a protein, polypeptide, or nucleic acid, as used herein, means that the protein, polypeptide, or nucleic acid is not in its natural medium or in its natural form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally bound to or normally mixed with it or in solution. Isolated polypeptides include naturally-produced such polypeptides contained in cell lysates, in purified or partially purified form, recombinant polypeptides, such polypeptides expressed or secreted by cells, and such polypeptides in heterologous host cells or cultures. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).
The term "affinity" as used herein denotes the equilibrium constant for reversible binding of 2 agents and is expressed as KD. The affinity of a binding protein for a ligand, such as the affinity of an antibody for an epitope, can be, for example, about 100 nanomolar (nM) to about 0.1nM, about 100nM to about 1 picomolar (pM), or about 100nM to about 1 femtomolar (fM). The term "avidity" as used herein means the resistance of a complex of 2 or more agents to dissociation after dilution. Apparent affinity can be determined by methods such as enzyme-linked immunosorbent assay (ELISA) or any other technique familiar to those skilled in the art.
The term "homology" or "identity" or "similarity" as used herein refers to sequence similarity between two peptides or between two nucleic acid molecules. Each of homology and identity can be determined by comparing the position in each sequence, which are aligned for comparison purposes. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position; when equivalent positions are occupied by the same or similar amino acid residue (e.g., similar in steric and/or electronic properties), then the molecules can be said to be homologous (similar) at that position. The expression percent homology/similarity or identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. Deletion of residues (amino acids or nucleic acids) or the presence of additional residues in comparing two sequences also reduces identity and homology/similarity.
Exemplary embodiments of the invention
In some embodiments, the antigen binding domain has at least 80%,85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to the complementarity determining region of an amino acid sequence described below.
In some embodiments, the binding protein described herein has a K with CRP D Affinity, K, with a value of not more than 9.66E-09mol/L D Values may also be selected from 1.11 × 10E-10mol/L, 2 × 10-10mol/L, 3 × 010E-10mol/L, 4 × 110E-10mol/L, 5 × 210E-10mol/L, 6 × 310E-10mol/L, 7 × 410E-10mol/L, 8 × 510E-10mol/L, 9 × 610E-10mol/L, 1 × 710E-9mol/L, 2 × 10E-9mol/L, 3 × 10E-9mol/L, 4 × 10E-9mol/L, 5 × 10E-9mol/L, 6 × 10E-9mol/L, 7 × 10E-9mol/L, 8 × 10E-9mol/L, 9.66 × 10E-9mol/L; or 1.11E-10mol/L is more than or equal to KD and less than or equal to 9.66E-09mol/L;
in some embodiments, the binding proteins described herein may comprise 3 CDRs, 4 CDRs, 5 CDRs, 6 CDRs, and optionally, the CDRs may be any combination selected from the group consisting of heavy chain CDR regions and/or light chain CDR regions.
In some embodiments, the binding isThe protein is a "functional fragment" of an antibody, e.g., a nanobody, F (ab') 2 Fab', fab, fv, scFv (sc = single chain), diabodies (diabodies) and antibody minimal recognition units.
These functional fragments typically have the same binding specificity as the antibody from which they are derived. As those skilled in the art can surmise from the description of the present invention and the means of the related art, the antibody fragment of the present invention can be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction cleavage of disulfide bonds.
Antibody fragments can also be obtained by peptide synthesis by recombinant genetic techniques also known to those skilled in the art or by, for example, automated peptide synthesizers, such as those sold by Applied BioSystems and the like.
In some embodiments, the framework region sequence is a human framework sequence, such that a humanized antibody is formed.
In other embodiments, the known human framework sequences may also be modified by methods known in the art to alter the selection of one or more relevant framework amino acid positions, depending on various criteria. One criterion for selecting the relevant framework amino acids for alteration may be the relative difference in amino acid framework residues between the donor and acceptor molecules. Using this approach to select relevant framework positions for alteration has the advantage of avoiding any subjective bias in residue determination or any bias in the contribution of residues to CDR binding affinity.
In some embodiments, the constant region sequences of the present application include heavy chain constant regions, such as mu, delta, gamma, alpha, or epsilon chain constant regions of IgG1, igG2, igG3, igG4, igA, igE, igM, or IgD. Light chain constant regions, kappa light chain constant regions or lambda light chain constant regions may also be included.
Alternatively, in another embodiment, the constant region sequence may be substituted for at least one amino acid residue, while maintaining the activity or affinity of the binding protein.
In some embodiments, the nucleic acid sequences described herein are operably linked to an expression control sequence in a suitable expression vector and the expression vector is employed to transform a suitable unicellular host.
Wherein the nucleic acid sequence is operably linked to at least one regulatory sequence. "operably linked" means that the coding sequence is linked to the regulatory sequences in a manner which allows for expression of the coding sequence. Regulatory sequences are selected to direct the expression of the protein of interest in a suitable host cell, and include, but are not limited to, promoters, enhancers and other expression control elements.
In some embodiments, the nucleic acids of the invention or fragments thereof may be inserted into a suitable vector to form a cloning or expression vector carrying the nucleic acid fragments of the invention. Such novel vectors are also part of the present invention. The vector may comprise a plasmid, phage, cosmid, minichromosome, or virus, as well as naked DNA that is transiently expressed only in a particular cell. The cloning and expression vectors of the present invention are capable of autonomous replication and therefore are capable of providing high copy numbers for high level expression or high level replication purposes for subsequent cloning. The expression vector may comprise a promoter for driving expression of the nucleic acid fragment of the invention, optionally a nucleic acid sequence encoding a signal peptide for secretion or integration of the peptide expression product into a membrane, a nucleic acid fragment of the invention, and optionally a nucleic acid sequence encoding a terminator. When the expression vector is manipulated in a production strain or cell line, the vector, when introduced into a host cell, may or may not be integrated into the genome of the host cell. Vectors typically carry a replication site, as well as a marker sequence capable of providing phenotypic selection in transformed cells.
Various combinations of expression vectors can be used to express the nucleic acid sequences of the present invention. Useful expression vectors may be suitable plasmids, viral vectors, phages and the like. Suitable vectors include, but are not limited to: SV40 and derivatives of known bacterial plasmids, e.g., escherichia coli plasmids coli.el, pcr1, pbr322, pmb and their derivatives, plasmids such as RP4; phage DNA, e.g., numerous derivatives of phage λ, e.g., NM989 and other phage DNA, e.g., M13 and filamentous single-stranded phage DNA; yeast plasmids such as 2u plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from a combination of plasmids and phage DNA, such as plasmids that have been modified to employ phage DNA or other expression control sequences, and the like.
In other embodiments, the invention further comprises the step of introducing the vector comprising the nucleic acid into a host cell, which may employ any available technique. For eukaryotic cells, suitable techniques may include, for example, calcium phosphate transfection, DEAE dextran, electroporation, liposome-mediated transfection, and transduction using retroviruses or other viruses (e.g., vaccinia, or for insect cells, baculovirus). For bacterial cells, suitable techniques may include, for example, calcium chloride transformation, electroporation, and transfection using bacteriophages. Preferred host cells in the present invention are derived from mammalian cells, such as CHO cells. The transformed cells are capable of replicating the nucleic acid fragments of the invention.
In some embodiments, the indicator that shows signal intensity comprises any one of a fluorescent substance, a quantum dot, a digoxigenin-labeled probe, biotin, a radioisotope, a radiocontrast agent, a paramagnetic ion fluorescent microsphere, an electron-dense substance, a chemiluminescent label, an ultrasound contrast agent, a photosensitizer, colloidal gold, or an enzyme.
Many known nucleic acid manipulation techniques and methods, such as preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in: short Protocols in Molecular Biology, 2 nd edition, eds. Ausubel et al, john Wiley & Sons,1992.
Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example 1
This example provides an exemplary method for the preparation of anti-C-reactive protein antibodies.
S1, constructing an expression plasmid:
restriction enzyme, prime Star DNA polymerase in this example was purchased from Takara;
the MagExtractor-RNA extraction kit was purchased from TOYOBO;
BD SMART TM RACE cDNA Amplification Kit was purchased from Takara;
pMD-18T vector was purchased from Takara;
the plasmid extraction kit is purchased from Tiangen corporation;
primer synthesis and gene sequencing were done by Invitrogen;
secreting Anti-CRP 7C2 monoclonal antibody as existing hybridoma cell strain, and recovering for later use.
Design and synthesis of S11 primer:
5' RACE upstream primer for amplifying heavy chain and light chain:
SMARTER II A Oligonucleotide：
5’>AAGCAGTGGTATCAACGCAGAGTACXXXXX<3’；
5'-RACE CDS Primer(5'-CDS)：5’>(T) 25 VN<3’(N＝A,C,G,orT；V＝A,G,orC)；
Universal Primer A Mix(UPM)：
5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’；
Nested Universal Primer A(NUP)：
5’>AAGCAGTGGTATCAACGCAGAGT<3’；
mIgG CKR：5’>CTAACACTCATTCCTGTTGAAGCTCTTGACAAT<3’；
mHR：5’>TCATTTACCAGGAGAGTGGGAGAGGC<3’。
cloning and sequencing of variable region genes of an S12 antibody:
RNA is extracted from a hybridoma cell strain secreting Anti-CRP 7C2 monoclonal antibody, first strand cDNA synthesis is carried out by using a SMARTERTM RACE cDNA Amplification Kit and a SMARTER II A Oligonucleotide and 5' -CDS primer in the Kit, and an obtained first strand cDNA product is used as a PCR Amplification template. The Light Chain gene was amplified with Universal Primer A Mix (UPM), nested Universal Primer A (NUP), and mIgG CKR primers, and the Heavy Chain gene was amplified with Universal Primer A Mix (UPM), nested Universal Primer A (NUP), and mIgG CHR primers. The primer pair of Light Chain amplifies about 0.75KB of target band, and the primer pair of Heavy Chain amplifies about 1.4KB of target band. The product was purified and recovered by agarose gel electrophoresis, and the product was subjected to A addition reaction with rTaq DNA polymerase, inserted into pMD-18T vector, transformed into DH 5. Alpha. Competent cells, and after colonies were grown, 4 clones of the Heavy Chain and Light Chain genes were cloned, respectively, and sent to Invitrogen corporation for sequencing.
Sequence analysis of the S13 Anti-CRP 7C2 antibody variable region genes:
putting the gene sequence obtained by sequencing into an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene segment amplified by the Light Chain, the VL gene sequence is 336bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the Heavy Chain primer pair, the VH gene sequence is 357bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.
Construction of S14 recombinant antibody expression plasmid:
pcDNA TM 3.4
vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, bamHI, ecoRI and the like are introduced into the expression vector and named as pcDNA3.4A expression vector, and the vector is called as 3.4A expression vector for short in the following; according to the sequencing result of the antibody variable region gene in the pMD-18T, VL and VH gene specific primers of the Anti-CRP 7C2 antibody are designed, wherein two ends of the primers are respectively provided with HindIII and EcoRI enzyme cutting sites and protective bases, and the primers are as followsThe following:
CRP-7C2-HF：
5’>CCCAAGCTTGCCACCATGGAATGGAGCTGGGTCTTTC<3’
CRP-7C2-HR：
5’>CCCGAATTCTCATTATTTACCAGGAGAGTGGGAGAGGCTCTTCTC<3’
CRP-7C2-LF：
5’>CCCAAGCTTGCCACCATGGATTCACAGGCCCAGGTTCTTA<3
CRP-7C2-LR：
5’>CCCGAATTCTCATTAACACTCATTCCTGTTGAAGCTCTTGACAA<3。
a0.74 KB Light Chain gene fragment and a 1.42KB Heavy Chain gene fragment were amplified by PCR amplification. The gene fragments of the Heavy Chain and the Light Chain are subjected to double enzyme digestion by HindIII/EcoRI respectively, the 3.4A vector is subjected to double enzyme digestion by HindIII/EcoRI, the gene of the Heavy Chain and the gene of the Light Chain are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the Heavy Chain and the Light Chain are respectively obtained.
S2. Stable cell strain screening
Transient transfection of S21 recombinant antibody expression plasmid into CHO cells, determination of expression plasmid activity
Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10 7 cells/ml are put into a centrifuge tube, 100ul of plasmid is mixed with 700ul of cells, transferred into an electric rotating cup, electrically rotated, sampled and counted on days 3, 5 and 7, and sampled and detected on day 7.
Diluting goat anti-mouse IgG 1ug/ml with the coating solution to coat the microplate, wherein each well is 100uL, and the temperature is 4 ℃ overnight; the next day, washing with the washing solution for 2 times, and patting dry; adding sealing solution (1% casein), per well 120uL,37 deg.C, 1h, patting dry; adding diluted cell supernatant at 100 uL/hole at 37 deg.C for 30min; throwing off liquid in the plate, patting dry, adding 20% of mouse negative blood, sealing each hole at 120ul,37 ℃ for 1h; throwing off the liquid in the plate, patting to dry, adding 1ug/ml CRP antigen (BBI), 100uL per well, 37 deg.C, 30min; washing with washing solution for 5 times, and drying; adding a labeled HRP goat anti-CRP polyclonal antibody (1; adding a developing solution A (50 uL/hole), adding a developing solution B (50 uL/hole), and carrying out 10min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 uL/hole; OD readings were taken at 450nm (reference 630 nm) on the microplate reader. The results showed that the OD of the reaction after the cell supernatant was diluted 1000 times was still greater than 1.0, and the OD of the reaction in the wells without the cell supernatant was less than 0.1, indicating that the antibodies generated after transient plasmid transfer were both active against the CRP antigen.
Linearization of S22 recombinant antibody expression plasmids
The following reagents were prepared: 50ul Buffer, 100 ug/tube DNA, 10ul Puv I enzyme, and sterile water to 500ul, performing enzyme digestion in water bath at 37 ℃ overnight; extraction was performed sequentially with equal volumes of phenol/chloroform/isoamyl alcohol (lower layer) 25; precipitating with 0.1 times volume (water phase) of 3M sodium acetate and 2 times volume of ethanol on ice, rinsing with 70% ethanol, removing organic solvent, re-melting with appropriate amount of sterilized water after ethanol is completely volatilized, and finally measuring concentration. S23 recombinant antibody expression plasmid stable transfection, pressurized screening of stable cell strains
Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10 7 Putting cells/ml in a centrifuge tube, mixing 100ul plasmid and 700ul cells, transferring into an electric rotating cup, electrically rotating, and counting the next day; 25umol/L MSX 96-well pressure culture for about 25 days.
Observing the marked clone holes with cells under a microscope, and recording the confluence degree; taking culture supernatant, and carrying out sample detection; selecting cell strains with high antibody concentration and relative concentration, transferring the cell strains into 24 holes, and transferring the cell strains into 6 holes after 3 days; after 3 days, the seeds were kept and cultured in batches, and the cell density was adjusted to 0.5X 10 6 cells/ml,2.2ml, batch culture, cell density 0.3X 10 6 cells/ml,2ml for seed preservation; and (4) 7 days, carrying out batch culture supernatant sample sending detection in 6 holes, and selecting cell strains with small antibody concentration and cell diameter to transfer TPP for seed preservation and passage.
S3, recombinant antibody production
S31 cell expanding culture
After the cells were recovered, they were cultured in 125ml size shake flasks, inoculated with 30ml Dynamis medium at a culture medium volume of 100%, and placed in a shaker at a rotation speed of 120r/min and a temperature of 37 ℃ with 8% carbon dioxide. Culturing for 72h, inoculating and expanding at inoculation density of 50 ten thousand cells/ml, and calculating the expanding volume according to production requirements, wherein the culture medium accounts for 100 percent. Then the culture is expanded every 72 h. When the cell amount meets the production requirement, the production is carried out by strictly controlling the inoculation density to be about 50 ten thousand cells/ml.
S32 Shake flask production and purification
Shake flask parameters: the rotating speed is 120r/min, the temperature is 37 ℃, and the carbon dioxide is 8 percent. Feeding in a flowing mode: daily feeding was started when the culture was carried out for 72h in a shake flask, 3% of the initial culture volume was fed daily to HyCloneTM Cell BoostTM Feed 7a, and one thousandth of the initial culture volume was fed daily to Feed 7b, up to day 12 (day 12 feeding). Glucose was supplemented with 3g/L on the sixth day. Samples were collected on day 13. Affinity purification was performed using a proteinA affinity column. Mu.g of the purified antibody was subjected to reducing SDS-PAGE, and 4. Mu.g of an external control antibody was used as a control, and the electrophoretogram was shown in FIG. 1. Two bands were shown after reducing SDS-PAGE, 1 with 50kD Mr and 28kD Mr (light chain).
Example 2
Antibody affinity analysis and activity identification
The antibody obtained in example 1 was analyzed to have a light chain having a sequence shown in SEQ ID NO. 11 and a heavy chain having a sequence shown in 12.
Upon analysis, the complementarity determining region (WT) of the heavy chain:
CDR-VH1 is G-W (X1) -T-F-T-Q (X2) -Y-V (X3) -M-N;
CDR-VH2 is W-I (X1) -N-T-D (X2) -T-G-E-P-T-Y-A-E (X3) -E (X4) -F-K;
CDR-VH3 is A-L-S-I (X1) -S-R-L-N (X2) -W-Y-F (X3) -D-V;
complementarity determining regions of the light chain:
CDR-VL1 is R-A-S-N (X1) -S-V-S (X2) -A-S-P (X3) -Y-G-W (X4) -M-H;
CDR-VL2 is Y-A (X1) -S-Q (X2) -L-E-S;
CDR-VL3 is Q-N (X1) -S-W-E-L (X2) -P-C (X3) -T;
wherein X1, X2 and X3 are all the sites to be mutated.
TABLE 1 mutation sites related to antibody Activity
Based on the CDR sequences of WT obtained by the above analysis, the above mutation was performed at the corresponding site in Table 1, and the activity of each antibody after mutation was determined.
Diluting goat anti-mouse IgG 1ug/ml with the coating solution to coat the microplate, wherein each well is 100uL, and the temperature is 4 ℃ overnight; on the next day, washing with the washing solution for 2 times, and patting to dry; adding blocking solution (1% casein), per well 120uL,37 deg.C, 1h, patting dry; adding diluted CRP monoclonal antibody at 100 uL/hole, 37 deg.C for 30min; throwing off liquid in the plate, patting dry, adding 20% of mouse negative blood, sealing each hole at 120ul,37 ℃ for 1h; throwing off the liquid in the plate, patting to dry, adding 1ug/ml CRP antigen (BBI), 100uL per well, 37 deg.C, 30min; washing with washing solution for 5 times, and drying; adding goat anti-CRP polyclonal antibody labeled with HRP (1; adding a developing solution A (50 uL/hole), adding a developing solution B (50 uL/hole), and carrying out 10min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 uL/hole; OD readings were taken at 450nm (reference 630 nm) on the microplate reader.
TABLE 2 antibody Activity assay data
As can be seen from the above table, the activity effect of mutation 1 is the best, so mutation 1 is used as the framework sequence for further mutation and screening to obtain the mutant sequence with better potency, the sites after partial mutation are shown in Table 3, and the affinity analysis results of the corresponding binding protein are shown in Table 4.
TABLE 3 mutation sites related to antibody affinity
Affinity assay
Performing data by enzyme-mediated immunoassay in the same way as activity identification, and coating to obtain four gradients of 2ug/ml, 1ug/ml and 0.5ug/ml; the antibody was diluted in a 2-fold gradient starting at 1000ng/ml to 0.977ng/ml loading. And obtaining the OD values corresponding to different antibody concentrations under the conditions of no coating concentration. Under the same coating concentration, taking the antibody concentration as a horizontal coordinate and the OD value as a vertical coordinate, carrying out logarithmic plotting, and calculating the antibody concentration at the 50% maximum OD value according to a fitting equation; substitution into the formula: k = (n-1)/(2 × (n × Ab ') -Ab)), where Ab and Ab' respectively represent antibody concentrations at 50% maximum OD values at the corresponding coating concentration (Ag, ag '), and n = Ag/Ag'; every two coating concentrations can be combined to calculate a K value, and finally three K values can be obtained, and the average value is taken, and the reciprocal value is obtained to obtain the affinity constant K D 。
Table 4 affinity assay data
As can be seen from Table 4, the mutant sequences corresponding to the mutation sites listed in Table 3 all have better affinity.
To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.
TABLE 5 mutations with WT as backbone
Table 6 affinity assay data
From the analysis in tables 5 and 6, the mutant sequences corresponding to the above mutation sites all have certain affinity under the premise of ensuring antibody activity.
The applicant verifies that the antibody in table 4 and another internal antibody (an antibody matched with an antibody of the original WT sequence) are subjected to antibody matching experiments, the properties of the antibody and the WT antibody are not obviously changed, and the specificity is maintained at the original high level and is not obviously changed through the verification of the double-antibody sandwich method matching experiments, which indicates that the antibody and the WT antibody before mutation recognize the same epitope. But showed higher sensitivity due to the increased activity and affinity of the mutant antibody.
Stability analysis
Placing the same batch of antibodies based on the mutation 1 in 4 ℃ (refrigerator), -80 ℃ (refrigerator), 37 ℃ (thermostat) for 21 days, taking samples in 7 days, 14 days, 21 days for state observation, and performing activity detection on the samples in 21 days to analyze the stability of the antibodies, wherein the result shows that no obvious protein state change is seen in 21 days of antibody placement under three examination conditions, and the activity is not more reduced along with the increase of the examination temperature, thus indicating that the self-produced antibodies are stable.
Further, the stability of WT and 5 randomly extracted mutant antibodies (WT 1-1, WT 1-2, WT1-8, WT1-9, mutant 1-12) were tested; the antibody is stored at 37 ℃ for 72 hours, and then taken out and detected with the same batch of antibody stored at 4 ℃ for 72 hours under the same detection condition to obtain the same negative and positive quality control samples, the detection method is the antibody activity analysis method adopted in the embodiment, the linearity of each group of antibodies can reach more than 99.90%, the CV value is lower than 10%, and the antibody activities stored at different temperatures have no statistical difference. This indicates that the antibodies all have excellent stability, and the mutation of the site has no influence on the stability.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Dongguan City of Pengzhi Biotech Co., ltd
<120> a binding protein comprising an antigen binding domain of C-reactive protein
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> PRT
<213> Artificial sequence
<400> 1
Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Gln Arg Ala Ser Ile Ser Cys
20
<210> 2
<211> 15
<212> PRT
<213> Artificial sequence
<400> 2
Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Arg Leu Leu Ile Lys
1 5 10 15
<210> 3
<211> 32
<212> PRT
<213> Artificial sequence
<400> 3
Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr His Phe Thr
1 5 10 15
Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys
20 25 30
<210> 4
<211> 11
<212> PRT
<213> Artificial sequence
<400> 4
Phe Gly Gly Gly Thr Asn Leu Glu Leu Lys Arg
1 5 10
<210> 5
<211> 25
<212> PRT
<213> Artificial sequence
<400> 5
Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu
1 5 10 15
Thr Val Lys Ile Ser Cys Lys Ala Ser
20 25
<210> 6
<211> 14
<212> PRT
<213> Artificial sequence
<400> 6
Trp Val Arg Gln Ile Pro Asp Lys Arg Leu Glu Trp Val Ala
1 5 10
<210> 7
<211> 31
<212> PRT
<213> Artificial sequence
<400> 7
Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ile Thr Ala Tyr Leu
1 5 10 15
Gln Ile Asn Asn Leu Lys Asn Glu Asp Val Ala Thr Tyr Phe Cys
20 25 30
<210> 8
<211> 11
<212> PRT
<213> Artificial sequence
<400> 8
Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ser
1 5 10
<210> 9
<211> 106
<212> PRT
<213> Artificial sequence
<400> 9
Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln
1 5 10 15
Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr
20 25 30
Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln
35 40 45
Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr
50 55 60
Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg
65 70 75 80
His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro
85 90 95
Ile Val Lys Ser Phe Asn Arg Asn Glu Cys
100 105
<210> 10
<211> 324
<212> PRT
<213> Artificial sequence
<400> 10
Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala
1 5 10 15
Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr
20 25 30
Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser
35 40 45
Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu
50 55 60
Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val
65 70 75 80
Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys
85 90 95
Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro
100 105 110
Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu
115 120 125
Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser
130 135 140
Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu
145 150 155 160
Val His Thr Ala Gln Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr
165 170 175
Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn
180 185 190
Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro
195 200 205
Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln
210 215 220
Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val
225 230 235 240
Ser Leu Thr Cys Met Ile Thr Asn Phe Phe Pro Glu Asp Ile Thr Val
245 250 255
Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln
260 265 270
Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn
275 280 285
Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val
290 295 300
Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His
305 310 315 320
Ser Pro Gly Lys
<210> 11
<211> 218
<212> PRT
<213> Artificial sequence
<400> 11
Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Gln Arg Ala Ser Ile Ser Cys Arg Ala Ser Asn Ser Val Ser Ala Ser
20 25 30
Pro Tyr Gly Trp Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro
35 40 45
Arg Leu Leu Ile Lys Tyr Ala Ser Gln Leu Glu Ser Gly Val Pro Ala
50 55 60
Arg Phe Ser Gly Ser Gly Ser Gly Thr His Phe Thr Leu Asn Ile His
65 70 75 80
Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Ser Trp
85 90 95
Glu Leu Pro Cys Thr Phe Gly Gly Gly Thr Asn Leu Glu Leu Lys Arg
100 105 110
Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln
115 120 125
Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr
130 135 140
Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln
145 150 155 160
Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr
165 170 175
Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg
180 185 190
His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro
195 200 205
Ile Val Lys Ser Phe Asn Arg Asn Glu Cys
210 215
<210> 12
<211> 444
<212> PRT
<213> Artificial sequence
<400> 12
Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu
1 5 10 15
Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Trp Thr Phe Thr Gln Tyr
20 25 30
Val Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met
35 40 45
Gly Trp Ile Asn Thr Asp Thr Gly Glu Pro Thr Tyr Ala Glu Glu Phe
50 55 60
Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ile Thr Ala Tyr
65 70 75 80
Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Val Ala Thr Tyr Phe Cys
85 90 95
Ala Leu Ser Ile Ser Arg Leu Asn Trp Tyr Phe Asp Val Trp Gly Ala
100 105 110
Gly Thr Thr Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val
115 120 125
Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr
130 135 140
Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr
145 150 155 160
Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val
165 170 175
Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser
180 185 190
Ser Thr Trp Pro Ser Gln Thr Val Thr Cys Asn Val Ala His Pro Ala
195 200 205
Ser Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys
210 215 220
Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe
225 230 235 240
Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val
245 250 255
Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe
260 265 270
Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Lys Pro
275 280 285
Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro
290 295 300
Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val
305 310 315 320
Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr
325 330 335
Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys
340 345 350
Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asn
355 360 365
Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro
370 375 380
Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser
385 390 395 400
Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala
405 410 415
Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His
420 425 430
His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Lys
435 440
Claims (23)
1. An isolated binding protein comprising a C-reactive protein antigen binding domain, wherein the antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL3;
CDR-VH1 is G-X1-T-F-T-X2-Y-X3-M-N, wherein X1 is Y;
CDR-VH2 is W-X1-N-T-X2-T-G-E-P-T-Y-A-X3-X4-F-K, wherein X4 is D;
CDR-VH3 is A-L-S-X1-S-R-L-X2-W-Y-X3-D-V, wherein X1 is L;
CDR-VL1 is R-A-S-X1-S-V-X2-A-S-X3-Y-G-X4-M-H, wherein X3 is G;
CDR-VL2 is Y-X1-S-X2-L-E-S, wherein X2 is N;
CDR-VL3 is Q-X1-S-W-E-X2-P-X3-T, wherein X1 is H;
the mutation site of each complementarity determining region is selected from any one of the following mutations:
。
2. An isolated binding protein comprising a C-reactive protein antigen binding domain, wherein the antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL3;
CDR-VH1 is G-X1-T-F-T-X2-Y-X3-M-N, wherein X1 is W;
CDR-VH2 is W-X1-N-T-X2-T-G-E-P-T-Y-A-X3-X4-F-K, wherein X4 is E;
CDR-VH3 is A-L-S-X1-S-R-L-X2-W-Y-X3-D-V, wherein X1 is I;
CDR-VL1 is R-A-S-X1-S-V-X2-A-S-X3-Y-G-X4-M-H, wherein X3 is P;
CDR-VL2 is Y-X1-S-X2-L-E-S, wherein X2 is Q;
CDR-VL3 is Q-X1-S-W-E-X2-P-X3-T, wherein X1 is N;
the mutation site of each complementarity determining region is selected from any one of the following mutations:
。
3. The binding protein of 1~2, wherein the binding protein is F (ab') 2 Fab', fab, fv, scFv and diabody.
4. The binding protein according to any one of claims 1~2, comprising light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence given in SEQ ID NOs 1 to 4 and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence given in SEQ ID NOs 5 to 8.
5. The binding protein of 1~2, wherein the binding protein further comprises an antibody constant region sequence.
6. The binding protein according to claim 5, wherein said constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, igG2, igG3, igG4, igA, igM, igE, and IgD.
7. The binding protein of claim 5, wherein the species of said constant region is derived from a cow, horse, pig, sheep, goat, rat, mouse, dog, cat, rabbit, donkey, deer, mink, chicken, duck, goose, or human.
8. The binding protein of claim 7, wherein the species source of said constant region is a bovine.
9. The binding protein of claim 7, wherein said species source of the constant region is turkey or turkey.
10. The binding protein according to claim 7, wherein said constant region is derived from a mouse.
11. The binding protein according to claim 10, wherein said light chain constant region sequence is set forth in SEQ ID NO 9;
the heavy chain constant region sequence is shown as SEQ ID NO. 10.
12. An isolated nucleic acid molecule which is DNA or RNA and which encodes a binding protein according to any one of claims 1 to 11.
13. A vector comprising the nucleic acid molecule of claim 12.
14. A host cell transformed with the vector of claim 13.
15. The host cell of claim 14, wherein the host cell is a mammalian cell.
16. The host cell of claim 14, wherein the host cell is a Chinese Hamster Ovary (CHO) cell, a HeLa cell, a young hamster kidney cell, and an NS0 mouse myeloma cell.
17. A method of producing the binding protein of any one of claims 1 to 11, comprising the steps of:
culturing the host cell of any one of claims 14 to 16 under suitable culture conditions, and recovering the produced binding protein from the culture medium or from the cultured host cell.
18. Use of the binding protein of any one of claims 1 to 11 in the preparation of a reagent for detecting a CRP antigen.
19. Use of the binding protein of any one of claims 1 to 11 for the preparation of a kit for detecting CRP in a test sample, comprising:
a) Contacting the CRP antigen in the test sample with the binding protein of any one of claims 1 to 11 under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex;
b) Detecting the presence of the immune complex.
20. The use of claim 19, wherein in step a) the immune complex further comprises a second antibody, said second antibody binding to said binding protein.
21. The use of claim 19, wherein in step a) the immune complex further comprises a second antibody, wherein the second antibody binds to the CRP antigen.
22. An agent or kit comprising the binding protein of any one of claims 1 to 11.
23. A reagent or kit according to claim 22, characterised in that the reagent or kit further comprises one or more of a buffer, a stabiliser, a diluent and a carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911028232.7A CN112724251B (en) | 2019-10-28 | 2019-10-28 | Binding protein containing C-reactive protein antigen binding domain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911028232.7A CN112724251B (en) | 2019-10-28 | 2019-10-28 | Binding protein containing C-reactive protein antigen binding domain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112724251A CN112724251A (en) | 2021-04-30 |
| CN112724251B true CN112724251B (en) | 2022-11-08 |
Family
ID=75589267
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911028232.7A Active CN112724251B (en) | 2019-10-28 | 2019-10-28 | Binding protein containing C-reactive protein antigen binding domain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112724251B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5265257B2 (en) * | 2008-06-30 | 2013-08-14 | 富士フイルム株式会社 | Antibodies that recognize dog CRP and human CRP |
| CN106699884B (en) * | 2017-01-19 | 2020-04-17 | 江苏众红生物工程创药研究院有限公司 | Anti-human C-reactive protein antibody and application thereof |
| CN107022527B (en) * | 2017-03-24 | 2019-12-27 | 菲鹏生物股份有限公司 | Hybridoma cell capable of secreting anti-C-reactive protein monoclonal antibody, C-reactive protein detection reagent, and preparation method and application thereof |
-
2019
- 2019-10-28 CN CN201911028232.7A patent/CN112724251B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112724251A (en) | 2021-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20210035249A (en) | NS1 protein binding protein | |
| KR20210031946A (en) | NS1 protein binding protein and application | |
| CN109081869B (en) | Binding protein of NS1 protein | |
| JP7117088B2 (en) | Antibody, method for producing same, and method for improving thermal stability of antibody | |
| CN113121678B (en) | Recombinant antibody for resisting HIV-1P24 | |
| CN111018983B (en) | Anti-human cardiac troponin I antibody and application thereof | |
| CN111363044B (en) | Antibody for resisting generic specific plasmodium lactate dehydrogenase | |
| CN112724251B (en) | Binding protein containing C-reactive protein antigen binding domain | |
| CN112574303B (en) | Antibody for resisting C-reactive protein | |
| CN112979798B (en) | An isolated binding protein comprising a C-reactive protein antigen binding domain | |
| CN110818797A (en) | Recombinant antibody of anti-human CA153 protein | |
| TWI698643B (en) | Antibody and antibody fragments, kit and method for detecting miltenberger blood group antigen | |
| CN111363036B (en) | Recombinant antibody of anti-heart fatty acid binding protein | |
| CN112574304B (en) | Antibody for resisting C-reactive protein | |
| CN112745390A (en) | Binding protein containing NT-proBNP antigen binding structural domain | |
| CN112979804B (en) | An isolated binding protein comprising a procalcitonin antigen-binding domain | |
| CN112707964B (en) | Recombinant antibody for resisting N-terminal brain natriuretic peptide precursor | |
| CN112979799B (en) | Binding protein containing hemoglobin antigen structural domain | |
| CN113004402B (en) | Binding protein containing hemoglobin antigen structural domain | |
| CN111018980B (en) | Anti-human cardiac troponin I antibody and application thereof | |
| CN112079928B (en) | anti-PD-L1 monoclonal antibody | |
| CN111018977B (en) | Recombinant antibody of anti-human cardiac troponin I | |
| CN112979816B (en) | Binding proteins to CKMB and uses thereof | |
| CN111018991B (en) | anti-CA50 antibody and application thereof | |
| CN114751985A (en) | Tim-3 antibody, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |