CN112979798B

CN112979798B - An isolated binding protein comprising a C-reactive protein antigen binding domain

Info

Publication number: CN112979798B
Application number: CN201911307725.4A
Authority: CN
Inventors: 崔鹏; 何志强; 孟媛; 钟冬梅; 娄文娟; 唐丽娜
Original assignee: Dongguan Pengzhi Biotechnology Co Ltd
Current assignee: Dongguan Pengzhi Biotechnology Co Ltd
Priority date: 2019-12-18
Filing date: 2019-12-18
Publication date: 2022-11-04
Anticipated expiration: 2039-12-18
Also published as: CN112979798A

Abstract

The invention relates to an isolated binding protein containing a C-reactive protein antigen binding domain, and researches on the aspects of preparation, application and the like of the binding protein. The binding protein has strong activity and high affinity, and can be widely applied to the detection of C-reactive protein.

Description

An isolated binding protein comprising a C-reactive protein antigen binding domain

Technical Field

The invention relates to the technical field of immunization, in particular to an isolated binding protein containing a C-reactive protein antigen binding domain.

Background

C-reactive protein (CRP), an Acute phase-reactive protein (Acute phase protein), in 1930 Tillett and Fransic of AVERY laboratory of Loncher research institute in the United states, the serum of an Acute infection patient can have a precipitation reaction with C polysaccharide on the cell wall of pneumococci, and then the protein participating in the reaction is proved to be called C-reactive protein. CRP belongs to one of the members of the penetrator family, has a relative molecular mass of 115KD-140KD, is formed by combining 5 identical subunits in a non-covalent bond mode to form a symmetrical annular pentasphere, surrounds a hole-shaped structure in the middle, has a concave surface containing a ligand binding site, and has 206 amino acid residues in each subunit. In inflammation, infection and tissue injury, CRP is secreted into human blood after being synthesized mainly by liver under stimulation of cell factor (such as interleukin-6, tumor necrosis factor) and the like, and the half-life period in blood is about 19h. Peripheral blood lymphocytes are also able to synthesize small amounts of CRP.

CRP has multiple biological functions and participates in multiple self-physiology and pathophysiology processes. CRP has a high affinity for phosphatidylcholine residues and can bind to a variety of self-ligands (e.g., plasma cell lipoproteins, cell membranes of injured cells, micronuclein particles, opsonin cells, etc.) or foreign ligands (e.g., polysaccharides, phospholipids and components of microorganisms such as bacteria, fungi, parasites, etc.). CRP, when bound to these ligands, activates only the primary phase of the classical pathway of complement activation, limiting the development and magnitude of the late inflammatory response of complement activation. In addition, CRP can increase lymphocyte activity, enhance phagocytosis of macrophage to various bacteria and foreign matters, inhibit platelet aggregation, and resist inflammation.

With the progress of detection technology, the relationship between acute phase reaction protein, especially CRP, and acute infection, tissue vascular injury, etc. is more and more emphasized, and many research results find that it is one of the most important proteins in acute phase reaction protein and is also an important marker of human infection, and the change of its content in vivo has strong correlation with the occurrence and development of the following infectious diseases, cardiovascular diseases, autoimmune diseases, malignant tumors, depression, etc.

1) Serum CRP levels are a sensitive and objective indicator of bacterial infection. In general, the CRP concentration of the organism is lower, the CRP in the serum of newborn is less than 2mg/L, and the CRP in the serum of children and normal adults is less than or equal to 10mg/L. In infectious diseases, CRP concentration can rapidly rise within 6-8h, and peak in 24-48 h. The high peak value can reach hundreds of times of the normal value. But sharply decreases after the infection is eliminated, and can be recovered to be normal within one week.

CRP levels also correlate with the extent of infection and severity of infection. Various bacterial infections can cause CRP level increase, 10-99mg/L indicates focal or superficial infection, and more than or equal to 100mg/L indicates severe conditions such as septicemia or invasive infection. Thus, serum CRP levels can be used to predict the severity of infectious diseases, length of hospitalization, prognosis, and recurrence.

2) CRP can be used for differential diagnosis of bacterial and viral infections. CRP levels are elevated significantly upon bacterial infection and elevated more normally or mildly upon viral infection, and thus CRP may also aid in the differential diagnosis of bacterial and non-bacterial infections.

3) CRP is associated with early diagnosis and prognosis of autoimmune diseases. CRP can be elevated in the active phase of most connective tissue diseases. Connective tissue diseases are autoimmune diseases, including systemic lupus erythematosus, rheumatoid arthritis and the like, and although the causes, the pathologies, the expression forms and the treatment modes are different, autoimmune inflammations play an important role in the occurrence and development processes of the diseases. CRP is one of the important prediction indexes for early joint destruction and prognosis of rheumatoid arthritis

4) CRP can reflect the components of atherosclerotic plaques and predict the likelihood of plaque rupture, an independent predictor of cardiovascular disease. CRP level of patients with coronary heart disease and acute coronary syndrome is obviously increased, and the increased level has obvious correlation with the obstruction degree of coronary arteriosclerosis, the occurrence and prognosis of coronary heart disease terminal events and the degree of congestive heart failure.

5) CRP is associated with differential diagnosis and evaluation of tumors. The CRP level of the malignant tumor patients is mostly increased, and the combined detection of CRP and AFP can be used for differential diagnosis of liver cancer and liver benign diseases. CRP is of great significance for the treatment of tumors and the evaluation of the effect of surgery, and is helpful for the clinical evaluation of the tumor progress.

6) Elevation of CRP is closely associated with metabolic syndrome. In recent years, diabetes is also considered to be a chronic low-grade inflammatory disease mediated by cytokines, many inflammatory factors such as CRP are remarkably increased in patients with type II diabetes, CRP level in serum is closely related to increase of incidence rate of type II diabetes in people, and polymorphism of CRP gene is also related to incidence rate of diabetes.

In view of the important role of CRP in many fields, the detection of CRP has important clinical significance for the diagnosis, prognosis, evaluation, etc. of the above-mentioned diseases. At present, more CRP measuring methods exist, such as immunoprecipitation, immunoturbidimetry, labeled immunoassay, etc., among which immunoturbidimetry is most commonly used. The above-mentioned conventional immunoassay methods all require a monoclonal antibody against CRP.

For a long time, murine monoclonal antibodies produced by hybridoma technology have been widely used in research, clinical diagnosis and therapy. However, as the mouse peritoneal cavity is adopted for hybridoma production, the influence of individual mice is particularly great, the production is unstable, the batch difference is great, and the mouse autoantibody purification difficulty is great. And the existing anti-CRP antibody cannot be well applied to CRP detection due to low activity and poor affinity, so that the field has strong demand for a detection antibody which can be specifically bound with CRP and has good activity and affinity.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The invention provides an isolated binding protein with good activity and high affinity, which comprises a C-reactive protein (CRP) antigen binding domain, and a preparation method and application thereof.

The present invention provides an isolated binding protein comprising a C-reactive protein antigen binding domain, said antigen binding domain comprising at least one complementarity determining region of an amino acid sequence; or; has at least 80% sequence homology with the complementarity determining region of the amino acid sequence shown below and has K with CRP _D ≤9.37×10 ^-10 Affinity of mol/L;

CDR-VH1 is G-Y-T-X1-T-X2-Y-X3-M-H, wherein,

x1 is Y or F, X2 is S or T, X3 is Y, V or F;

the CDR-VH2 is Y-I-X1-P-Y-X2-D-G-T-X3-Y-N-X4-K-F-K-G, wherein,

x1 is N, H or Q, X2 is N or Q, X3 is R or K, X4 is E or D;

CDR-VH3 is A-R-X1-D-R-X2-H-Y-X3-L-D-Y, wherein,

x1 is S or T, X2 is I or L, X3 is G or A;

CDR-VL1 is R-A-S-X1-S-V-S-T-S-R-X3-S-Y-M, wherein,

x1 is N, H or Q, X2 is S or T, X3 is N or Q;

CDR-VL2 is Y-X1-S-N-L-X2-S, wherein,

x1 is I, L or V, X2 is E or D;

CDR-VL3 is Q-X1-S-X2-E-X3-P-P-T, wherein,

x1 is Q, H or N, X2 is Y, W or F, and X3 is I or L.

Further, the present invention provides an isolated binding protein comprising a C-reactive protein antigen binding domain, wherein:

in the complementarity determining region CDR-VH1, X1 is F;

in the CDR-VH2, X3 is R;

in the CDR-VH3, X2 is I;

in the complementarity determining region CDR-VL1, X2 is T;

in the complementarity determining region CDR-VL2, X2 is E;

in the complementarity determining region CDR-VL3, X3 is I;

in some embodiments, in the complementarity determining region CDR-VH1, X2 is independently selected from S;

in some embodiments, in the complementarity determining region CDR-VH1, X2 is independently selected from T;

in some embodiments, in the complementarity determining region CDR-VH1, X3 is independently selected from Y;

in some embodiments, in the complementarity determining region CDR-VH1, X3 is independently selected from V;

in some embodiments, in the complementarity determining region CDR-VH1, X3 is independently selected from F;

in some embodiments, in the complementarity determining region CDR-VH2, X1 is independently selected from N;

in some embodiments, in the complementarity determining region CDR-VH2, X1 is independently selected from H;

in some embodiments, in the complementarity determining region CDR-VH2, X1 is independently selected from Q;

in some embodiments, in the complementarity determining region CDR-VH2, X2 is independently selected from Q;

in some embodiments, in the complementarity determining region CDR-VH2, X2 is independently selected from N;

in some embodiments, in the complementarity determining region CDR-VH2, X4 is independently selected from E;

in some embodiments, in the complementarity determining region CDR-VH2, X4 is independently selected from D;

in some embodiments, in the complementarity determining region CDR-VH3, X1 is independently selected from S;

in some embodiments, in the complementarity determining region CDR-VH3, X1 is independently selected from T;

in some embodiments, in the complementarity determining region CDR-VH3, X3 is independently selected from G;

in some embodiments, in the complementarity determining region CDR-VH3, X3 is independently selected from a;

in some embodiments, in the complementarity determining region CDR-VL1, X1 is independently selected from N;

in some embodiments, in the complementarity determining region CDR-VL1, X1 is independently selected from H;

in some embodiments, in the complementarity determining region CDR-VL1, X1 is independently selected from Q;

in some embodiments, in the complementarity determining region CDR-VL1, X3 is independently selected from N;

in some embodiments, in the complementarity determining region CDR-VL1, X3 is independently selected from Q;

in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from I;

in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from L;

in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from V;

in some embodiments, in the complementarity determining region CDR-VL3, X1 is independently selected from Q;

in some embodiments, in the complementarity determining region CDR-VL3, X1 is independently selected from H;

in some embodiments, in the complementarity determining region CDR-VL3, X1 is independently selected from N;

in some embodiments, in the complementarity determining region CDR-VL3, X2 is independently selected from Y;

in some embodiments, in the complementarity determining region CDR-VL3, X2 is independently selected from W;

in some embodiments, in the complementarity determining region CDR-VL3, X2 is independently selected from F;

in some embodiments, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:

in some embodiments, the invention provides an isolated binding protein comprising a C-reactive protein antigen binding domain, wherein:

in the complementarity determining region CDR-VH1, X1 is Y;

in the complementarity determining region CDR-VH2, X3 is K;

in the CDR-VH3, X2 is L;

in the complementarity determining region CDR-VL1, X2 is S;

in the complementarity determining region CDR-VL2, X2 is D;

in the complementarity determining region CDR-VL3, X3 is L;

the mutation site of each of the remaining complementarity determining regions of the antigen binding domain is selected from any one of the following combinations of mutations:

the isolated binding protein provided by the invention has strong activity and high affinity with CRP (especially human CRP), and is suitable for detecting CRP content, especially human CRP content. Meanwhile, the binding protein obtained by the recombination method has small individual difference, small batch difference and stable quality, and is more beneficial to quality control and detection stability.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is an electrophoretogram of the monoclonal antibody against human CRP in example 1 of the present invention.

Detailed Description

The present invention may be understood more readily by reference to the following description of some embodiments of the invention and the detailed description of the examples included therein.

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such embodiments are necessarily varied. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Definition of terms

"isolated binding protein comprising an antigen binding domain" and "binding protein" generally refer to all proteins/protein fragments comprising CDR regions. The term "antibody" includes polyclonal and monoclonal antibodies and antigenic compound-binding fragments of these antibodies, including Fab, F (ab') 2, fd, fv, scFv, diabodies and minimal recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments.

The "F (ab ') 2" and "Fab'" moieties can be produced by treating Ig with proteases such as pepsin and papain, and includes antibody fragments produced by digestion of immunoglobulins in the vicinity of disulfide bonds that exist between hinge regions within each of the 2 heavy chains. For example, papain cleaves IgG upstream of disulfide bonds between hinge regions present within each of 2 heavy chains to produce 2 cognate antibody fragments in which a light chain consisting of VL and CL (light chain constant region) and a heavy chain fragment consisting of VH and CH γ regions (in the constant region of the heavy chain) are linked by disulfide bonds at their C-terminal regions. Each of these 2 homologous antibody fragments is called Fab'. Proteases also cleave IgG upstream of the disulfide bonds between hinge regions present within each of the 2 heavy chains to produce antibody fragments: the fragment is slightly larger than the 2 above-mentioned fragments in which the Fab' is linked at the hinge region. This antibody fragment is designated F (ab') 2.

The Fab fragment also contains the constant domain of the light chain and the first constant domain of the heavy chain (CH 1). Fab' fragments differ from Fab fragments in that several residues are added at the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region. Fab '-SH is herein denoted as such a Fab': wherein the cysteine residues of the constant domain carry a free thiol group. F (ab ') 2 antibody fragments were originally produced as Fab' fragment pairs, which have a hinge cysteine between them. Other chemical couplings of antibody fragments are also known.

"Fv" refers to antibody fragments that contain an intact antigen recognition and antigen binding site. This region consists of a dimer of one heavy and one light chain variable domain, either tightly non-covalently or covalently bound (disulfide-linked Fv has been described in the art, reiter et al (1996) Nature Biotechnology 14 1239-1245. In this configuration, the 3 CDRs of each variable domain interact to define an antigen binding site on the surface of the VH-VL dimer. The combination of one or more CDRs from each VH and VL chain together confer antigen binding specificity to the antibody.

The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region (VL or VH) is composed of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The extent of the framework regions and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest), E.Kabat et al, U.S. department of Health and Human Services (U.S.. Department of Health and Human Services), (1983), and Chothia. The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.

The more highly conserved portions of the variable domains are referred to as the "backbone", "framework" or "FR". The variable domains of the unmodified heavy and light chains each contain 4 FRs (FR 1, FR2, FR3 and FR 4) which mainly adopt a β -sheet configuration interspersed with 3 CDRs which form loops and in some cases join β -sheet moieties. The CDRs in each chain are held close together by the FRs and, together with the CDRs from the other chain, facilitate the formation of the antigen binding site of the antibody.

As used herein, "framework region", "framework" or "FR" region means the regions of the antibody variable domain excluding those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions (FR 1, FR2, FR3 and FR 4) separated by CDRs.

In general, the variable domains VL/VH of the heavy and light chains can be obtained by linking the CDRs and FRs, numbered as follows, in a combined arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

The type of antibody can be selected from IgG1, igG2, igG3, igG4, igA, igM, igE, and IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".

The term "purified" or "isolated" in relation to a protein, polypeptide, or nucleic acid, as used herein, means that the protein, polypeptide, or nucleic acid is not in its natural medium or in its natural form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally bound to or normally mixed with it or in solution. Isolated polypeptides include the naturally-produced polypeptide contained in a cell lysate, the polypeptide in purified or partially purified form, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous host cell or culture. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

The term "homology" or "identity" or "similarity" as used herein refers to sequence similarity between two peptides or between two nucleic acid molecules. Each of homology and identity can be determined by comparing the position in each sequence, which are aligned for comparison purposes. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position; when equivalent positions are occupied by the same or similar amino acid residue (e.g., similar in steric and/or electronic properties), then the molecules can be said to be homologous (similar) at that position. The expression percent homology/similarity or identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. Deletion of residues (amino acids or nucleic acids) or the presence of additional residues in comparing two sequences also reduces identity and homology/similarity.

Exemplary embodiments of the invention

In some embodiments, the antigen binding domain has at least 80%,85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to a complementarity determining region of an amino acid sequence having a sequence identity of K, to CRP _D The value is less than or equal to 9.37 multiplied by 10 ^-10 mol/L; in some embodiments, the K is _D Value of 9X 10 ^-10 mol/L、8×10 ^-10 mol/L、7×10 ^-10 mol/L、6×10 ^-10 mol/L、5×10 ^-10 mol/L、4×10 ^-10 mol/L、3×10 ^-10 mol/L、2×10 ^-10 mol/L、1×10 ^-10 mol/L、9×10 ^-11 mol/L、8×10 ^-11 mol/L、7×10 ^-11 mol/L、6×10 ^-11 mol/L、5×10 ^-11 mol/L、4×10 ^-11 mol/L、3×10 ^-11 mol/L、2×10 ^-11 mol/L、1.08×10 ^- ¹¹ mol/L。

Or 1.08X 10 ^-11 mol/L≤K _D ≤9.37×10 ^-10 mol/L；

In some embodiments, the binding protein comprises at least 3 CDRs (alternatively, 3 CDRs of a heavy chain, or 3 CDRs of a light chain).

In some embodiments, the binding proteins described herein may comprise 3 CDRs, 6 CDRs, and optionally, the CDRs may be any combination selected from the group consisting of heavy chain CDR regions and/or light chain CDR regions.

In some embodiments, the binding protein comprises at least 6 CDRs.

In some embodiments, the binding protein is an antibody that is a nanoparticleAntibody, F (ab') ₂ Fab', fab, fv, scFv (sc = single chain), diabodies (diabodies), or minimal recognition units for antibodies.

These functional fragments typically have the same binding specificity as the antibody from which they are derived. As those skilled in the art can surmise from the description of the present invention and the means of the related art, the antibody fragment of the present invention can be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction cleavage of disulfide bonds.

Antibody fragments can also be obtained by peptide synthesis by recombinant genetic techniques also known to those skilled in the art or by, for example, automated peptide synthesizers, such as those sold by Applied BioSystems and the like.

In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 having the sequences shown in SEQ ID NOS: 1-4 in order, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 having the sequences shown in SEQ ID NOS: 5-8 in order.

In some embodiments, the framework region sequence is a human framework sequence, such that a humanized antibody is formed.

In other embodiments, the known human framework sequences may also be modified by methods known in the art to alter the selection of one or more relevant framework amino acid positions, depending on various criteria. One criterion for selecting the relevant framework amino acids for alteration may be the relative difference in amino acid framework residues between the donor and acceptor molecules. Using this approach to select relevant framework positions for alteration has the advantage of avoiding any subjective bias in residue determination or any bias in the contribution of residues to CDR binding affinity.

In some embodiments, the constant region sequences of the present application include heavy chain constant regions, such as μ chain, δ chain, γ chain, α chain, or ε chain constant regions of IgG1, igG2, igG3, igG4, igA, igE, igM, or IgD. Light chain constant regions, kappa light chain constant regions or lambda light chain constant regions may also be included.

In some embodiments, the binding protein further comprises an antibody constant region sequence.

In some embodiments, the constant region sequence is selected from the group consisting of sequences of any of IgG1, igG2, igG3, igG4, igA, igM, igE, igD constant regions.

In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.

In some embodiments, the constant region is murine in origin.

In some embodiments, the light chain constant region sequence is set forth in SEQ ID NO 9 and the heavy chain constant region sequence is set forth in SEQ ID NO 10.

In some embodiments, the binding protein is an intact antibody comprising a variable region and a constant region.

Alternatively, in another embodiment, the constant region sequence may be substituted for at least one amino acid residue while maintaining the binding protein activity or affinity.

In another aspect, the invention also relates to an isolated nucleic acid molecule, which is DNA or RNA, which encodes a binding protein as described above.

In one aspect, the invention also relates to a vector comprising a nucleic acid molecule provided by the invention.

In another aspect, the present invention also relates to a host cell transformed with a vector as described above.

In some embodiments, the host cell includes bacterial, eukaryotic, yeast and baculovirus systems.

In some embodiments, the host cell is a eukaryotic cell, further a mammalian cell.

Mammalian cell lines useful for expression in the art include: chinese Hamster Ovary (CHO) cells, heLa cells, melengus kidney cells, NS0 mouse myeloma cells, and many others.

In some embodiments, the host cell is a CHO cell.

In some embodiments, the nucleic acid sequences described herein are operably linked to an expression control sequence in a suitable expression vector and the expression vector is employed to transform a suitable unicellular host.

Wherein the nucleic acid sequence is operably linked to at least one regulatory sequence. "operably linked" means that the coding sequence is linked to the regulatory sequences in a manner that allows for expression of the coding sequence. Regulatory sequences are selected to direct the expression of the protein of interest in a suitable host cell, and include, but are not limited to, promoters, enhancers and other expression control elements.

In some embodiments, the nucleic acids of the invention or fragments thereof may be inserted into a suitable vector to form a cloning or expression vector carrying the nucleic acid fragments of the invention. Such novel vectors are also part of the present invention. The vector may comprise a plasmid, phage, cosmid, minichromosome, or virus, as well as naked DNA that is transiently expressed only in a particular cell. The cloning and expression vectors of the present invention are capable of autonomous replication and therefore are capable of providing high copy numbers for high level expression or high level replication purposes for subsequent cloning. The expression vector may comprise a promoter for driving expression of the nucleic acid fragment of the invention, optionally a nucleic acid sequence encoding a signal peptide for secretion or integration of the peptide expression product into a membrane, a nucleic acid fragment of the invention, and optionally a nucleic acid sequence encoding a terminator. When the expression vector is manipulated in a production strain or cell line, the vector, when introduced into a host cell, may or may not be integrated into the genome of the host cell. Vectors typically carry a replication site, as well as a marker sequence capable of providing phenotypic selection in transformed cells.

Various combinations of expression vectors can be used to express the nucleic acid sequences of the present invention. Useful expression vectors may be suitable plasmids, viral vectors, phages and the like. Suitable vectors include, but are not limited to: SV40 and known derivatives of bacterial plasmids, e.g., escherichia coli plasmids coli, el, pcr1, pbr322, pmb9 and their derivatives, plasmids such as RP4; phage DNA, e.g., numerous derivatives of phage λ, e.g., NM989 and other phage DNA, e.g., M13 and filamentous single-stranded phage DNA; yeast plasmids such as the 2u plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from a combination of plasmids and phage DNA, such as plasmids that have been modified to employ phage DNA or other expression control sequences, and the like.

In other embodiments, the invention further comprises the step of introducing the vector comprising the nucleic acid into a host cell, which may employ any available technique. For eukaryotic cells, suitable techniques may include, for example, calcium phosphate transfection, DEAE dextran, electroporation, liposome-mediated transfection, and transduction using retroviruses or other viruses (e.g., vaccinia, or for insect cells, baculovirus). For bacterial cells, suitable techniques may include, for example, calcium chloride transformation, electroporation, and transfection using bacteriophages.

According to one aspect of the invention, the invention also relates to a method for producing a binding protein as described above, said method comprising the steps of:

culturing the host cell as described above in suitable culture conditions and recovering the binding protein as described above from the culture medium or from the cultured host cell.

According to one aspect of the invention, the invention also relates to the use of a binding protein as described above for the preparation of a diagnostic agent or kit for the diagnosis of a disease associated with a change in CRP levels.

In some embodiments, the disease associated with a change in CRP level is an infectious disease, a cardiovascular disease, an autoimmune disease, a tumor, and depression.

In some embodiments, the infectious disease comprises a bacterial infection, a fungal infection, or a viral infection.

In some embodiments, the autoimmune disease comprises systemic lupus erythematosus, multiple sclerosis, type I diabetes, psoriasis, ulcerative colitis, sjogren's syndrome, scleroderma, polymyositis, rheumatoid arthritis, mixed connective tissue disease, primary biliary cirrhosis, autoimmune hemolytic anemia, hashimoto's thyroiditis, addisons disease, vitiligo, graves disease, myasthenia gravis, ankylosing spondylitis, allergic osteoarthritis, allergic vasculitis, autoimmune neutropenia, idiopathic thrombocytopenic purpura, lupus nephritis, chronic atrophic gastritis, autoimmune infertility, endometriosis, pasture disease, pemphigus, discoid lupus or dense deposit disease.

According to one aspect of the invention, the invention also relates to a method of detecting a CRP antigen in a test sample, comprising:

a) Contacting the CRP antigen in the test sample with a binding protein described in the present invention to form an immune complex under conditions sufficient for an antibody/antigen binding reaction to occur;

b) Detecting the presence of the immune complex.

In the above embodiments, the presence of the immune complex in step b) is indicative of the presence of the CRP antigen in the test sample.

In the above embodiments, the binding protein may be labeled with an indicator showing signal intensity to allow the immune complex to be easily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

in this embodiment, the binding protein forms a partner antibody with the second antibody in the form of a first antibody for binding to a different epitope of CRP;

the second antibody may be labeled with an indicator showing the intensity of the signal so that the complex is easily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the CRP antigen;

in this embodiment, the binding protein serves as an antigen for the second antibody, which may be labeled with an indicator that indicates the strength of the signal to allow the complex to be readily detected.

In some embodiments, the indicator that shows signal intensity comprises any one of a fluorescent substance, a quantum dot, a digoxigenin-labeled probe, biotin, a radioisotope, a radiocontrast agent, a paramagnetic ion fluorescent microsphere, an electron-dense substance, a chemiluminescent label, an ultrasound contrast agent, a photosensitizer, colloidal gold, or an enzyme.

Further, another aspect of the present invention relates to a detection reagent or kit comprising the binding protein as described above.

In some embodiments, the reagent or kit further comprises one or more of a buffer, a stabilizer, a preservative, a diluent, or a carrier.

Further, the buffer is one or more of Tris buffer, TAPSO buffer, potassium dihydrogen phosphate-sodium hydroxide buffer, barbital buffer, MOPS buffer, HEPES buffer, PIPES buffer, tricine and phosphate buffer.

The stabilizer is one or more of glycine, arginine, sucrose, mannitol, glycerol, trehalose, glucose, casein, chitosan and bovine serum albumin.

The preservative is one or more of benzoic acid and salts thereof, sorbic acid and salts thereof, phenoxyethanol, formaldehyde and Proclin 300.

Many known nucleic acid manipulation techniques and methods, such as preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in: short Protocols in Molecular Biology, 2 nd edition, eds. Ausubel et al, john Wiley & Sons,1992.

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are conventional products which are commercially available, and are not indicated by manufacturers.

Example 1

This example provides an exemplary method for the preparation of anti-C-reactive protein antibodies.

S1, constructing an expression plasmid:

restriction enzyme, prime Star DNA polymerase in this example was purchased from Takara;

the MagExtractor-RNA extraction kit was purchased from TOYOBO;

BD SMART ^TM RACE cDNA Amplification Kit was purchased from Takara;

pMD-18T vector was purchased from Takara;

the plasmid extraction kit is purchased from Tiangen corporation;

primer synthesis and gene sequencing were done by Invitrogen;

the Anti-CRP monoclonal antibody is secreted as an existing hybridoma cell strain, and is recovered for later use.

Design and synthesis of S11 primer:

5' RACE upstream primer for amplifying heavy chain and light chain:

SMARTER II A Oligonucleotide：

5’>AAGCAGTGGTATCAACGCAGAGTACXXXXX<3’；

5'-RACE CDS Primer(5'-CDS)：5’>(T)25VN<3’(N＝A,C,G,orT；V＝A,G,orC)；

Universal Primer A Mix(UPM):

5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’；

Nested Universal Primer A(NUP):

5’>AAGCAGTGGTATCAACGCAGAGT<3’；

mIgG CKR：5’>CTAACACTCATTCCTGTTGAAGCTCTTGACAAT<3’；

mIgG CHR：5’>TCATTTACCAGGAGAGTGGGAGAGGC<3’。

cloning and sequencing of variable region genes of an S12 antibody:

RNA is extracted from hybridoma cell strains secreting Anti-CRP monoclonal antibodies, first strand cDNA synthesis is carried out by using a SMARTERTM RACE cDNA Amplification Kit and SMARTER II A Oligonucleotide and 5' -CDS primers in the Kit, and obtained first strand cDNA products are used as PCR Amplification templates. The Light Chain gene was amplified with Universal Primer A Mix (UPM), nested Universal Primer A (NUP) and mIgG CKR primers, and the Heavy Chain gene was amplified with Universal Primer A Mix (UPM), nested Universal Primer A (NUP) and mIgG CHR primers. The primer pair of Light Chain can amplify target band about 0.75KB, and the primer pair of Heavy Chain can amplify target band about 1.4 KB. The product was purified and recovered by agarose gel electrophoresis, and the product was inserted into pMD-18T vector after A-addition reaction with rTaq DNA polymerase, transformed into DH 5. Alpha. Competent cells, and after colonies were grown, 4 clones of the Heavy Chain and Light Chain genes were cloned, respectively, and sent to Invitrogen corporation for sequencing.

Sequence analysis of the S13 antibody variable region genes:

putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene fragment amplified by the Light Chain, the VL gene sequence is 336bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the Heavy Chain primer pair, the VH gene sequence is 357bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.

Construction of S14 recombinant antibody expression plasmid:

pcDNA ^TM 3.4

vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, bamHI, ecoRI and the like are introduced into the expression vector and are named as pcDNA3.4A expression vector, which is called 3.4A expression vector for short in the following; according to the sequencing result of the antibody gene in the pMD-18T, the light chain and heavy chain gene specific primers of the Anti-CRP 9C11 antibody are designed, the two ends are respectively provided with HindIII and EcoRI enzyme cutting sites and protective basic groups,the primers are as follows:

CRP-9C11-HF：5’>CCCAAGCTTGCCACCATGGAATGGAGCTGGGTCTTTC<3’；

CRP-9C11-HR:5’>CCCGAATTCTCATTATTTACCAGGAGAGTGGGAGAGGCTCTTCTC<3’；

CRP-9C11-LF:5’>CCCAAGCTTGCCACCATGGATTCACAGGCCCAGGTTCTTA<3’；

CRP-9C11-LR:5’>CCCGAATTCTCATTAACACTCATTCCTGTTGAAGCTCTTGACAA<3’；

a0.75 KB Light Chain gene fragment and a 1.43KB Heavy Chain gene fragment were amplified by PCR amplification. The Heavy Chain and Light Chain gene fragments are respectively subjected to double digestion by HindIII/EcoRI, the 3.4A vector is subjected to double digestion by HindIII/EcoRI, the Heavy Chain gene and the Light Chain gene are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the Heavy Chain and the Light Chain are respectively obtained.

S2. Stable cell strain screening

Transient transfection of S21 recombinant antibody expression plasmid into CHO cells, determination of expression plasmid activity

The plasmid is diluted to 400ng/ml with ultrapure water, CHO cells are adjusted to be 1.43 multiplied by 107cells/ml, 100 mul of plasmid is mixed with 700 mul of cells, the mixture is transferred into an electric rotating cup and is electrically rotated, sampling and counting are carried out on 3 rd, 5 th and 7 th days, and sampling and detection are carried out on 7 th day.

The coating solution diluted CRP antigen (BBI) to 1ug/ml, 100 μ l per well, 4 deg.C overnight; on the next day, washing with the washing solution for 2 times, and patting to dry; add blocking solution (20% BSA +80% PBS) 120 μ l per well, 37 ℃,1h, patted dry; adding diluted cell supernatant 100 μ l/well at 37 deg.C for 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100 mu l per well at 37 ℃ for 30min; washing with the washing solution for 5 times, and drying; adding a developing solution A (50 μ l/hole), adding a developing solution B (50 μ l/hole), and standing for 10min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu l/hole; OD readings were taken at 450nm (reference 630 nm) on the microplate reader. The results showed that the OD of the reaction after the cell supernatant was diluted 1000 times was still greater than 1.0, and the OD of the reaction without the cell supernatant was less than 0.1, indicating that the antibodies generated after transient transformation of the plasmid were both active against the CRP antigen.

Linearization of S22 recombinant antibody expression plasmids

The following reagents were prepared: 50 mul Buffer, 100ug DNA/tube, 10 mul PuvI enzyme, and sterile water to 500 mul, and performing enzyme digestion in water bath at 37 deg.C overnight; extraction was performed sequentially with equal volumes of phenol/chloroform/isoamyl alcohol (lower layer) 25; precipitating with 0.1 times volume (water phase) of 3M sodium acetate and 2 times volume of ethanol on ice, rinsing with 70% ethanol, removing organic solvent, re-melting with appropriate amount of sterilized water after ethanol is completely volatilized, and finally measuring concentration.

S23 recombinant antibody expression plasmid stable transfection, pressurized screening of stable cell strains

Diluting the plasmid to 400ng/ml with ultrapure water, adjusting CHO cells to 1.43 multiplied by 107cells/ml, mixing 100 mul plasmid and 700 mul cells, transferring to an electric rotating cup, electrically rotating, and counting the next day; 25 u mol/L MSX 96 hole pressure culture about 25 days.

Observing the marked clone holes with cells under a microscope, and recording the confluence degree; taking culture supernatant, and sending the culture supernatant to a sample for detection; selecting cell strains with high antibody concentration and relative concentration, transferring the cell strains into 24 holes, and transferring the cell strains into 6 holes after 3 days; after 3 days, preserving and batch culturing, adjusting the cell density to be 0.5 multiplied by 106cells/ml, carrying out batch culture by 2.2ml, preserving the seeds by the cell density to be 0.3 multiplied by 106cells/ml and 2 ml; and (4) 7 days, carrying out batch culture supernatant sample sending detection in 6 holes, and selecting cell strains with small antibody concentration and cell diameter to transfer TPP for seed preservation and passage.

S3, recombinant antibody production

S31 cell expanding culture

After the cells were recovered, they were cultured in 125ml size shake flasks, inoculated with 30ml Dynamis medium at a culture medium volume of 100%, and placed in a shaker at a rotation speed of 120r/min and a temperature of 37 ℃ with 8% carbon dioxide. Culturing for 72h, inoculating and expanding at inoculation density of 50 ten thousand cells/ml, and calculating the expanding volume according to production requirements, wherein the culture medium accounts for 100 percent. Then the culture is expanded every 72 h. When the cell amount meets the production requirement, the production is carried out by strictly controlling the inoculation density to be about 50 ten thousand cells/ml.

S32 Shake flask production and purification

Shake flask parameters: the rotating speed is 120r/min, the temperature is 37 ℃, and the carbon dioxide is 8 percent. Feeding in a flowing mode: daily feeding was started at 72h in the flask, 3% of the initial culture volume was fed daily by HyCloneTM Cell BoostTM Feed 7a, one thousandth of the initial culture volume was fed daily by Feed 7b, and was continued up to day 12 (day 12 feeding). Glucose was supplemented with 3g/L on the sixth day. Samples were collected on day 13. Affinity purification was performed using a proteinA affinity column. Mu.g of the purified antibody was subjected to reducing SDS-PAGE, and 4. Mu.g of an external control antibody was used as a control, and the electrophoretogram was shown in the figure. Two bands were shown after reducing SDS-PAGE, 1 with 50kD Mr and 28kD Mr (light chain).

Example 2

Antibody affinity analysis and activity identification

The antibody obtained in example 1 was analyzed to have a light chain having a sequence shown in SEQ ID NO. 11 and a heavy chain having a sequence shown in SEQ ID NO. 12.

Upon analysis, the complementarity determining region (WT) of the heavy chain:

CDR-VH1 is G-Y-T-Y (X1) -T-S (X2) -Y-F (X3) -M-H;

CDR-VH2 is Y-I-N (X1) -P-Y-Q (X2) -D-G-T-K (X3) -Y-N-E (X4) -K-F-K-G;

CDR-VH3 is A-R-T (X1) -D-R-L (X2) -H-Y-A (X3) -L-D-Y;

complementarity determining regions of the light chain:

CDR-VL1 is R-A-S-H (X1) -S-V-S-S (X2) -S-R-N (X3) -S-Y-M;

CDR-VL2 is Y-I (X1) -S-N-L-D (X2) -S;

CDR-VL3 is Q-Q (X1) -S-W (X2) -E-L (X3) -P-P-T;

wherein X1, X2 and X3 are all the sites to be mutated.

TABLE 1 mutant sites associated with antibody Activity

Based on the CDR sequences of WT obtained by the above analysis, the above mutation was performed at the corresponding site in Table 1, and the activity of each antibody after mutation was determined.

Diluting CRP antigen (BBI) with coating solution to 1ug/ml, coating with microporous plate at 4 deg.C overnight in each well of 100 μ l; the next day, washing with the washing solution for 2 times, and patting dry; blocking solution (20% BSA +80% PBS) was added, 120. Mu.l per well, 37 ℃,1h, patted dry; adding diluted CRP monoclonal antibody at a concentration of 100 μ l/well, washing at 37 deg.C for 30min for 5 times, and drying; adding a labeled goat anti-mouse IGG-HRP (1: 15K), washing with a washing solution at 37 ℃ for 30min for 5 times in each hole in a volume of 100. Mu.l, and patting to dry; adding a developing solution A (50 μ l/hole), adding a developing solution B (50 μ l/hole), and standing for 10min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu l/hole; OD readings were taken at 450nm (reference 630 nm) on the microplate reader.

TABLE 2 analysis of antibody Activity data

As can be seen from the above table, the activity of mutation 1 is the best, so further mutation and screening are carried out by using mutation 1 as a framework sequence, the sites after partial mutation are shown in table 3, and the results of affinity analysis of the corresponding binding proteins are shown in table 4.

TABLE 3 mutation sites related to antibody affinity

Affinity assay

Performing affinity analysis in the same way as activity identification, and coating four gradients of 2ug/ml, 1ug/ml and 0.5ug/ml; the antibody was diluted in a 2-fold gradient starting at 1000ng/ml to a loading of 0.977 ng/ml. And obtaining the OD values corresponding to different antibody concentrations under the conditions of no coating concentration. Under the same coating concentration, the antibody concentration is used as the abscissa, the OD value is used as the ordinate, the logarithm is plotted, and roots are obtainedCalculating the antibody concentration at 50% of the maximum OD value according to a fitting equation; substitution into the formula: k = (n-1)/(2 × (n × Ab ') -Ab)), calculating the reciprocal of the affinity constant, where Ab and Ab' represent the antibody concentration at 50% of maximum OD value at the corresponding coating concentration (Ag, ag '), respectively, n = Ag/Ag'; every two coating concentrations can be combined to calculate a K value, and finally three K values can be obtained, the average value is taken, and the reciprocal value is obtained to be the affinity constant K _D 。

Table 4 affinity assay data

As can be seen from Table 4, the mutant sequences corresponding to the mutation sites listed in Table 3 all have better affinity.

To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.

TABLE 5 mutations with WT as backbone

Table 6 affinity assay data

Sample name	K _D (M)	Sample name	K _D (M)
				WT	7.89E-10	WT1-5	4.40E-10
WT1-1	7.48E-10	WT1-6	8.74E-10
				WT1-2	3.83E-10	WT1-7	9.37E-10
WT1-3	7.98E-10	WT1-8	7.75E-10
				WT1-4	7.38E-10	WT1-9	8.66E-10
WT1-10	5.04E-10	WT1-11	8.28E-10
				WT1-12	3.78E-10

From the analysis in tables 5 and 6, the mutant sequences corresponding to the above mutant sites all have better affinity under the premise of ensuring the antibody activity.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Dongguan City of Pengzhi Biotech Co., ltd

<120> an isolated binding protein comprising a C-reactive protein antigen binding domain

<130> 2019.12.16

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> PRT

<213> Artificial sequence

<400> 1

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys

20

<210> 2

<211> 16

<212> PRT

<213> Artificial sequence

<400> 2

His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Lys

1 5 10 15

<210> 3

<211> 32

<212> PRT

<213> Artificial sequence

<400> 3

Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

1 5 10 15

Leu Asp Ile His Pro Val Glu Glu Asp Asp Thr Ala Thr Tyr Tyr Cys

20 25 30

<210> 4

<211> 11

<212> PRT

<213> Artificial sequence

<400> 4

Phe Gly Gly Gly Ile Lys Leu Glu Ile Lys Arg

1 5 10

<210> 5

<211> 25

<212> PRT

<213> Artificial sequence

<400> 5

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser

20 25

<210> 6

<211> 14

<212> PRT

<213> Artificial sequence

<400> 6

Trp Val Lys Gln Lys Pro Gly Gln Gly Leu Glu Trp Ile Gly

1 5 10

<210> 7

<211> 30

<212> PRT

<213> Artificial sequence

<400> 7

Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu

1 5 10 15

Leu Ser Ser Ile Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys

20 25 30

<210> 8

<211> 11

<212> PRT

<213> Artificial sequence

<400> 8

Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

1 5 10

<210> 9

<211> 106

<212> PRT

<213> Artificial sequence

<400> 9

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

1 5 10 15

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

20 25 30

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

35 40 45

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

50 55 60

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

65 70 75 80

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

85 90 95

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210> 10

<211> 323

<212> PRT

<213> Artificial sequence

<400> 10

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro

195 200 205

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln

210 215 220

Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val

225 230 235 240

Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val

245 250 255

Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln

260 265 270

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn

275 280 285

Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val

290 295 300

Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His

305 310 315 320

Ser Pro Gly

<210> 11

<211> 218

<212> PRT

<213> Artificial sequence

<400> 11

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser His Ser Val Ser Ser Ser

20 25 30

Arg Asn Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Lys Tyr Ile Ser Asn Leu Asp Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asp Ile His

65 70 75 80

Pro Val Glu Glu Asp Asp Thr Ala Thr Tyr Tyr Cys Gln Gln Ser Trp

85 90 95

Glu Leu Pro Pro Thr Phe Gly Gly Gly Ile Lys Leu Glu Ile Lys Arg

100 105 110

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

115 120 125

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

130 135 140

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

145 150 155 160

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

165 170 175

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

180 185 190

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

195 200 205

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

210 215

<210> 12

<211> 442

<212> PRT

<213> Artificial sequence

<400> 12

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Tyr Thr Ser Tyr

20 25 30

Phe Met His Trp Val Lys Gln Lys Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Tyr Gln Asp Gly Lys Arg Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Ile Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys

85 90 95

Ala Arg Thr Asp Arg Leu His Tyr Ala Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr

115 120 125

Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu

130 135 140

Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp

145 150 155 160

Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser

180 185 190

Thr Trp Pro Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser

195 200 205

Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys

210 215 220

Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro

225 230 235 240

Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr

245 250 255

Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser

260 265 270

Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg

275 280 285

Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile

290 295 300

Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn

305 310 315 320

Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys

325 330 335

Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu

340 345 350

Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe

355 360 365

Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala

370 375 380

Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr

385 390 395 400

Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly

405 410 415

Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His

420 425 430

Thr Glu Lys Ser Leu Ser His Ser Pro Gly

435 440

Claims

1. An isolated binding protein comprising a C-reactive protein antigen binding domain, wherein the antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL3;

CDR-VH1 is G-Y-T-X1-T-X2-Y-X3-M-H, wherein X1 is F;

CDR-VH2 is Y-I-X1-P-Y-X2-D-G-T-X3-Y-N-X4-K-F-K-G, wherein X3 is R;

CDR-VH3 is A-R-X1-D-R-X2-H-Y-X3-L-D-Y, wherein X2 is I;

CDR-VL1 is R-A-S-X1-S-V-S-X2-S-R-X3-S-Y-M, wherein X2 is T;

CDR-VL2 is Y-X1-S-N-L-X2-S, wherein X2 is E;

CDR-VL3 is Q-X1-S-X2-E-X3-P-P-T, wherein X3 is I;

the mutation site of each complementarity determining region is selected from any one of the following mutations:

mutations CDR-VH1 X2/X3 CDR-VH2 X1/X2/X4 CDR-VH3 X1/X3 CDR-VL1 X1/X3 CDR-VL2 X1 CDR-VL3 X1/X2 Mutation 1 S/F N/Q/E T/A H/N I Q/W Mutation 1-1 T/F N/N/D S/A H/Q L Q/Y Mutations 1-2 S/Y H/Q/E TG Q/N V Q/F Mutations 1-3 T/Y H/N/D S/G Q/Q I H/Y Mutations 1-4 S/V Q/Q/E S/A N/N V H/W Mutations 1 to 5 T/V Q/N/D S/G N/Q L H/F Mutations 1 to 6 S/Y Q/N/E T/A Q/Q V N/Y Mutations 1 to 7 S/V Q/Q/D T/G Q/N L N/W Mutations 1 to 8 S/F N/N/E S/G N/Q I N/F Mutations 1 to 9 T/Y N/Q/D T/A N/N L Q/F Mutations 1-10 T/V H/N/E T/G H/Q I N/Y Mutations 1 to 11 T/F H/Q/D S/A H/N V H/W Mutations 1 to 12 T/V Q/N/D T/G H/N I N/F Mutations 1 to 13 S/F H/Q/D S/G Q/N V H/Y Mutations 1 to 14 T/Y Q/Q/E T/A N/N L Q/W Mutations 1-15 S/Y N/N/E S/A N/Q V H/F Mutations 1-16 T/F H/N/D T/G H/Q L Q/Y Mutations 1-17 S/V Q/Q/D S/A Q/Q I N/W Mutations 1-18 T/V H/Q/E T/G N/Q L H/F Mutations 1-19 S/Y N/Q/D S/A Q/N I Q/Y Mutations 1-20 T/F N/N/D S/G Q/Q V N/W Mutations 1-21 S/V Q/N/E T/G H/N V Q/F Mutations 1-22 T/Y N/Q/E S/A H/Q I N/Y Mutations 1-23 S/F H/N/E T/A N/N L H/W Mutations 1-24 T/F Q/N/D T/G H/N I N/F Mutations 1-25 S/F Q/Q/E S/G Q/N L H/Y Mutations 1-26 T/Y N/N/D T/A N/N V Q/W Mutations 1-27 S/Y N/Q/E S/A N/Q L Q/Y Mutations 1-28 T/V H/N/D S/A H/Q V N/W Mutations 1-29 S/V H/Q/E S/G Q/Q I H/F Mutations 1-30 T/Y Q/Q/D T/A Q/Q V N/Y Mutations 1-31 T/V H/N/D T/G Q/N I H/W Mutations 1-32 T/F Q/N/E S/G N/Q L Q/F Mutations 1-33 S/Y N/Q/E T/A N/N I H/Y Mutations 1 to 34 S/V H/Q/D T/G H/Q L Q/W Mutations 1-35 S/F Q/N/D S/A H/N V N/F Mutations 1 to 36 S/V H/N/E S/G H/N I H/F Mutations 1-37 T/Y N/N/D T/G H/Q V Q/W Mutations 1-38 S/F N/Q/D S/A Q/N L N/Y Mutations 1-39 T/V Q/Q/E T/A Q/Q V Q/F Mutations 1-40 S/Y N/N/E T/G N/N L N/W Mutations 1-41 T/F H/Q/E S/G N/Q I H/Y Mutations 1-42 S/V N/Q/D T/A H/N L N/F Mutations 1-43 T/F N/N/E S/A Q/N V H/W Mutations 1-44 S/Y H/Q/D S/A N/N I Q/Y Mutations 1-45 T/Y H/N/E S/G N/Q V Q/F Mutations 1-46 S/F Q/Q/D T/A H/Q I N/Y Mutations 1-47 T/V Q/N/E T/G Q/Q L H/W Mutations 1-48 S/F Q/N/E T/G N/Q I N/F Mutations 1-49 T/F Q/Q/D S/A Q/N L H/Y Mutations 1-50 S/Y N/N/E T/G Q/Q V Q/W Mutations 1-51 T/Y N/Q/D S/A H/N I H/F Mutations 1-52 S/V H/N/E T/A H/Q L Q/Y Mutations 1-53 T/V H/Q/D S/A N/N V N/W Mutations 1-54 T/V N/Q/D TG Q/Q I Q/Y Mutations 1-55 S/Y N/N/E S/G Q/N V N/W Mutations 1-56 T/F H/Q/D S/G N/Q L H/F Mutations 1-57 S/V H/N/E T/A N/N V N/Y Mutations 1-58 T/Y Q/Q/D T/G H/Q L H/W Mutations 1-59 S/F Q/N/E S/A H/Q I Q/F Mutations 1-60 T/V N/Q/E S/G H/N L H/Y Mutations 1-61 S/F N/N/D T/G Q/Q I Q/W Mutations 1-62 T/Y H/Q/E S/A Q/N V N/F Mutations 1-63 S/Y H/N/D T/A H/N I H/F Mutations 1-64 T/F Q/Q/E T/G N/N V Q/W

。

2. An isolated binding protein comprising a C-reactive protein antigen binding domain, wherein the antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL3;

CDR-VH1 is G-Y-T-X1-T-X2-Y-X3-M-H, wherein X1 is Y;

CDR-VH2 is Y-I-X1-P-Y-X2-D-G-T-X3-Y-N-X4-K-F-K-G, wherein X3 is K;

CDR-VH3 is A-R-X1-D-R-X2-H-Y-X3-L-D-Y, wherein X2 is L;

CDR-VL1 is R-A-S-X1-S-V-S-X2-S-R-X3-S-Y-M, wherein X2 is S;

CDR-VL2 is Y-X1-S-N-L-X2-S, wherein X2 is D;

CDR-VL3 is Q-X1-S-X2-E-X3-P-P-T, wherein X3 is L;

the mutation site of each of the remaining complementarity determining regions of the antigen binding domain is selected from any one of the following mutations:

site of the body CDR-VH1 X2/X3 CDR-VH2 X1/X2/X4 CDR-VH3 X1/X3 CDR-VL1 X1/X3 CDR-VL2 X1 CDR-VL3 X1/X2 WT S/F N/Q/E T/A H/N I Q/W WT 1-1 T/F N/Q/D S/A N/N V Q/Y WT 1-2 T/V H/N/D T/A Q/Q L H/Y WT 1-3 T/F Q/N/D S/G N/Q I H/W WT 1-4 S/V Q/N/E S/A H/N L H/F WT 1-5 S/F H/Q/D T/G H/Q L N/Y WT 1-6 T/Y H/Q/E T/A Q/N V N/W WT 1-7 T/V Q/Q/E S/A N/N V N/F WT 1-8 T/V N/Q/E S/G N/N L Q/Y WT 1-9 T/F H/Q/D T/G N/Q I Q/W WT 1-10 S/Y Q/Q/D S/A H/Q L Q/F WT 1-11 S/V H/Q/E T/G H/N L H/Y WT 1-12 S/F N/N/D S/G Q/N I H/W

。

3. The binding protein according to any one of claims 1 to 2, wherein the binding protein is F (ab') ₂ Fab', fab, fv, scFv and diabody.

4. The binding protein according to any one of claims 1 to 2, wherein the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 with the sequences shown in SEQ ID NO. 1-4 in sequence, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 with the sequences shown in SEQ ID NO. 5-8 in sequence.

5. The binding protein according to any one of claims 1 to 2, further comprising an antibody constant region sequence.

6. The binding protein of claim 5, wherein said constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, igG2, igG3, igG4, igA, igM, igE, igD.

7. The binding protein of claim 5, wherein the species of said constant region is derived from a cow, horse, pig, sheep, goat, rat, mouse, dog, cat, rabbit, donkey, deer, mink, chicken, duck, goose, or human.

8. The binding protein of claim 7, wherein the species source of said constant region is a bovine.

9. The binding protein of claim 7, wherein said species source of the constant region is turkey or turkey.

10. The binding protein according to claim 7, wherein said constant region is derived from a mouse.

11. The binding protein according to claim 10,

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

12. An isolated nucleic acid molecule which is DNA or RNA and which encodes a binding protein according to any one of claims 1 to 11.

13. A vector comprising the nucleic acid molecule of claim 12.

14. A host cell transformed with the vector of claim 13.

15. The host cell of claim 14, wherein the host cell is a mammalian cell.

16. The host cell of claim 15, wherein the host cell comprises any one of Chinese Hamster Ovary (CHO) cells, heLa cells, melengus mouse kidney cells, and NS0 mouse myeloma cells.

17. A method of producing the binding protein of any one of claims 1 to 11, comprising the steps of:

culturing the host cell of any one of claims 14 to 16, and recovering and producing the binding protein from the culture medium or from the cultured host cell.

18. Use of a binding protein according to any one of claims 1 to 11 in the preparation of a reagent for detecting a C-reactive protein antigen.

19. Use of a binding protein according to any one of claims 1 to 11 in the preparation of a kit for detecting CRP in a test sample comprising:

a) Contacting the CRP antigen in the test sample with the binding protein of claim 3 to form an immune complex under conditions sufficient for an antibody/antigen binding reaction to occur;

b) Detecting the presence of the immune complex.

20. The use of claim 19, wherein in step a) the immune complex further comprises a second antibody, wherein the second antibody binds to the binding protein.

21. The use of claim 19, wherein in step a) the immune complex further comprises a second antibody, wherein the second antibody binds to the CRP antigen.

22. A reagent or kit comprising the binding protein of any one of claims 1 to 11.

23. A reagent or kit according to claim 22, further comprising one or more of a pharmaceutically acceptable excipient, buffer, stabiliser, diluent or carrier.