CN112979816B

CN112979816B - Binding proteins to CKMB and uses thereof

Info

Publication number: CN112979816B
Application number: CN201911308270.8A
Authority: CN
Inventors: 崔鹏; 何志强; 孟媛; 钟冬梅; 覃婷; 周全兴; 王晨
Original assignee: Fapon Biotech Inc
Current assignee: Fapon Biotech Inc
Priority date: 2019-12-18
Filing date: 2019-12-18
Publication date: 2022-11-08
Anticipated expiration: 2039-12-18
Also published as: CN112979816A

Abstract

The invention discloses a binding protein for CKMB and application thereof, relating to the technical field of antibodies. The binding proteins disclosed herein are directed to CKMB comprise an antigen binding domain comprising at least one complementarity determining region. The binding protein can specifically bind to CKMB, has good binding activity and affinity, and can be used for detecting the CKMB and diagnosing diseases related to the CKMB.

Description

Binding proteins to CKMB and uses thereof

Technical Field

The invention relates to the technical field of antibodies, in particular to a binding protein for CKMB and application thereof.

Background

There are four isozyme forms of creatine kinase isozymes (CK): muscle type (MM), brain type (BB), hybrid type (MB), and mitochondrial type (MiMi). MM type is mainly present in various muscle cells, and is a dimer composed of two identical subunits, BB type is mainly present in brain cells, MB type is mainly present in cardiac muscle cells, and MiMi type is mainly present in cardiac muscle and skeletal muscle mitochondria. CKMB (namely hybrid creatine kinase isozyme) is generally divided into two allotypes of MB 1 and MB 2, wherein in cardiac muscle cells, CKMB 2 mainly exists in the form of MB 2, MB 2 is released once the cardiac muscle cells are damaged, the CKMB level in serum rapidly rises in a short time, the rising time is usually within 6h of the attack, the peak value is reached in about 24h, and the rising time gradually decreases after 72h until the normal level is recovered, which indicates that the CKMB can reflect the myocardial damage condition in an early stage. Because of the high sensitivity and specificity of CKMB in the diagnosis of acute myocardial infarction, after years of intensive research and clinical analysis, the increase of CKMB in serum becomes a well-known important index for diagnosing Acute Myocardial Infarction (AMI) and confirming the existence of myocardial necrosis, and has high diagnosis accuracy, and the clinical diagnosis myocardial damage standard is that on the basis of excluding taking medicaments with damage to myocardium and other diseases causing myocardial enzyme and electrocardiogram abnormal diseases, at least 1 item of myocardial enzyme containing CKMB is increased and electrocardiogram possibly shows abnormal expression. Especially, the use of thrombolytic therapy and emergency percutaneous coronary intervention for AMI patients in hospitals at all levels is becoming more widespread, which requires an early diagnosis of AMI.

Because the AMI is in an acute onset and rapidly progresses, the patients need to be treated symptomatically as soon as possible after the patients visit the clinic. The detection method with more clinical application is a large-scale biochemical analyzer, the detection result is accurate, and a plurality of detection indexes can be covered. But because the time consumption is long, the instrument needs calibration and indoor quality control every day, and is not suitable for AMI emergency detection. When the CKMB is separated by agarose gel electrophoresis, the percentage of each zone is obtained mainly by scanning each zymogram according to different molecular weights and charges of each isozyme of the CK, and the zymogram is combined with the activity of the total enzyme CK to obtain the enzyme activity of each isozyme. The colloidal gold particle detection method based on immunochromatography has the characteristics of simplicity and convenience in use and rapidness, and has more applications in the detection of infectious diseases and self antigens. However, the sensitivity is not high, and accurate quantification cannot be realized, so that the application of the method in AMI detection is limited.

At present, an immunosuppression method is mostly adopted in a clinical laboratory for measuring CKMB, and the method is simple and rapid, but has poor specificity. The detection principle is that the activity of the M subunit is inhibited through an anti-CK-M antibody, the activity of the B subunit is detected, because the content of CKBB in a healthy human body is very small and can be directly ignored, and the activity of CKMB in blood can be obtained by multiplying the detected result by 2. The method has the advantages of simple operation, high detection speed, low cost and the like, and is widely applied to clinical laboratory inspection. However, it was later found that muscle breakdown and some non-cardiac diseases can lead to elevated B subunit levels leading to false positive increases in CKMB.

The enzyme mass method adopts a chemical immune luminescence technology for quantitative detection, mainly adopts a double-antibody sandwich method, so that an anti-human CKMB antibody is coated on a solid phase carrier such as magnetic particles, and the like, and a marker of the anti-human CKMB antibody is an enzyme-labeled anti-human CKMB antibody for quantitative analysis and detection of CKMB. The detection method has higher specificity to antigen-antibody reaction, has no cross reaction with CKBB and CKMM, has higher sensitivity, and is not influenced by factors such as giant CK and other enzymes in serum. Therefore, the enzyme quality method has more obvious advantages in accuracy. However, most of anti-human CKMB antibodies used in the enzyme quality method are murine monoclonal antibodies produced by hybridoma technology, which are greatly influenced by individual mice, are unstable in production, have large batch-to-batch variation, and have large difficulty in purifying the mouse autoantibodies. In addition, the conventional anti-CKMB antibodies cannot be well applied to the detection of CKMB due to low activity and poor affinity. There is therefore a strong need in the art for antibodies that effectively and specifically bind to CKMB and can detect it.

Disclosure of Invention

The invention aims to provide a binding protein for CKMB and application thereof. The binding protein for CKMB provided by the invention can be specifically bound with CKMB, has better binding activity and affinity, can be used for detecting CKMB and diagnosing diseases related to CKMB, and provides more protein choices for the effective detection of CKMB and the diagnosis of diseases related to CKMB.

Noun definitions

"isolated binding protein comprising an antigen binding domain" refers broadly to any protein/protein fragment comprising a CDR region, in particular an antibody or functional fragment of an antibody. The term "antibody" includes polyclonal and monoclonal antibodies, and "antibody functional fragments" include antigen-compound-binding fragments of these antibodies, including Fab, F (ab') 2, fd, fv, scFv, diabodies, and minimal recognition units, as well as single chain derivatives of these antibodies and fragments. The type of antibody can be selected from IgG1, igG2, igG3, igG4, igA, igM, igE, and IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".

The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region (VL or VH) is composed of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The extent of the framework regions and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest), E.Kabat et al, U.S. department of Health and Human Services (U.S.. Department of Health and Human Services), (1983), and Chothia. The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.

As used herein, "framework region" or "FR" region means the region of an antibody variable domain excluding those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions (FR 1, FR2, FR3 and FR 4) separated by CDRs.

Typically, the variable domains VL/VH of the heavy and light chains are obtained by linking the CDRs and FRs numbered as follows in a combinatorial arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

The term "purified" or "isolated" in relation to a polypeptide or nucleic acid, as used herein, means that the polypeptide or nucleic acid is not in its natural medium or in its natural form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally bound to or normally mixed with it or in solution. Isolated polypeptides include the naturally-produced polypeptide contained in a cell lysate, the polypeptide in purified or partially purified form, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous host cell or culture. In connection with a nucleic acid, the terms "isolated" or "purified" mean that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

Exemplary embodiments of the invention:

in a first aspect, embodiments of the invention provide an isolated binding protein comprising an antigen binding domain that includes at least one of the following complementarity determining regions, or that includes a sequence having at least 80% sequence identity with the sequence of at least one of the following complementarity determining regions and has a KD ≦ 5.99 × 10 for CKMB proteins ^-8 Similar complementarity determining regions for affinity in mol/L:

CDR-VH1, the amino acid sequence G-F-S-X1-X2-T-S-G-X3-G-X4-S, wherein: x1 is I or L, X2 is N or S, X3 is M or F, X4 is I, L or V;

CDR-VH2, the amino acid sequence of which is H-X1-Y-W-X2-D-D-X3-R-Y-N-P-S-X4-K-S, wherein: x1 is L or I, X2 is D or E, X3 is Q or K, X4 is I or L;

CDR-VH3, the amino acid sequence of which is X1-R-R-X2-T-X3-Y-F-D, wherein: x1 is S or A; x2 is F or Y; x3 is N or D;

a complementarity determining region CDR-VL1, having an amino acid sequence S-X1-S-S-X2-V-X3-Y-M-Y, wherein: x1 is G or A, X2 is S or T, X3 is S or T;

a complementarity determining region CDR-VL2 having the amino acid sequence X1-T-X2-N-X3-a-S, wherein: x1 is I or L, X2 is S or T, X3 is I or L;

a complementarity determining region CDR-VL3, the amino acid sequence Q-X1-W-S-X2-N-X3-W, wherein: x1 is Q or K, X2 is S or R, and X3 is P or A.

The binding protein provided by the embodiment of the invention contains an antigen binding domain, the antigen binding domain comprises at least one of the complementarity determining regions, the amino acid sequence of the complementarity determining region is discovered and revealed for the first time, the binding protein is a novel sequence, the binding protein can be endowed with the capability of specifically binding to CKMB protein, and the binding protein has better binding activity and affinity, can be used for detecting CKMB and diagnosing diseases related to the CKMB, and provides more antibody selections for the effective detection of the CKMB and the diagnosis of the diseases related to the CKMB.

In alternative embodiments, the similar complementarity determining region has at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence of the at least one complementarity determining region described above and has K with CKMB protein _D ≤5.99×10 ^-8 Affinity of mol/L; or K _D ≤5×10 ^-8 mol/L; or K _D ≤4×10 ^-8 mol/L; or K _D ≤3×10 ^-8 mol/L; or K _D ≤2×10 ^-8 mol/L; or K _D ≤1×10 ^-8 mol/L; or K _D ≤9×10 ^-9 mol/L; or K _D ≤8×10 ^-9 mol/L; or K _D ≤7×10 ^-9 mol/L; or K _D ≤6×10 ^-9 mol/L; or K _D ≤5×10 ^-9 mol/L; or K _D ≤4×10 ^- ⁹ mol/L; or K _D ≤3×10 ^-9 mol/L; or K _D ≤2×10 ^-9 mol/L; or K _D ≤1×10 ^-9 mol/L；

In an alternative embodiment, 1.04 × 10 ^-9 mol/L≤K _D ≤5.99×10 ^-8 mol/L。

K _D The detection of (c) is carried out with reference to the method in the example of the present invention.

In alternative embodiments, in the complementarity determining region CDR-VH1, X3 is F;

in the CDR-VH2, X2 is D;

in the CDR-VH3, X2 is Y;

in the complementarity determining region CDR-VL1, X1 is A;

in the complementarity determining region CDR-VL2, X2 is S;

in the CDR-VL3, X3 is P.

In alternative embodiments, in the complementarity determining region CDR-VH1, X1 is I;

in alternative embodiments, in the complementarity determining region CDR-VH1, X1 is L;

in alternative embodiments, in the complementarity determining region CDR-VH1, X2 is N;

in alternative embodiments, in the complementarity determining region CDR-VH1, X2 is S;

in alternative embodiments, in the complementarity determining region CDR-VH1, X4 is I;

in alternative embodiments, in the complementarity determining region CDR-VH1, X4 is L;

in alternative embodiments, in the complementarity determining region CDR-VH1, X4 is V;

in alternative embodiments, in the complementarity determining region CDR-VH2, X1 is L;

in alternative embodiments, in the complementarity determining region CDR-VH2, X1 is I;

in alternative embodiments, in the complementarity determining region CDR-VH2, X3 is Q;

in alternative embodiments, in the complementarity determining region CDR-VH2, X3 is K;

in alternative embodiments, in the complementarity determining region CDR-VH2, X4 is I;

in alternative embodiments, in the complementarity determining region CDR-VH2, X4 is L;

in alternative embodiments, in the complementarity determining region CDR-VH3, X1 is S;

in alternative embodiments, in the complementarity determining region CDR-VH3, X1 is a;

in alternative embodiments, in the complementarity determining region CDR-VH3, X3 is N;

in alternative embodiments, in the complementarity determining region CDR-VH3, X3 is D;

in alternative embodiments, in the complementarity determining region CDR-VL1, X2 is S;

in alternative embodiments, in the complementarity determining region CDR-VL1, X2 is T;

in alternative embodiments, in the complementarity determining region CDR-VL1, X3 is S;

in alternative embodiments, in the complementarity determining region CDR-VL1, X3 is T;

in alternative embodiments, in the complementarity determining region CDR-VL2, X1 is I;

in alternative embodiments, in the complementarity determining region CDR-VL2, X1 is L;

in alternative embodiments, in the complementarity determining region CDR-VL2, X3 is I;

in alternative embodiments, in the complementarity determining region CDR-VL2, X3 is L;

in alternative embodiments, in the complementarity determining region CDR-VL3, X1 is Q;

in alternative embodiments, in the complementarity determining region CDR-VL3, X1 is K;

in alternative embodiments, in the complementarity determining region CDR-VL3, X2 is S;

in alternative embodiments, in the complementarity determining region CDR-VL3, X2 is R.

In an alternative embodiment, the mutation site (i.e., xn site, n =1,2,3 or 4) in each of the complementarity determining regions described above is selected from any one of the following combinations of mutations 1-54:

in alternative embodiments, in the complementarity determining region CDR-VH1, X3 is M;

in the CDR-VH2, X2 is E;

in the CDR-VH3, X2 is F;

in the complementarity determining region CDR-VL1, X1 is G;

in the complementarity determining region CDR-VL2, X2 is T;

in the CDR-VL3, X3 is A.

In alternative embodiments, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations 55-60:

in alternative embodiments, the binding protein includes at least 3 complementarity determining regions (e.g., 3 complementarity determining regions of a heavy chain, or3 complementarity determining regions of a light chain); alternatively, the binding protein comprises at least 6 complementarity determining regions (e.g., 3 complementarity determining regions of a heavy chain and 3 complementarity determining regions of a light chain);

in alternative embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.

In alternative embodiments, the binding protein is a functional fragment of an antibody, such as any one of a nanobody, F (ab ') 2, fab', fab, fv, scFv, diabody, and antibody minimal recognition unit;

functional fragments of the above antibodies typically have the same binding specificity as the antibody from which they are derived. As will be readily understood by those skilled in the art based on the teachings of the present invention, functional fragments of the above antibodies can be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction to cleave disulfide bonds.

Functional fragments of the above antibodies can also be obtained by recombinant genetic techniques also known to those skilled in the art or synthesized by, for example, automated peptide synthesizers, such as those sold by Applied BioSystems and the like.

In alternative embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4, as shown in sequence in SEQ ID NOS: 1-4, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4, as shown in sequence in SEQ ID NOS: 5-8.

In addition, based on the disclosure of the present invention, the species source of the heavy chain or light chain framework region of the binding protein may be human, so as to constitute a humanized antibody.

In alternative embodiments, the binding protein further comprises an antibody constant region.

In alternative embodiments, the antibody constant region is selected from the constant regions of any one of IgG1, igG2, igG3, igG4, igA, igM, igE and IgD.

In alternative embodiments, the species of the antibody constant region is from a cow, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.

In alternative embodiments, the antibody constant region is derived from a mouse.

In alternative embodiments, the light chain constant region sequence of the antibody constant region is set forth in SEQ ID NO. 9 and the heavy chain constant region sequence of the antibody constant region is set forth in SEQ ID NO. 10.

The sequences of SEQ ID NOS: 1-10 are shown in the following table:

in a second aspect, the embodiments provide the use of a binding protein according to any one of the preceding embodiments in the preparation of an agent or kit for diagnosing a disease with abnormal CKMB levels.

It should be noted that abnormal CKMB levels means significantly elevated or reduced CKMB levels compared to normal levels.

In an alternative embodiment, the abnormal level of CKMB is an abnormal level of CKMB in serum.

In alternative embodiments, the disease with abnormal CKMB levels comprises a disease that causes damage to cardiomyocytes. The damage of the myocardial cells releases MB 2, so that the CKMB level in the serum is rapidly increased in a short time. Thus, by measuring serum CKMB levels, comparing them to normal levels, if CKMB levels are elevated, it can be an indication that the body is suffering from a disease that causes damage to cardiomyocytes.

In an alternative embodiment, the disease that causes damage to cardiomyocytes comprises acute myocardial infarction.

The binding protein provided by the invention can detect the change of the CKMB level in serum, and can diagnose the acute myocardial infarction. Similarly, it is easily understood by those skilled in the art that if other diseases cause damage to cardiac muscle cells, such that the level of CKMB is increased, the binding protein provided by the present invention can be used to diagnose the diseases. Therefore, any reagent or kit for preparing a disease with abnormal CKMB levels using the binding protein provided by the present invention is within the scope of the present invention.

In a third aspect, the embodiments provide an agent or a kit for diagnosing a disease with abnormal CKMB levels, which contains the binding protein according to any one of the previous embodiments.

In alternative embodiments, an abnormal level of CKMB is an abnormal level of CKMB in serum.

In alternative embodiments, the disease with abnormal CKMB levels comprises a disease that causes damage to cardiomyocytes.

In a fourth aspect, an embodiment of the present invention provides a method for detecting CKMB, including: mixing a binding protein according to any one of the preceding embodiments with a sample to be tested.

In an alternative embodiment, the above method is for the purpose of non-disease diagnosis.

It should be noted that, those skilled in the art can perform qualitative or quantitative detection of CKMB protein in the sample to be tested based on the characteristics of immune complex formed by antibody/antigen combination. The method for detecting an antigen or an antibody based on the formation of an immune complex upon binding of the antibody to the antigen comprises:

(1) The detection purpose is realized by a precipitation reaction, which comprises the following steps: a one-way immunodiffusion test, a two-way immunodiffusion test, an immunoturbidimetry, a countercurrent immunoelectrophoresis, an immunoblotting, and the like;

(2) The detection purpose is realized by marking an indicator for displaying the signal intensity, and the method comprises the following steps: immunofluorescence, radioimmunoassay, and enzyme-linked immunoassay (e.g., double antibody sandwich, indirect, or competitive methods);

the indicator may be selected appropriately according to different detection methods, including but not limited to the indicators described below:

(1) In immunofluorescence, the indicator may be a fluorescent dye, for example, a fluorescein dye (including Fluorescein Isothiocyanate (FITC), hydroxyphoton (FAM), tetrachlorofluorescein (TET), etc. or analogs thereof), a rhodamine dye (including rhodamine Red (RBITC), tetramethylrhodamine (TAMRA), rhodamine B (TRITC), etc. or analogs thereof), a Cy series dye (including Cy2, cy3B, cy3.5, cy5, cy5.5, cy3, etc. or analogs thereof), an Alexa series dye (including Alexa fluor350, 405, 430, 488, 532, 546, 555, 568, 594, 610, 33, 647, 680, 700, 750, etc. or analogs thereof), a protein dye (including Phycoerythrin (PE), phycocyanin (PC), allophycocyanin (APC), polycyanoxanthin-chlorophyll protein (preCP), etc.);

(2) In radioimmunoassays, the indicator may be a radioisotope, for example: 212Bi, 131I, 111In, 90Y, 186Re, 211At, 125I, 188Re, 153Sm, 213Bi, 32P, 94mTc, 99mTc, 203Pb, 67Ga, 68Ga, 43Sc, 47Sc, 110mIn, 97Ru, 62Cu, 64Cu, 67Cu, 68Cu, 86Y, 88Y, 121Sn, 161Tb, 166Ho, 105Rh, 177Lu, 172Lu, 18F, and the like.

(3) In enzyme-linked immunoassays, the indicator may be an enzyme that catalyzes the development of a substrate (e.g., horseradish peroxidase, alkaline phosphatase, or glucose oxidase, etc.).

Based on the disclosure of the above binding protein, those skilled in the art can easily think of using any one or a combination of several methods or other methods to achieve quantitative or qualitative detection of CKMB in a sample to be detected, and it is within the scope of the present invention to use the binding protein disclosed in the present invention to detect CKMB regardless of the method.

In alternative embodiments, the binding protein is labeled with an indicator that indicates the intensity of the signal such that a complex of the binding protein bound to CKMB protein is detected.

In a fifth aspect, embodiments of the invention provide an isolated nucleic acid encoding a binding protein according to any one of the preceding embodiments;

in alternative embodiments, the nucleic acid is DNA or RNA.

Based on the disclosure of the amino acid sequence of the binding protein, one skilled in the art can easily obtain the nucleic acid sequence encoding the binding protein according to the codon corresponding to the amino acid, and obtain various nucleic acid sequences encoding the binding protein according to the degeneracy of the codon, which are within the protection scope of the present invention as long as they encode the binding protein.

In a sixth aspect, embodiments of the invention provide a vector comprising a nucleic acid according to the previous embodiments.

Wherein the nucleic acid sequence is operably linked to at least one regulatory sequence. "operably linked" means that the nucleic acid sequence is linked to the regulatory sequence in a manner that allows expression. Regulatory sequences, including promoters, enhancers and other expression control elements, are selected to direct the expression of the protein of interest in a suitable host cell.

Herein, a vector may refer to a molecule or agent comprising a nucleic acid of the invention or a fragment thereof, capable of carrying genetic information and capable of delivering the genetic information into a cell. Typical vectors include plasmids, viruses, bacteriophages, cosmids and minichromosomes. The vector may be a cloning vector (i.e. a vector for transferring genetic information into a cell, which may be propagated and in which the presence or absence of said genetic information may be selected) or an expression vector (i.e. a vector comprising the necessary genetic elements to allow expression of the genetic information of said vector in a cell). Thus, a cloning vector may contain a selectable marker, as well as an origin of replication compatible with the cell type specified by the cloning vector, while an expression vector contains the regulatory elements necessary to effect expression in a specified target cell.

The nucleic acids of the invention or fragments thereof may be inserted into a suitable vector to form a cloning or expression vector carrying the nucleic acid fragments of the invention. Such novel vectors are also part of the present invention. The vector may comprise a plasmid, phage, cosmid, minichromosome, or virus, as well as naked DNA that is transiently expressed only in a particular cell. The cloning and expression vectors of the invention are capable of autonomous replication and thus provide high copy numbers for high level expression or high level replication purposes for subsequent cloning. The expression vector may comprise a promoter for driving expression of the nucleic acid fragment of the invention, optionally a nucleic acid sequence encoding a signal peptide for secretion or integration of the peptide expression product into a membrane, a nucleic acid fragment of the invention, and optionally a nucleic acid sequence encoding a terminator. When the expression vector is manipulated in a production strain or cell line, the vector, when introduced into a host cell, may or may not be integrated into the genome of the host cell. Vectors typically carry a replication site, as well as a marker sequence capable of providing phenotypic selection in transformed cells.

In a seventh aspect, embodiments of the present invention provide a host cell comprising a vector according to the previous embodiments.

The expression vectors of the invention are useful for transforming host cells. Such transformed host cells are also part of the invention and may be cultured cells or cell lines for propagation of the nucleic acid fragments and vectors of the invention, or for recombinant production of the binding proteins of the invention. Host cells of the present invention include microorganisms such as bacteria (e.g., escherichia coli, bacillus spp., etc.). Host cells also include cells from multicellular organisms such as fungi, insect cells, plant cells or mammalian cells, preferably from mammals, e.g., CHO cells.

In an eighth aspect, embodiments of the invention provide a method of producing a binding protein of any one of the preceding embodiments, comprising:

the host cell of the previous embodiment is cultured, and the binding protein is isolated and purified from the culture medium or from the cultured host cell.

The production method may be, for example, transfecting a host cell with a nucleic acid vector encoding at least a portion of the binding protein, and culturing the host cell under suitable conditions such that the binding protein is expressed. The host cell may also be transfected with one or more expression vectors, which may comprise, alone or in combination, DNA encoding at least a portion of the binding protein. The bound protein may be isolated from the culture medium or cell lysate using conventional techniques for purifying proteins and peptides, including ammonium sulfate precipitation, chromatography (e.g., ion exchange, gel filtration, affinity chromatography, etc.), and/or electrophoresis.

Construction of suitable vectors containing the coding and regulatory sequences of interest can be carried out using standard ligation and restriction techniques well known in the art. The isolated plasmid, DNA sequence or synthetic oligonucleotide is cleaved, tailed and religated as desired. Any method may be used to introduce mutations into the coding sequence to produce variants of the invention, and these mutations may comprise deletions or insertions or substitutions or the like.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a reduced SDS-PAGE of the CKMB monoclonal antibody of example 1.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

Restriction enzyme, prime Star DNA polymerase, was purchased from Takara in this example. MagExtractor-RNA extraction kit was purchased from TOYOBO. BD SMART ^TM RACE cDNA Amplification Kit was purchased from Takara. pMD-18T vector was purchased from Takara. Plasmid extraction kits were purchased from Tiangen corporation. Primer synthesis and gene sequencing were done by Invitrogen. This example provides a method for producing recombinant antibodies against CKMB

1 construction of recombinant plasmid

(1) Primer and method for producing the same

Amplifying heavy chain and light chain 5' RACE primers:

SMARTER II A Oligonucleotide：

5’-AAGCAGTGGTATCAACGCAGAGTACXXXXX-3’；

5'-RACE CDS Primer(5'-CDS)：5’-(T)25VN-3’(N＝A，C，G，orT；V＝A，G，orC)；

Universal Primer A Mix(UPM)：

5’-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3’；

Nested Universal Primer A(NUP)：5’-AAGCAGTGGTATCAACGCAGAGT-3’；

MIgG-CKR：5’-CTAACACTCATTCCTGTTGAAGC-3’；

MIgG-CHR：5’-TCATTTACCCGGAGTCCGGGAGAAGCTC-3’。

(2) Antibody variable region gene cloning and sequencing

RNA is extracted from a hybridoma cell strain secreting anti-CKMB monoclonal antibody, first strand cDNA synthesis is carried out by using a SMARTERTM RACE cDNA Amplification Kit and a SMARTER II A Oligonucleotide and a 5' -CDS primer in the Kit, and an obtained first strand cDNA product is used as a PCR Amplification template. The light chain genes were amplified with Universal Primer A Mix (UPM) (5 '> CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT < 3'), nested Universal Primer A (NUP) (5 '> AAGCAGTGGTATCAACGCAGAGT < 3'), and mIgG CKR Primer (5 '> CTAACACTCATTCCTGTTGAAGCTCTTGACAAT < 3'), and the heavy chain genes were amplified with Universal Primer A Mix (UPM), nested Universal Primer A (NUP), and mIgG CHR (5 '> TCATTTACCAGGAGAGTGGGAGAGGC < 3'). Wherein the primer pair of the light chain can amplify a target band about 0.8KB, and the primer pair of the heavy chain can amplify a target band about 1.4 KB. The product is added with A by rTaq DNA polymerase, inserted into pMD-18T vector, transformed into DH5 alpha competent cell, after growing colony, 4 clones of heavy chain and light chain gene clone are taken respectively and sent to Invitrogen company for sequencing.

(3) Sequence analysis of Anti-CK 8A27 antibody variable region Gene

Putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy chain primer pair and the light chain primer pair are correct, wherein in the gene fragment amplified by the light chain, the VL gene sequence is 321bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the heavy chain primer pair, the VH gene sequence is 354bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.

(4) Construction of recombinant antibody expression plasmid

pcDNA ^TM 3.4

vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, bamHI, ecoRI and the like are introduced into the expression vector and named as pcDNA3.4A expression vector, and the vector is called as 3.4A expression vector for short in the following; according to the sequencing result of the antibody gene in the pMD-18T, the light chain and heavy chain gene specific primers of the anti-CKMB antibody are designed, two ends of the primers are respectively provided with HindIII and EcoRI enzyme cutting sites and protective bases,the primers are as follows:

CK8A9-HF：

5’>CAGCAAGCTTGCCGCCACCATGGAATGCAGCTGTGTCATGCTCTTCTTC<3’；

CKT8A9-HR：

5’>CATCGAATTCTTATCATTTACCAGGAGAGTGGGAGA<3’；

CKT8A9-LF：

5’>CATCAAGCTTGCCGCCACCATGAAGTTGCCTGTTAGGCTGTTGG<3’；

CKT8A9-LR：

5’>CAGCGAATTCTTACTAACACTCATTCCTGTTGAAGC<3’；

a0.75 KB light chain gene fragment and a 1.42KB heavy chain gene fragment were amplified by PCR amplification. The heavy chain gene fragment and the light chain gene fragment are subjected to double enzyme digestion by HindIII/EcoRI respectively, the 3.4A vector is subjected to double enzyme digestion by HindIII/EcoRI, the heavy chain gene and the light chain gene are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the heavy chain and the light chain are respectively obtained.

2 Stable cell line selection

(1) Transient transfection of recombinant antibody expression plasmid into CHO cell, determination of expression plasmid activity

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10 ⁷ cells/ml are put into a centrifuge tube, 100 mul of plasmid is mixed with 700 mul of cells, the mixture is transferred into an electric rotating cup and is electrically rotated, the sampling counting is carried out on 3 rd, 5 th and 7 th days, and the sampling detection is carried out on 7 th day.

Diluting goat anti-mouse IgG1 mu g/ml with the coating solution to coat the microplate, wherein each well is 100 mu l, and the temperature is 4 ℃ overnight; the next day, washing with the washing solution for 2 times, and patting dry; add blocking solution (20% BSA +80% PBS) 120 μ l per well, 37 ℃,1h, patted dry; adding diluted cell supernatant at a concentration of 100 μ l/well at 37 deg.C for 60min; throwing off liquid in the plate, patting dry, adding 20% mouse negative blood, sealing, and sealing at 37 ℃ for 1h, wherein each hole is 120 mu l; throwing off liquid in the plate, patting to dry, adding diluted CKMB antigen 100 mul per hole, 37 ℃,40min; washing with washing solution for 5 times, and drying; adding CKMB monoclonal antibody labeled with HRP, wherein each hole is 100 mul, 37 ℃ and 30min; adding a developing solution A (50 μ l/hole), adding a developing solution B (50 μ l/hole), and standing for 10min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu l/hole; OD readings were taken at 450nm (reference 630 nm) on the microplate reader. The result shows that the reaction OD is still more than 1.0 after the cell supernatant is diluted 1000 times, and the reaction OD of the wells without the cell supernatant is less than 0.1, which indicates that the antibodies generated after the plasmid is transiently transformed have activity to CKMB antigen.

(2) Linearization of recombinant antibody expression plasmids

The following reagents were prepared: 50 mul Buffer, 100 mul DNA/tube, 10 mul Puv I enzyme, and sterile water to 500 mul, and water bath enzyme digestion at 37 ℃ overnight; extraction was performed sequentially with equal volumes of phenol/chloroform/isoamyl alcohol (lower layer) 25, followed by chloroform (aqueous phase); precipitating with 0.1 times volume (water phase) of 3M sodium acetate and 2 times volume of ethanol on ice, rinsing with 70% ethanol, removing organic solvent, re-melting with appropriate amount of sterilized water after ethanol is completely volatilized, and finally measuring concentration.

(3) Stable transfection of recombinant antibody expression plasmid, pressurized screening of stable cell lines

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10 ⁷ cells/ml are put into a centrifuge tube, 100 mul of plasmid is mixed with 700 mul of cells, and the mixture is transferred into an electric rotating cup and is electrically rotated, and the next day is counted; 25 u mol/L MSX 96 hole pressure culture about 25 days.

Observing the marked clone holes with the cells under a microscope, and recording the confluence degree; taking culture supernatant, and sending the culture supernatant to a sample for detection; selecting antibody concentration, transferring cell strains with high relative concentration into 24 holes, and transferring into 6 holes after 3 days; after 3 days, the seeds were kept and cultured in batches, and the cell density was adjusted to 0.5X 10 ⁶ cells/ml,2.2ml, cell density 0.3X 10 ⁶ cell/ml, 2ml for seed preservation; and (4) 7 days, carrying out batch culture supernatant sample sending detection in 6 holes, and selecting cell strains with small antibody concentration and cell diameter to transfer TPP for seed preservation and passage.

3 recombinant antibody production

(1) Cell expanding culture

After the cells were recovered, they were cultured in 125ml size shake flasks, inoculated with 30ml Dynamis medium at a culture medium volume of 100%, and placed in a shaker at a rotation speed of 120r/min and a temperature of 37 ℃ with 8% carbon dioxide. Culturing for 72h, inoculating and expanding at inoculation density of 50 ten thousand cells/ml, and calculating the expanding volume according to production requirements, wherein the culture medium accounts for 100 percent. Then the culture is expanded every 72 h. When the cell amount meets the production requirement, the production is carried out by strictly controlling the inoculation density to be about 50 ten thousand cells/ml.

(2) Shake flask production and purification

Shake flask parameters: the rotating speed is 120r/min, the temperature is 37 ℃, and the carbon dioxide is 8 percent. Feeding in a flowing mode: daily feeding was started at 72h in the flask, 3% of the initial culture volume was fed daily by HyCloneTM Cell BoostTM Feed 7a, one thousandth of the initial culture volume was fed daily by Feed 7b, and was continued up to day 12 (day 12 feeding). Glucose was supplemented with 3g/L on the sixth day. Samples were collected on day 13. Affinity purification was performed using a proteinA affinity column. Mu.g of the purified antibody (i.e., CKMB monoclonal antibody) was subjected to reducing SDS-PAGE, and the electrophoretogram thereof was shown in FIG. 1. Two bands were shown after reducing SDS-PAGE, 1 with 50kD of Mr (i.e., heavy chain, SEQ ID NO: 12) and 28kD of Mr (i.e., light chain, SEQ ID NO: 14).

Example 2

Detection of antibody Performance

(1) Example 1 Activity assay of antibodies and mutants thereof

Further analysis revealed that the variable region of the heavy chain of the CKMB monoclonal antibody (WT) of example 1 is shown in SEQ ID NO:11, wherein the amino acid sequences of the complementarity determining regions of the heavy chain are as follows:

CDR-VH1：G-F-S-I(X1)-N(X2)-T-S-G-M(X3)-G-V(X4)-S；

CDR-VH2：H-I(X1)-Y-W-E(X2)-D-D-Q(X3)-R-Y-N-P-S-I(X4)-K-S；

CDR-VH3：A(X1)-R-R-F(X2)-T-N(X3)-Y-F-D；

the light chain variable region is shown as SEQ ID NO 13, wherein the amino acid sequences of the complementarity determining regions of the light chain are as follows:

CDR-VL1：S-G(X1)-S-S-T(X2)-V-S(X3)-Y-M-Y；

CDR-VL2：L(X1)-T-T(X2)-N-I(X3)-A-S；

CDR-VL3：Q-Q(X1)-W-S-S(X2)-N-A(X3)-W。

on the basis of the CKMB monoclonal antibody of example 1, mutation is made in the complementarity determining regions for sites involved in antibody activity, wherein X1, X2, X3, X4 are all mutated sites. See table 1 below.

TABLE 1 mutant sites associated with antibody Activity

And (3) detecting the binding activity:

coating solution (PBS) dilutes goat anti-mouse IgG1 mug/ml for coating a microplate, each well is 100 mug, and the temperature is kept overnight at 4 ℃; the next day, washing with washing solution (PBS) for 2 times, and patting dry; add blocking solution (20% BSA +80% PBS) 120 μ l per well, 37 ℃,1h, patted dry; adding diluted CKMB monoclonal antibody into the mixture at a concentration of 100 mu l/hole, and keeping the temperature at 37 ℃ for 60min; throwing off liquid in the plate, patting dry, adding 20% mouse negative blood, sealing, and sealing at 37 ℃ for 1h, wherein each hole is 120 mu l; throwing off liquid in the plate, patting to dry, adding diluted CKMB antigen 100 mul per hole, 37 ℃,40min; washing with washing solution for 5 times, and drying; adding another CKMB monoclonal antibody marked with HRP, wherein each hole is 100 mu l at 37 ℃ for 30min; adding color development liquid A (50 μ L/well containing 2.1g/L citric acid, 12.25g/L citric acid, 0.07g/L acetanilide and 0.5g/L carbamide peroxide) and adding color development liquid B (50 μ L/well containing 1.05g/L citric acid, 0.186g/L LEDTA.2Na, 0.45g/L TMB and 0.2ml/L concentrated HCl) for 10min; stop solution (50. Mu.l/well, containing 0.75 g/EDTA-2 Na and 10.2ml/L concentrated H) was added ₂ SO ₄ ) (ii) a OD readings were taken at 450nm (reference 630 nm) on the microplate reader.

The results are shown in Table 2.

TABLE 2 Activity data of antibodies and mutants thereof

Sample concentration (n)g/ml)	50	25	12.5	6.25	3.125	0
							WT	2.162	1.424	0.608	0.331	0.218	0.091
Mutation 1	2.412	2.091	0.948	0.610	0.301	0.081
							Mutation 2	2.368	1.932	0.916	0.547	0.276	0.080
Mutation 3	2.268	1.992	0.903	0.537	0.219	0.083
							Mutation 4	2.352	1.972	0.931	0.546	0.232	0.085
Mutation 5	1.933	1.333	0.712	0.558	0.254	0.015
							Mutation 6	1.945	1.256	0.801	0.525	0.288	0.013
Mutation 7	0.352	-	-	-	-	-
							Mutation 8	0.236	-	-	-	-	-
Mutation 9	0.321	-	-	-	-	-
							Mutation 10	0.257	-	-	-	-	-

As can be seen from the data in Table 2, WT, as well as mutations 1-6, had better binding activity, while mutations 7-10 had poorer binding activity ratio and essentially no binding activity, indicating that the mutation patterns listed in Table 1 were not predictable.

(1) Example 1 affinity assays for antibodies and mutants thereof

Based on mutation 1, other affinity-related sites were mutated, and the sequence of each mutation is shown in Table 3 below.

TABLE 3 mutation sites related to antibody affinity

And (3) affinity detection:

(a) Using AMC sensors, the purified antibody was diluted to 10ug/ml with PBST and CKMB protein was diluted with PBST in a 2-fold gradient starting at 50 ug/ml;

the operation flow is as follows: equilibrating for 60s in buffer 1 (PBST), immobilizing antibody in antibody solution for 300s, incubating in buffer 2 (PBST) for 180s, binding for 420s in antigen solution, dissociating for 1200s in buffer 2, regenerating the sensor with 10mM pH 1.69GLY solution and buffer 3, and outputting data. The results are shown in Table 4 (K) _D Represents the equilibrium dissociation constant, i.e., affinity; kon denotes the binding rate; kdis denotes off-rate).

Table 4 affinity assay data

The data in Table 4 show that essentially all of mutation 1, mutation 1-1 through mutation 1-53 have a relatively low K _D The values indicate that the affinity of these antibodies is good, and also that the mutation pattern of the mutation sites listed in Table 3 does not have a negative effect on the affinity of the antibodies, and it is sufficient to indicate that antibodies with better affinity can be obtained by mutating the mutation sites in the manner listed in Table 3.

(b) Based on WT, mutation is carried out on other sites, and the affinity of each mutant is detected, the sequence of each mutation is shown in Table 5, and the corresponding affinity data is shown in Table 6.

TABLE 5 mutations with WT as backbone

TABLE 6 affinity detection of mutations with WT as backbone

K _D (M)

kon(1/Ms)

kdis(1/s)

K _D (M)

kon(1/Ms)

kdis(1/s)

WT

3.67E-08

1.90E+04

6.97E-04

WT 1-3

5.20E-08

1.69E+04

8.78E-04

WT 1-1

5.66E-08

1.61E+04

9.12E-04

WT 1-4

4.25E-08

1.87E+04

7.96E-04

WT 1-2

4.57E-08

1.86E+04

8.50E-04

WT 1-5

5.99E-08

1.65E+04

9.89E-04

As can be seen from the data in Table 6, the affinity of WT, WT 1-1 to WT 1-6 was also good, indicating that antibodies with better affinity could be obtained by mutating the mutation sites as listed in Table 5.

(3) Antibody stability detection

The antibody of the above example is placed in 4 ℃ (refrigerator), -80 ℃ (refrigerator), 37 ℃ (incubator) for 21 days, samples for 7 days, 14 days, 21 days are taken for state observation, and activity detection is carried out on the samples for 21 days, the result shows that under three examination conditions, no obvious protein state change is seen in 21 days of antibody placement, and the activity is not more prone to decrease with the increase of examination temperature, which indicates that the self-produced antibody is stable. The following table shows the results of the 21-day evaluation of the OD enzyme immunity assay with mutation 1.

TABLE 7 antibody stability analysis

Sample concentration (ng/ml)	50	25	0
				Samples at 4 ℃ for 21 days	2.143	1.455	0.056
21 days samples at-80 deg.C	2.144	1.439	0.055
				21 day samples at 37 deg.C	2.175	1.463	0.063

As shown in the data in Table 7, the antibodies of the examples of the present invention still detected antigens after being stored at different temperatures for 21 days, which indicates that the antibodies provided by the examples of the present invention all have excellent stability, and the mutation of the site has no influence on the stability.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Fenpeng biological products Ltd

<120> binding protein for CKMB and use thereof

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> PRT

<213> Artificial sequence

<400> 1

Gln Phe Val Leu Thr Gln Ser Pro Ala Leu Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys

20

<210> 2

<211> 15

<212> PRT

<213> Artificial sequence

<400> 2

Trp Tyr Gln Gln Lys Pro Lys Ser Ser Pro Lys Pro Trp Ile Tyr

1 5 10 15

<210> 3

<211> 32

<212> PRT

<213> Artificial sequence

<400> 3

Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser

1 5 10 15

Leu Thr Ile Ser Thr Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys

20 25 30

<210> 4

<211> 12

<212> PRT

<213> Artificial sequence

<400> 4

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

1 5 10

<210> 5

<211> 25

<212> PRT

<213> Artificial sequence

<400> 5

Gln Val Asn Leu Lys Glu Ser Gly Pro Gly Met Leu Gln Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Ser Phe Ser

20 25

<210> 6

<211> 14

<212> PRT

<213> Artificial sequence

<400> 6

Trp Ile Arg Gln Pro Ser Gly Lys Ala Val Glu Trp Leu Ala

1 5 10

<210> 7

<211> 30

<212> PRT

<213> Artificial sequence

<400> 7

Arg Leu Thr Ile Ser Lys Asp Thr Ser Arg Asn Lys Val Phe Leu Lys

1 5 10 15

Ile Thr Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr Cys

20 25 30

<210> 8

<211> 12

<212> PRT

<213> Artificial sequence

<400> 8

Tyr Trp Gly Gln Gly Thr Pro Leu Thr Val Ser Ser

1 5 10

<210> 9

<211> 106

<212> PRT

<213> Artificial sequence

<400> 9

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

1 5 10 15

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

20 25 30

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

35 40 45

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

50 55 60

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

65 70 75 80

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

85 90 95

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210> 10

<211> 204

<212> PRT

<213> Artificial sequence

<400> 10

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala

195 200

<210> 11

<211> 118

<212> PRT

<213> Artificial sequence

<400> 11

Gln Val Asn Leu Lys Glu Ser Gly Pro Gly Met Leu Gln Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Ile Asn Thr Ser

20 25 30

Gly Met Gly Val Ser Trp Ile Arg Gln Pro Ser Gly Lys Ala Val Glu

35 40 45

Trp Leu Ala His Ile Tyr Trp Glu Asp Asp Gln Arg Tyr Asn Pro Ser

50 55 60

Ile Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Arg Asn Lys Val

65 70 75 80

Phe Leu Lys Ile Thr Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr

85 90 95

Cys Ala Arg Arg Phe Thr Asn Tyr Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Pro Leu Thr Val Ser Ser

115

<210> 12

<211> 441

<212> PRT

<213> Artificial sequence

<400> 12

Gln Val Asn Leu Lys Glu Ser Gly Pro Gly Met Leu Gln Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Ile Asn Thr Ser

20 25 30

Gly Met Gly Val Ser Trp Ile Arg Gln Pro Ser Gly Lys Ala Val Glu

35 40 45

Trp Leu Ala His Ile Tyr Trp Glu Asp Asp Gln Arg Tyr Asn Pro Ser

50 55 60

Ile Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Arg Asn Lys Val

65 70 75 80

Phe Leu Lys Ile Thr Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr

85 90 95

Cys Ala Arg Arg Phe Thr Asn Tyr Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Pro Leu Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro

115 120 125

Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly

130 135 140

Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn

145 150 155 160

Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln

165 170 175

Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr

180 185 190

Trp Pro Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser

195 200 205

Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro

210 215 220

Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro

225 230 235 240

Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys

245 250 255

Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp

260 265 270

Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu

275 280 285

Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met

290 295 300

His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser

305 310 315 320

Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly

325 330 335

Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln

340 345 350

Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe

355 360 365

Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu

370 375 380

Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe

385 390 395 400

Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn

405 410 415

Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His Thr

420 425 430

Glu Lys Ser Leu Ser His Ser Pro Gly

435 440

<210> 13

<211> 107

<212> PRT

<213> Artificial sequence

<400> 13

Gln Phe Val Leu Thr Gln Ser Pro Ala Leu Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Ser Gly Ser Ser Thr Val Ser Tyr Met

20 25 30

Tyr Trp Tyr Gln Gln Lys Pro Lys Ser Ser Pro Lys Pro Trp Ile Tyr

35 40 45

Leu Thr Thr Asn Ile Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Thr Val Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Ala Trp Thr

85 90 95

Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105

<210> 14

<211> 213

<212> PRT

<213> Artificial sequence

<400> 14

Gln Phe Val Leu Thr Gln Ser Pro Ala Leu Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Ser Gly Ser Ser Thr Val Ser Tyr Met

20 25 30

Tyr Trp Tyr Gln Gln Lys Pro Lys Ser Ser Pro Lys Pro Trp Ile Tyr

35 40 45

Leu Thr Thr Asn Ile Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Thr Val Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Ala Trp Thr

85 90 95

Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala Pro

100 105 110

Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Leu Thr Ser Gly Gly

115 120 125

Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro Lys Asp Ile Asn

130 135 140

Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly Val Leu Asn

145 150 155 160

Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser Ser

165 170 175

Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr Thr

180 185 190

Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro Ile Val Lys Ser Phe

195 200 205

Asn Arg Asn Glu Cys

210

Claims

1. An isolated binding protein comprising an antigen binding domain, wherein said antigen binding domain comprises the following 6 complementarity determining regions:

a complementarity determining region CDR-VH1, the amino acid sequence of which is G-F-S-X1-X2-T-S-G-X3-G-X4-S;

the amino acid sequence of the complementarity determining region CDR-VH2 is H-X1-Y-W-X2-D-D-X3-R-Y-N-P-S-X4-K-S;

a complementarity determining region CDR-VH3, the amino acid sequence of which is X1-R-R-X2-T-X3-Y-F-D;

a complementarity determining region CDR-VL1, the amino acid sequence of which is S-X1-S-S-X2-V-X3-Y-M-Y;

a complementarity determining region CDR-VL2, the amino acid sequence of which is X1-T-X2-N-X3-A-S;

a complementarity determining region CDR-VL3, the amino acid sequence of which is Q-X1-W-S-X2-N-X3-W;

in the CDR-VH1, X3 is F;

in the complementarity determining region CDR-VH2, X2 is D;

in the CDR-VH3, X2 is Y;

in the complementarity determining region CDR-VL1, X1 is A;

in the complementarity determining region CDR-VL2, X2 is S;

in the complementarity determining region CDR-VL3, X3 is P;

the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations 1 to 54:

combination of mutations CDR-VH1 X1/X2/X4 CDR-VH2 X1/X3/X4 CDR-VH3 X1/X3 CDR-VL1 X2/X3 CDR-VL2 X1/X3 CDR-VL3 X1/X2 Mutant combination 1 I/N/V I/Q/I A/N T/S L/I Q/S Combination of mutations 2 L/N/V L/Q/L A/D S/T L/L Q/R Combination of mutations 3 I/SV I/Q/L S/N T/T I/I K/S Combination of mutations 4 L/S/V L/Q/I S/D S/S I/L K/R Combination of mutations 5 I/N/L I/K/L A/D T/T I/I Q/R Combination of mutations 6 L/N/L L/K/I S/N S/T L/L K/S Mutant combination 7 I/S/L I/K/I A/N T/S I/L Q/S Combination of mutations 8 L/S/L L/K/L S/D S/S L/I K/R Combination of mutations 9 I/N/I L/Q/I A/D S/T L/I K/S Combination of mutations 10 L/N/I L/K/L A/N S/S I/L Q/R Combination of mutations 11 I/S/I I/Q/L S/D T/S I/I K/R Mutant combination 12 L/S/I I/K/I S/N T/T L/L Q/S Mutant combinations 13 I/N/V L/Q/L S/D S/T I/L K/R Combination of mutations 14 L/S/I L/K/I A/D T/S L/I Q/S Combination of mutations 15 L/N/V I/Q/I S/N T/T L/L K/S Combination of mutations 16 I/N/L I/K/L A/N S/S I/I Q/R Mutant combinations 17 I/S/I L/Q/L S/N T/S L/L K/S Combination of mutations 18 I/SV I/K/I S/D S/T L/I Q/R Combination of mutations 19 L/N/L L/Q/I A/N T/T I/L K/R Combination of mutations 20 L/S/V I/K/L A/D S/S I/I Q/S Mutant combination 21 L/N/I L/K/I S/D S/T L/I Q/R Mutant combination 22 I/S/L I/Q/L A/N T/S L/L K/S Mutant combination 23 I/N/I L/K/L S/N T/T I/I Q/S Mutant combinations 24 L/S/L I/Q/I A/D S/S I/L K/R Mutant combinations 25 I/S/L L/K/L A/D T/T I/I Q/S Mutant combinations 26 L/N/I I/K/I A/N S/T L/L Q/R Mutant combinations 27 L/S/L L/K/I S/D T/S I/L K/S Mutant combinations 28 I/S/V I/K/L S/N S/S L/I K/R Mutant combinations 29 I/N/I L/Q/I S/N S/T L/L K/S Combination of mutations 30 I/NL I/Q/L S/D S/S L/I Q/R Combination of mutations 31 L/S/V L/Q/L A/N T/S I/L K/R Mutant combinations 32 L/N/L I/Q/I A/D T/T I/I Q/S Mutant combinations 33 L/S/I L/Q/L A/D S/T L/I K/R Mutant combinations 34 I/N/V L/K/I A/N S/S I/L Q/S Combination of mutations 35 I/S/I I/Q/I S/D T/S I/I K/S Combination of mutations 36 L/N/V I/K/L S/N T/T L/L Q/R Mutant combinations 37 L/S/L L/Q/I A/N S/T I/L Q/S Combination of mutations 38 I/N/I L/K/L A/D T/S L/I Q/R Mutant combinations 39 I/N/V I/Q/L S/N T/T L/L K/S Combination of mutations 40 L/S/I I/K/I S/D S/S I/I K/R Mutant combination 41 I/S/L L/Q/L A/D T/T L/L Q/R Combination of mutations 42 L/N/V I/K/I S/N S/T L/I K/S Mutant combinations 43 I/S/I L/Q/I A/N T/S I/L Q/S Mutant combinations 44 I/N/L I/K/L S/D S/S I/I K/R Combination of mutations 45 L/S/V L/K/I S/D T/S I/L K/R Mutant combinations 46 L/N/L I/Q/L A/D S/T L/I Q/S Mutant combinations 47 I/SV L/K/L S/N T/T L/L K/S Mutant combinations 48 L/N/I I/Q/I A/N S/S I/I Q/R Mutant combinations 49 I/N/V L/K/L S/N S/T L/I K/S Mutant combinations 50 I/S/I I/K/I S/D T/S I/L Q/R Mutant combinations 51 L/N/V L/Q/L A/N T/T I/I K/R Mutant combinations 52 L/S/L I/K/L A/D S/S L/L Q/S Mutant combination 53 I/N/I L/Q/I S/D S/T I/I Q/R Mutant combinations 54 I/N/V I/K/L A/N T/S L/L K/S

。

2. An isolated binding protein comprising an antigen binding domain, wherein said antigen binding domain comprises the following 6 complementarity determining regions:

a complementary determining region CDR-VH1, the amino acid sequence of which is G-F-S-X1-X2-T-S-G-M-G-X4-S;

a complementarity determining region CDR-VH2, the amino acid sequence of which is H-X1-Y-W-E-D-D-X3-R-Y-N-P-S-X4-K-S;

a complementarity determining region CDR-VH3, the amino acid sequence of which is X1-R-R-F-T-X3-Y-F-D;

a complementarity determining region CDR-VL1, the amino acid sequence of which is S-G-S-S-X2-V-X3-Y-M-Y;

a complementarity determining region CDR-VL2, the amino acid sequence of which is X1-T-T-N-X3-A-S;

a complementarity determining region CDR-VL3, the amino acid sequence of which is Q-X1-W-S-X2-N-A-W,

the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations 55-60:

combination of mutations CDR-VH1 X1/X2/X4 CDR-VH2 X1/X3/X4 CDR-VH3 X1/X3 CDR-VL1 X2/X3 CDR-VL2 X1/X3 CDR-VL3 X1/X2 Mutant combinations 55 I/N/V I/Q/I A/N T/S L/I Q/S Mutant combinations 56 L/S/L I/K/I S/N T/T I/I K/R Mutant combinations 57 L/S/V I/Q/I A/N S/S L/L Q/S Mutant combinations 58 I/N/L I/K/L A/D T/T L/L K/S Mutant combinations 59 I/N/V I/K/I S/D S/T I/I K/R Mutant combinations 60 L/S/I I/Q/L A/D T/S L/L Q/S

。

3. The binding protein of any one of claims 1-2, wherein said binding protein is an antibody or a functional fragment thereof.

4. The binding protein of claim 3, wherein said binding protein is selected from any one of F (ab ') 2, fab', fab, fv, scFv, and diabody.

5. The binding protein according to any one of claims 1-2, wherein said binding protein comprises the light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 as shown in the sequence SEQ ID NOs 1-4, and/or the heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 as shown in the sequence SEQ ID NOs 5-8.

6. The binding protein according to any one of claims 1-2, wherein said binding protein further comprises an antibody constant region.

7. The binding protein of claim 6, wherein said antibody constant region is selected from the constant regions of any one of IgG1, igG2, igG3, igG4, igA, igM, igE, and IgD.

8. The binding protein of claim 6, wherein said antibody constant region is of a species of bovine, equine, porcine, ovine, caprine, rat, mouse, canine, feline, rabbit, donkey, deer, mink, chicken, duck, goose, or human origin.

9. The binding protein of claim 6, wherein the species source of said constant region is a bovine.

10. The binding protein of claim 6, wherein said species source of the constant region is turkey or turkey.

11. The binding protein of claim 6, wherein said antibody constant region is derived from a mouse.

12. The binding protein of claim 11, wherein said antibody constant region light chain constant region sequence is set forth in SEQ ID No. 9 and said antibody constant region heavy chain constant region sequence is set forth in SEQ ID No. 10.

13. A reagent or kit comprising a binding protein according to any one of claims 1 to 12.

14. Use of a binding protein according to any one of claims 1 to 12 in the manufacture of a kit for the detection of CKMB.

15. The use according to claim 14, wherein the kit is for: mixing the binding protein of any one of claims 1-12 with a sample to be tested;

the detection of CKMB is achieved by a precipitation reaction or by labeling an indicator showing the signal intensity.

16. The use according to claim 15, wherein the method for detecting CKMB by precipitation reaction is selected from any one or more of the following methods: a one-way immunodiffusion test, a two-way immunodiffusion test, an immunoturbidimetry, an immunoelectrophoresis, and an immunoblotting method; the immunoelectrophoresis comprises convection immunoelectrophoresis.

17. The use according to claim 15, wherein the CKMB detection is achieved by labeling the indicator for signal intensity by any one or more of the following methods: immunofluorescence, radioimmunoassay, and enzyme-linked immunoassay.

18. The use according to claim 17, wherein the indicator is selected from any one of a fluorescent dye, a radioisotope and an enzyme catalyzing color development of a substrate.

19. A vector comprising a nucleic acid encoding the binding protein of any one of claims 1-12.

20. A host cell comprising the vector of claim 19.

21. A method of producing the binding protein of any one of claims 1 to 12, comprising:

culturing the host cell of claim 20, and isolating and purifying the binding protein from the culture medium or from the cultured host cell.