CN111018975B - Recombinant antibody of anti-human cardiac troponin I - Google Patents
Recombinant antibody of anti-human cardiac troponin I Download PDFInfo
- Publication number
- CN111018975B CN111018975B CN201811180351.XA CN201811180351A CN111018975B CN 111018975 B CN111018975 B CN 111018975B CN 201811180351 A CN201811180351 A CN 201811180351A CN 111018975 B CN111018975 B CN 111018975B
- Authority
- CN
- China
- Prior art keywords
- cdr
- mutations
- complementarity determining
- determining region
- combination
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4712—Muscle proteins, e.g. myosin, actin, protein
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/12—Pulmonary diseases
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/32—Cardiovascular disorders
- G01N2800/324—Coronary artery diseases, e.g. angina pectoris, myocardial infarction
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a recombinant antibody of anti-human cardiac troponin I, in particular to a novel separated binding protein containing a cTnI antigen binding structural domain, and researches on the aspects of preparation, application and the like of the binding protein. The binding protein has strong activity and high affinity with human cTnI protein, and can be widely applied to the field of detection of the cTnI protein.
Description
Technical Field
The invention relates to the technical field of immunity, in particular to a recombinant antibody of an anti-human cardiac troponin I.
Background
Before the 80's of the 20 th century, the World Health Organization (WHO) has used the activity of the myocardial zymogram as one of the diagnostic criteria for Acute Myocardial Infarction (AMI). At the end of the 80's 20 th century, researchers found that troponin (Tn) had higher sensitivity and specificity than biomarkers such as phosphocreatine kinase (CK), phosphocreatine kinase isoenzyme (CK-MB), lactate dehydrogenase, and aspartate aminotransferase. The cardiac troponin I (cTnI) is only present in cardiac muscle, is a marker of cardiac muscle cells, can affect the contraction and relaxation functions of the heart by abnormal change, can be used for diagnosing myocardial necrosis, judging cardiac muscle injury and the like, becomes one of the markers with the strongest damage sensitivity and specificity of the cardiac muscle cells, and is a main biochemical marker which is generally accepted to rapidly diagnose AMI and Acute Coronary Syndrome (ACS) and assist ACS risk stratification and reflect the prognosis of the ACS.
The cTnI content in normal human blood is generally lower than 0.3 mu g/L. When the integrity of the cell membrane of the cardiomyocytes is damaged by ischemia or hypoxia, the free cTnI can rapidly penetrate the cell membrane and enter the blood stream. Therefore, the rapid, sensitive and accurate determination of cTnI and its change trend in human blood at the early stage of onset has important clinical significance for the diagnosis of acute myocardial infarction, risk stratification of acute coronary syndrome, monitoring of myocardial damage caused by various factors, and the like. The clinical methods for detecting the cTnI level include enzyme-linked immunosorbent assay (ELISA), chemiluminescence, colloidal gold and the like, and different methods have respective advantages and disadvantages, but all require specific monoclonal antibodies aiming at the cTnI.
The existing cTnI antibody has low activity and poor affinity, and cannot be well applied to the detection of cTnI protein, so that the field has strong demand for an antibody which can effectively and specifically bind and detect cTnI.
Disclosure of Invention
The present invention relates to a novel isolated binding protein comprising a cTnI antigen binding domain and studies on the preparation, use, etc. of the binding protein.
The antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences set forth below; or; has at least 80% sequence identity with the complementarity determining regions of the amino acid sequence described below and has K with cardiac troponin ID≤2.22×10-8Affinity of mol/L;
CDR-VH1 is G-X1-T-F-T-X2-Y-N-X3-H, wherein,
x1 is F or Y, X2 is E or D, X3 is V, L or I;
CDR-VH2 is Y-X1-Y-P-X2-N-G-I-X3-G-Y-N-Q, wherein,
x1 is I or L, X2 is N or Y, X3 is S or T;
CDR-VH3 is R-X1-A-Y-X2-Y-D-W-X3-A-Y, wherein,
x1 is D or E, X2 is E or D, X3 is L or I;
the complementarity determining region CDR-VL1 is S-Q-S-X1-G-X2-N-X3-Y, wherein,
x1 is I, V or L, X2 is T or S, X3 is L or I;
the complementarity determining region CDR-VL2 is Y-A-X1-X2-S-I-S, wherein,
x1 is S or T, X2 is D, Q or E;
the CDR-VL3 is Q-S-X1-X2-W-P-Y-T, wherein,
x1 is Q or N, X2 is D, Q or N;
an important advantage is that the binding protein is highly active and has a high affinity for the human cTnI protein.
Detailed Description
The present invention may be understood more readily by reference to the following description of certain embodiments of the invention and the detailed description of the examples included therein.
Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such embodiments are necessarily varied. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
Noun definitions
"isolated binding protein comprising an antigen binding domain" broadly refers to all proteins/protein fragments that comprise a CDR region. The term "antibody" includes polyclonal and monoclonal antibodies and antigenic compound-binding fragments of these antibodies, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies and minimal recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".
The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region (VL or VH) is composed of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The extent of the framework regions and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest), E.Kabat et al, U.S. department of Health and Human Services (U.S.. department of Health and Human Services), (1983), and Chothia. The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.
As used herein, the "framework" or "FR" regions mean the regions of the antibody variable domain excluding those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3 and FR 4).
Typically, the variable domains VL/VH of the heavy and light chains are obtained by linking the CDRs and FRs numbered as follows in a combinatorial arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR 4.
As used herein, the term "purified" or "isolated" in relation to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its native medium or native form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally associated with or normally mixed with or in solution. Isolated polypeptides include the naturally-produced polypeptide contained in a cell lysate, the polypeptide in purified or partially purified form, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous host cell or culture. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).
Exemplary embodiments of the invention
The present invention relates to an isolated binding protein comprising an antigen binding domain, wherein the antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences set forth in seq id nos; or; has at least 8 complementarity determining regions with the following amino acid sequence0% sequence identity and K with cardiac troponin ID≤7.12×10-10Affinity of mol/L;
CDR-VH1 is G-X1-T-F-T-X2-Y-N-X3-H, wherein,
x1 is F or Y, X2 is E or D, X3 is V, L or I;
CDR-VH2 is Y-X1-Y-P-X2-N-G-I-X3-G-Y-N-Q, wherein,
x1 is I or L, X2 is N or Y, X3 is S or T;
CDR-VH3 is R-X1-A-Y-X2-Y-D-W-X3-A-Y, wherein,
x1 is D or E, X2 is E or D, X3 is L or I;
the complementarity determining region CDR-VL1 is S-Q-S-X1-G-X2-N-X3-Y, wherein,
x1 is I, V or L, X2 is T or S, X3 is L or I;
the complementarity determining region CDR-VL2 is Y-A-X1-X2-S-I-S, wherein,
x1 is S or T, X2 is D, Q or E;
the CDR-VL3 is Q-S-X1-X2-W-P-Y-T, wherein,
x1 is Q or N, X2 is D, Q or N.
In some embodiments, the antigen binding domain has at least 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to a complementarity determining region of an amino acid sequence having K with pepsinogen IID≤2.22×10-8mol/L，KDThe value can also be selected to be 1 × 10-9mol/L、2×10-9mol/L、3×10-9mol/L、4×10-9mol/L、4.5×10-9mol/L、5×10-9mol/L、6×10-9mol/L、7×10-9mol/L、8×10-9mol/L、9×10-9mol/L、1×10-10mol/L、3×10-10mol/L、5×10-10mol/L、7×10-10mol/L、9×10-10mol/L or 1X 10-8mol/L；
Or 7.12X 10-10mol/L≤KD≤2.22×10-8mol/L；
Wherein the affinity is determined according to the method of the present specification.
In some embodiments:
in the complementarity determining region CDR-VH1, X1 is Y;
in the complementarity determining region CDR-VH2, X3 is T;
in the complementarity determining region CDR-VH3, X3 is L;
in the complementarity determining region CDR-VL1, X2 is T;
in the complementarity determining region CDR-VL2, X1 is S;
in the complementarity determining region CDR-VL3, X1 is N.
In some embodiments, in the complementarity determining region CDR-VH1, X2 is E.
In some embodiments, in the complementarity determining region CDR-VH1, X2 is D.
In some embodiments, in the complementarity determining region CDR-VH1, X3 is V.
In some embodiments, in the complementarity determining region CDR-VH1, X3 is L.
In some embodiments, in the complementarity determining region CDR-VH1, X3 is I.
In some embodiments, in the complementarity determining region CDR-VH2, X1 is I.
In some embodiments, in the complementarity determining region CDR-VH2, X1 is L.
In some embodiments, in the complementarity determining region CDR-VH2, X2 is N.
In some embodiments, in the complementarity determining region CDR-VH2, X2 is Y.
In some embodiments, in the complementarity determining region CDR-VH3, X1 is D.
In some embodiments, in the complementarity determining region CDR-VH3, X1 is E.
In some embodiments, in the complementarity determining region CDR-VH3, X2 is E.
In some embodiments, in the complementarity determining region CDR-VH3, X2 is D.
In some embodiments, in the complementarity determining region CDR-VL1, X1 is I.
In some embodiments, in the complementarity determining region CDR-VL1, X1 is V.
In some embodiments, in the complementarity determining region CDR-VL1, X1 is L.
In some embodiments, in the complementarity determining region CDR-VL1, X3 is L.
In some embodiments, in the complementarity determining region CDR-VL1, X3 is I.
In some embodiments, in the complementarity determining region CDR-VL2, X2 is D.
In some embodiments, in the complementarity determining region CDR-VL2, X2 is Q.
In some embodiments, in the complementarity determining region CDR-VL2, X2 is E.
In some embodiments, in the complementarity determining region CDR-VL3, X2 is D.
In some embodiments, in the complementarity determining region CDR-VL3, X2 is Q.
In some embodiments, in the complementarity determining region CDR-VL3, X2 is N.
In some embodiments, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:
| site of the body | CDR-VH1X2/X3 | CDR-VH2X1/X2 | CDR-VH3X1/X2 | CDR-VL1X1/X3 | CDR-VL2X2 | CDR-VL3X2 |
| Mutant combination 1 | E/V | I/N | D/E | I/L | D | D |
| Combination of mutations 2 | E/L | I/Y | D/D | I/I | Q | Q |
| Combination of mutations 3 | E/I | L/N | E/E | V/L | E | N |
| Combination of mutations 4 | D/L | L/Y | E/D | V/I | Q | Q |
| Combination of mutations 5 | D/I | I/Y | E/E | L/L | E | N |
| Combination of mutations 6 | D/V | L/N | E/D | L/I | D | Q |
| Mutant combination 7 | E/I | I/N | D/E | I/L | E | N |
| Combination of mutations 8 | D/V | L/Y | D/D | V/L | D | D |
| Combination of mutations 9 | D/L | L/N | D/D | L/L | Q | Q |
| Combination of mutations 10 | E/V | L/Y | E/E | I/I | D | N |
| Combination of mutations 11 | E/L | I/N | E/D | V/I | Q | Q |
| Mutant combination 12 | D/I | I/Y | D/E | L/I | E | D |
| Mutant combinations 13 | E/L | I/N | E/D | V/L | Q | D |
| Combination of mutations 14 | D/I | L/Y | D/D | L/I | E | Q |
| Combination of mutations 15 | E/V | I/Y | E/E | I/I | D | N |
| Mutant combinations 16 | D/I | L/N | D/E | V/I | E | Q |
| Mutant combinations 17 | E/V | I/N | D/D | I/L | D | N |
| Mutant combinations 18 | D/L | I/Y | E/E | V/L | Q | Q |
| Combination of mutations 19 | E/V | L/N | D/E | L/I | D | N |
| Combination of mutations 20 | E/L | L/Y | E/D | L/L | Q | D |
| Mutant combination 21 | E/I | I/Y | D/E | V/I | E | Q |
| Mutant combination 22 | D/L | L/N | D/D | V/L | Q | N |
| Mutant combination 23 | D/I | I/N | E/E | I/I | E | Q |
| Mutant combinations 24 | D/V | L/Y | E/D | I/L | D | D |
| Mutant combinations 25 | E/I | L/N | E/E | I/L | E | D |
| Mutant combinations 26 | D/V | L/Y | E/D | I/I | D | Q |
| Mutant combinations 27 | D/L | I/N | D/E | V/L | Q | N |
| Mutant combinations 28 | E/V | I/Y | D/D | V/I | D | Q |
| Mutant combinations 29 | E/L | I/N | D/D | L/L | Q | N |
| Combination of mutations 30 | D/I | L/Y | E/E | L/I | E | Q |
| Combination of mutations 31 | E/L | I/Y | E/D | I/L | Q | N |
| Mutant combinations 32 | D/I | L/N | D/E | V/L | E | D |
| Mutant combinations 33 | E/V | I/N | E/D | L/L | D | Q |
| Mutant combinations 34 | D/I | I/Y | D/D | I/I | E | N |
| Combination of mutations 35 | E/V | L/N | E/E | V/I | D | Q |
| Combination of mutations 36 | D/L | L/Y | D/E | L/I | Q | D |
| Mutant combinations 37 | E/V | I/Y | D/D | V/L | D | D |
| Combination of mutations 38 | E/L | L/N | E/E | L/I | Q | Q |
| Mutant combinations 39 | E/I | I/N | D/E | I/I | E | N |
| Combination of mutations 40 | D/L | L/N | D/E | I/L | Q | N |
| Mutant combination 41 | D/I | L/Y | D/D | V/L | E | Q |
| Combination of mutations 42 | E/V | I/N | E/E | L/I | D | N |
| Mutant combinations 43 | D/I | I/Y | E/D | L/L | E | D |
| Mutant combinations 44 | D/V | I/N | E/E | V/I | D | Q |
| Combination of mutations 45 | E/L | L/Y | E/D | V/L | Q | N |
| Mutant combinations 46 | E/V | I/Y | D/E | I/I | D | Q |
| Mutant combinations 47 | D/L | L/N | D/D | I/L | Q | D |
| Mutant combinations 48 | E/I | I/N | D/D | I/L | E | D |
| Mutant combinations 49 | D/L | I/Y | E/E | I/I | Q | Q |
| Mutant combinations 50 | E/I | L/N | E/D | V/L | E | N |
| Mutant combinations 51 | D/V | L/Y | D/E | V/I | D | Q |
| Combination of mutations52 | E/I | I/Y | E/D | L/L | E | N |
| Mutant combination 53 | D/V | L/N | D/D | L/I | D | Q |
In some embodiments, the binding protein includes at least 3 CDRs (e.g., 3 CDRs of a heavy chain, or 3 CDRs of a light chain); alternatively, the binding protein comprises at least 6 CDRs.
In some embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.
In some embodiments, the binding protein is a "functional fragment" of an antibody, e.g., a nanobody, F (ab')2Fab', Fab, Fv, scFv, diabody and antibody minimal recognition unit.
scFv (sc = single chain), bispecific antibodies (diabodies).
The "functional fragment" as defined in the present invention particularly refers to an antibody fragment having the same specificity for cTnI as the parent antibody. In addition to the above functional fragments, any fragment having an increased half-life is also included.
These functional fragments typically have the same binding specificity as the antibody from which they are derived. As the person skilled in the art deduces from the description of the invention, the antibody fragment of the invention may be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction cleavage of disulfide bonds.
Antibody fragments can also be obtained by peptide synthesis by recombinant genetic techniques also known to those skilled in the art or by, for example, automated peptide synthesizers, such as those sold by Applied BioSystems and the like.
In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence shown in SEQ ID NOS: 1-4, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence shown in SEQ ID NOS: 5-8.
In addition to the amino acid sequences disclosed herein above, the framework regions may be derived from human species to constitute humanized antibodies.
In some embodiments, the binding protein further comprises an antibody constant region sequence.
In some embodiments, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.
In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.
In some embodiments, the constant region is derived from a mouse;
the light chain constant region sequence is shown as SEQ ID NO. 9;
the heavy chain constant region sequence is shown in SEQ ID NO 10.
According to one aspect of the invention, the invention also relates to an isolated nucleic acid molecule, which is DNA or RNA, encoding a binding protein as described above.
According to one aspect of the invention, the invention also relates to a vector comprising a nucleic acid molecule as described above.
The invention further comprises at least one nuclear construct, e.g. a plasmid, further an expression plasmid, encoding a nucleic acid molecule as described above, the construction of which vector will be described in one embodiment of the present application.
According to one aspect of the invention, the invention also relates to a host cell transformed with a vector as described above.
The host cell may be a eukaryotic cell, such as a mammalian cell.
In some embodiments, the host cell is a CHO cell.
According to one aspect of the invention, the invention also relates to a method for producing a binding protein as described above, said method comprising the steps of:
the host cells as described above are cultured in a medium and under suitable culture conditions, and the binding protein so produced is recovered from the medium or from the cultured host cells.
According to one aspect of the invention, the invention also relates to the use of a binding protein as described above for the preparation of a diagnostic agent or kit for the diagnosis of acute myocardial infarction, acute coronary syndrome, pulmonary infarction, unstable angina pectoris, myocardial injury.
According to one aspect of the invention, the invention also relates to a method for detecting troponin I antigen in a test sample, comprising:
a) contacting a troponin I antigen in the test sample with a binding protein as defined above to form an immune complex under conditions sufficient for an antibody/antigen binding reaction to occur; and
b) detecting the presence of said immune complex, the presence of said complex being indicative of the presence of said troponin I antigen in said test sample;
in this embodiment, the binding protein may be labeled with an indicator that indicates the strength of the signal, so that the complex is readily detected.
In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;
in this embodiment, the binding protein forms a partner antibody with the second antibody in the form of a first antibody for binding to a different epitope of cTnI;
the second antibody may be labeled with an indicator showing the intensity of the signal so that the complex is easily detected.
In some embodiments, in step a), a second antibody is further included in the immune complex, which second antibody binds to the troponin I antigen;
in this embodiment, the binding protein serves as an antigen for the second antibody, which may be labeled with an indicator of signal intensity to allow the complex to be readily detected.
In some embodiments, the indicator that shows signal intensity comprises any one of a fluorescent substance, a quantum dot, a digoxigenin-labeled probe, biotin, a radioisotope, a radiocontrast agent, a paramagnetic ion fluorescent microsphere, an electron-dense substance, a chemiluminescent label, an ultrasound contrast agent, a photosensitizer, colloidal gold, or an enzyme.
In some embodiments, the fluorescent species include Alexa 350, Alexa 405, Alexa 430, Alexa 488, Alexa 555, Alexa 647, AMCA, aminoacridine, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4 ', 5' -dichloro-2 ', 7' -dimethoxyfluorescein, 5-carboxy-2 ', 4', 5', 7' -tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, dansyl chloride, fluorescein, HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-1, 3-diazole), Oregon Green 488, Oregon Green 500, Oregon Green514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresyl fast violet, cresyl Blue violet, brilliant cresol Blue, p-aminobenzoic acid, erythrosine, phthalocyanine, azomethine, cyanine, xanthine, succinyl fluorescein, rare earth metal cryptate, tripyridyldiamine europium, europium cryptate, diamine, bispyanin, La Jolla Blue dye, allophycocyanin, allocyanin B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin R, REG, rhodamine Green, rhodamine isothiocyanate, rhodamine red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine, and texas red.
In some embodiments, the radioisotope comprises110In、111In、177Lu、18F、52Fe、62Cu、64Cu、67Cu、67Ga、68Ga、86Y、90Y、89Zr、94mTc、94Tc、99mTc、120I、123I、124I、125I、131I、154-158Gd、32P、11C、13N、15O、186Re、188Re、51Mn、52mMn、55Co、72As、75Br、76Br、82mRb and83sr.
In some embodiments, the enzyme comprises any one of horseradish peroxidase, alkaline phosphatase, and glucose oxidase.
In some embodiments, the fluorescent microspheres are: the polystyrene fluorescent microsphere is internally wrapped with rare earth fluorescent ion europium.
According to one aspect of the invention, the invention also relates to a kit comprising a binding protein as described above.
Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example 1
This example provides an exemplary method for the preparation of recombinant antibodies against human cardiac troponin I.
S10, constructing an expression plasmid:
restriction enzyme, Prime Star DNA polymerase in this example was purchased from Takara;
the MagExtractor-RNA extraction kit was purchased from TOYOBO;
BD SMART ™ RACE cDNA Amplification Kit was purchased from Takara;
pMD-18T vector was purchased from Takara;
the plasmid extraction kit is purchased from Tiangen corporation;
primer synthesis and gene sequencing were done by Invitrogen;
the Anti-cTnI 12D2 monoclonal antibody is secreted as an existing hybridoma cell strain, and is recovered for later use.
S11, design and synthesis of primers:
5' RACE upstream primers for heavy and light chain amplification:
SMARTER II A Oligonucleotide：
5’>AAGCAGTGGTATCAACGCAGAGTACXXXXX<3’;
5'-RACE CDS Primer（5'-CDS)：5’>(T)25VN<3’(N=A,C,G,orT;V=A,G,orC);
Universal Primer A Mix(UPM):
5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’;
Nested Universal Primer A(NUP):
5’>AAGCAGTGGTATCAACGCAGAGT<3’；
mIgG CKR：5’> CGCCTAACACTCATTCCTGTTGAAGC <3’；
mIgG CHR：5’> CCGCTCATTTACCCGGAGACCG <3’。
s12, antibody variable region gene cloning and sequencing:
RNA extracted from hybridoma cell strain secreting Anti-cTnI 12D2 monoclonal antibody is synthesized into first strand cDNA by using SMARTERTM RACE cDNA Amplification Kit and SMARTER II A Oligonucleotide and 5' -CDS primer in the Kit, and the obtained first strand cDNA product is used as PCR Amplification template. The Light Chain gene was amplified with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIgG CKR primers, and the Heavy Chain gene was amplified with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIgG CHR primers. The primer pair of Light Chain can amplify a target band about 0.7KB, and the primer pair of Heavy Chain can amplify a target band about 1.4 KB. The product was purified and recovered by agarose gel electrophoresis, and the product was subjected to A addition reaction with rTaq DNA polymerase, inserted into pMD-18T vector, transformed into DH 5. alpha. competent cells, and after colonies were grown, 4 clones of the Heavy Chain and Light Chain gene clones were each cloned and sent to Invitrogen corporation for sequencing.
Sequence analysis of the S13, Anti-cTnI 12D2 antibody variable region genes:
putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI 11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene fragment amplified by the Light Chain, the VL gene sequence is 357bp, belongs to the VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the Heavy Chain primer pair, the VH gene sequence is 366bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.
S14, construction of recombinant antibody expression plasmid:
the pcDNA3.4 TOPO vector is a constructed recombinant antibody eukaryotic expression vector, multiple cloning enzyme cutting sites such as HindIII, BamHI, EcoRI and the like are introduced into the expression vector, and the expression vector is named as a pcDNA3.4A expression vector and is called as a3.4A expression vector for short in the following; according to the sequencing result of the antibody variable region gene in the pMD-18T, VL and VH gene specific primers of the Anti-cTnI 12D2 antibody are designed, wherein two ends of the primers are respectively provided with HindIII and EcoRI enzyme cutting sites and protective bases, and the primers are as follows:
cTnI-12D2-HF：5’> CCCAAGCTTGCCGCCACCATGAGTGTGCTCACTCAGGTCCTGGGGT <3’；
cTnI-12D2-HR:5’> GGGGAATTCTCATTTACCCGGAGACCGGGAGATGGTCTTC<3’；
cTnI-12D2-LF:5’>CCCAAGCTTGCCGCCACCATGAAGTCACAGACCCAGGTCTTCGTA <3’；
cTnI-12D2-LR: 5’>CCCGAATTCTCAACACTCATTCCTGTTGAAGCTCTTGACGATG<3’；
a0.73 KB Light Chain gene fragment and a 1.45KB Heavy Chain gene fragment were amplified by PCR amplification. The gene fragments of the Heavy Chain and the Light Chain are subjected to double enzyme digestion by HindIII/EcoRI respectively, the 3.4A vector is subjected to double enzyme digestion by HindIII/EcoRI, the Heavy Chain gene and the Light Chain gene are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the Heavy Chain and the Light Chain are respectively obtained.
Example 2
Recombinant antibody expression plasmid transient transfection CHO cell and expression supernatant antibody activity identification
Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 107cells/ml in centrifuge tube, 100ul plasmid and 700ul cell mixture, transferring to electric rotor, transferring to 10ml containing CD CHO AGT culture medium, culturing in 37 degree shaker (8% CO)2Amplitude 150); the cell viability was measured by sampling every day, and when the cell viability was less than 50%, the cell culture supernatant was centrifuged to obtain an antibody (having light and heavy chains having the sequences shown in SEQ ID NOS: 11 and 12). Take 4 μ g of purified antibody for reducing SDS-PAGE.
Upon analysis, the complementarity determining region (WT) of the heavy chain:
CDR-VH1 is G-F (X1) -T-F-T-E (X2) -Y-N-V (X3) -H;
CDR-VH2 is Y-I (X1) -Y-P-N (X2) -N-G-I-S (X3) -G-Y-N-Q;
CDR-VH3 is R-D (X1) -A-Y-E (X2) -Y-D-W-I (X3) -A-Y;
complementarity determining regions of the light chain:
CDR-VL1 is S-Q-S-I (X1) -G-S (X2) -N-L (X3) -Y;
CDR-VL2 is Y-A-T (X1) -D (X2) -S-I-S;
CDR-VL3 is Q-S-Q (X1) -D (X2) -W-P-Y-T;
wherein, X1, X2 and X3 are all the sites to be mutated.
TABLE 1 mutant sites associated with antibody Activity
| Site of the body | CDR-VH1X1 | CDR-VH2X3 | CDR-VH3X3 | CDR-VL1X2 | CDR-VL2X1 | CDR-VL3X1 |
| WT | F | S | I | S | T | Q |
| Mutation 1 | Y | T | L | T | S | N |
| Mutation 2 | Y | S | L | T | S | N |
| Mutation 3 | Y | T | I | T | S | Q |
| Mutation 4 | F | T | I | T | T | N |
| Mutation 5 | Y | S | L | S | S | Q |
The inventors performed the above-described mutation of the CDR sites in WT to obtain a more active antibody.
Diluting the cTnI quality control product recombinant antigen to 1ug/ml by the coating solution, and coating the cTnI quality control product recombinant antigen in a micropore plate at 100uL per pore for overnight at 4 ℃; the next day, washing with the washing solution for 2 times, and patting dry; add blocking solution (20% BSA +80% PBS), 120uL, 37 ℃, 1h per well, pat dry; adding the diluted cTnI monoclonal antibody, 100 uL/hole, 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100uL per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 uL/hole), adding a developing solution B (50 uL/hole), and carrying out 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 uL/hole; OD readings were taken at 450nm (reference 630 nm) on the microplate reader.
TABLE 2 antibody Activity assay data
| Sample concentration ng/ml | WT | Mutation 1 | Mutation 2 | Mutation 3 | Mutation 4 | Mutation 5 |
| 1000 | 1.919 | 2.407 | 2.397 | 2.314 | 2.146 | 2.115 |
| 200 | 1.673 | 2.194 | 2.124 | 2.098 | 1.977 | 1.940 |
| 40 | 0.535 | 1.265 | 1.253 | 1.1 | 1.005 | 1.092 |
| 8 | 0.431 | 0.371 | 0.361 | 0.339 | 0.238 | 0.286 |
| 1.6 | 0.104 | 0.142 | 0.139 | 0.124 | 0.135 | 0.120 |
| 0.32 | 0.092 | 0.112 | 0.101 | 0.086 | 0.079 | 0.073 |
| 0 | 0.080 | 0.073 | 0.058 | 0.073 | 0.064 | 0.084 |
As can be seen from the above table, the activity effect of mutation 1 is the best, so that mutation sites with better potency are screened by using mutation 1 as a framework sequence (ensuring that the activity of the antibody obtained by screening is similar to that of mutation 1, and the antibody activity is +/-10%), and partial results are as follows.
TABLE 3 mutation sites related to antibody affinity
| Site of the body | CDR-VH1X2/X3 | CDR-VH2X1/X2 | CDR-VH3X1/X2 | CDR-VL1X1/X3 | CDR-VL2X2 | CDR-VL3X2 |
| Mutation 1 | E/V | I/N | D/E | I/L | D | D |
| Mutation 1-1 | E/L | I/Y | D/D | I/I | Q | Q |
| Mutations 1-2 | E/I | L/N | E/E | V/L | E | N |
| Mutations 1 to 3 | D/L | L/Y | E/D | V/I | Q | Q |
| Mutations 1 to 4 | D/I | I/Y | E/E | L/L | E | N |
| Mutations 1 to 5 | D/V | L/N | E/D | L/I | D | Q |
| Mutations 1 to 6 | E/I | I/N | D/E | I/L | E | N |
| Mutations 1 to 7 | D/V | L/Y | D/D | V/L | D | D |
| Mutations 1 to 8 | D/L | L/N | D/D | L/L | Q | Q |
| Mutations 1 to 9 | E/V | L/Y | E/E | I/I | D | N |
| Mutations 1-10 | E/L | I/N | E/D | V/I | Q | Q |
| Mutations 1 to 11 | D/I | I/Y | D/E | L/I | E | D |
| Mutations 1 to 12 | E/L | I/N | E/D | V/L | Q | D |
| Mutations 1 to 13 | D/I | L/Y | D/D | L/I | E | Q |
| Mutations 1 to 14 | E/V | I/Y | E/E | I/I | D | N |
| Mutations 1-15 | D/I | L/N | D/E | V/I | E | Q |
| Mutations 1 to 16 | E/V | I/N | D/D | I/L | D | N |
| Mutations 1-17 | D/L | I/Y | E/E | V/L | Q | Q |
| Mutations 1-18 | E/V | L/N | D/E | L/I | D | N |
| Mutations 1-19 | E/L | L/Y | E/D | L/L | Q | D |
| Mutations 1-20 | E/I | I/Y | D/E | V/I | E | Q |
| Mutations 1-21 | D/L | L/N | D/D | V/L | Q | N |
| Mutations 1-22 | D/I | I/N | E/E | I/I | E | Q |
| Mutations 1-23 | D/V | L/Y | E/D | I/L | D | D |
| Mutations 1-24 | E/I | L/N | E/E | I/L | E | D |
| Mutations 1-25 | D/V | L/Y | E/D | I/I | D | Q |
| Mutations 1-26 | D/L | I/N | D/E | V/L | Q | N |
| Mutations 1-27 | E/V | I/Y | D/D | V/I | D | Q |
| Mutations 1-28 | E/L | I/N | D/D | L/L | Q | N |
| Mutations 1-29 | D/I | L/Y | E/E | L/I | E | Q |
| Mutations 1-30 | E/L | I/Y | E/D | I/L | Q | N |
| Mutations 1-31 | D/I | L/N | D/E | V/L | E | D |
| Mutations 1-32 | E/V | I/N | E/D | L/L | D | Q |
| Mutations 1-33 | D/I | I/Y | D/D | I/I | E | N |
| Mutations 1 to 34 | E/V | L/N | E/E | V/I | D | Q |
| Mutations 1-35 | D/L | L/Y | D/E | L/I | Q | D |
| Mutations 1 to 36 | E/V | I/Y | D/D | V/L | D | D |
| Mutations 1-37 | E/L | L/N | E/E | L/I | Q | Q |
| Mutations 1-38 | E/I | I/N | D/E | I/I | E | N |
| Mutations 1-39 | D/L | L/N | D/E | I/L | Q | N |
| Mutations 1-40 | D/I | L/Y | D/D | V/L | E | Q |
| Mutations 1-41 | E/V | I/N | E/E | L/I | D | N |
| Mutations 1-42 | D/I | I/Y | E/D | L/L | E | D |
| Mutations 1-43 | D/V | I/N | E/E | V/I | D | Q |
| Mutations 1-44 | E/L | L/Y | E/D | V/L | Q | N |
| Mutations 1-45 | E/V | I/Y | D/E | I/I | D | Q |
| Mutations 1-46 | D/L | L/N | D/D | I/L | Q | D |
| Mutations 1-47 | E/I | I/N | D/D | I/L | E | D |
| Mutations 1-48 | D/L | I/Y | E/E | I/I | Q | Q |
| Mutations 1-49 | E/I | L/N | E/D | V/L | E | N |
| Mutations 1-50 | D/V | L/Y | D/E | V/I | D | Q |
| Mutations 1-51 | E/I | I/Y | E/D | L/L | E | N |
| Mutations 1-52 | D/V | L/N | D/D | L/I | D | Q |
Affinity assay
Using AMC sensors, purified antibodies with PBST diluted to 10ug/ml, CTNI quality control recombinant protein PBST gradient dilution:
1000nmol、500nmol、250nmol、125nmol、62.5nmol、31.25nmol、15.625nmol、0nmol；
the operation flow is as follows: equilibrating in buffer 1 (PBST) for 60s, immobilizing antibody in antibody solution for 300s, incubating in buffer 2 (PBST) for 180s, binding in antigen solution for 420s, dissociating in buffer 2 for 800s, regenerating the sensor with 10mM GLY solution pH 1.69 and buffer 3, and outputting the data.
Table 4 affinity assay data
| Site of the body | KD (M) | KON (1/Ms) | kdis(1/s) |
| Mutation 1 | 3.80E-09 | 3.12E+05 | 1.19E-03 |
| Mutation 1-1 | 4.68E-09 | 3.61E+05 | 1.69E-03 |
| Mutations 1-2 | 4.37E-09 | 4.77E+05 | 2.08E-03 |
| Mutations 1 to 3 | 8.51E-10 | 4.77E+05 | 4.06E-04 |
| Mutations 1 to 4 | 7.35E-09 | 7.44E+05 | 5.47E-03 |
| Mutations 1 to 5 | 3.31E-09 | 1.70E+05 | 5.63E-04 |
| Mutations 1 to 6 | 2.58E-09 | 2.33E+05 | 6.01E-04 |
| Mutations 1 to 7 | 6.58E-09 | 2.32E+05 | 1.53E-03 |
| Mutations 1 to 8 | 9.60E-10 | 2.32E+05 | 2.23E-04 |
| Mutations 1 to 9 | 2.09E-09 | 3.84E+05 | 8.03E-04 |
| Mutations 1-10 | 3.29E-09 | 8.37E+05 | 2.75E-03 |
| Mutations 1 to 11 | 1.52E-09 | 1.02E+05 | 1.55E-04 |
| Mutations 1 to 12 | 2.12E-09 | 1.63E+05 | 3.46E-04 |
| Mutations 1 to 13 | 3.56E-09 | 6.95E+05 | 2.47E-03 |
| Mutations 1 to 14 | 1.26E-09 | 4.01E+05 | 5.05E-04 |
| Mutations 1-15 | 1.91E-09 | 2.13E+05 | 4.07E-04 |
| Mutations 1 to 16 | 2.21E-09 | 1.94E+05 | 4.29E-04 |
| Mutations 1-17 | 3.22E-09 | 2.23E+05 | 7.18E-04 |
| Mutations 1-18 | 2.49E-09 | 7.19E+05 | 1.79E-03 |
| Mutations 1-19 | 1.11E-09 | 1.17E+05 | 1.30E-04 |
| Mutations 1-20 | 5.32E-09 | 4.17E+05 | 2.22E-03 |
| Mutations 1-21 | 3.85E-09 | 3.04E+05 | 1.17E-03 |
| Mutations 1-22 | 9.08E-09 | 4.34E+05 | 3.94E-03 |
| Mutations 1-23 | 4.37E-09 | 1.83E+05 | 8.00E-04 |
| Mutations 1-24 | 9.15E-09 | 3.10E+05 | 2.84E-03 |
| Mutations 1-25 | 3.36E-09 | 7.50E+05 | 2.52E-03 |
| Mutations 1-26 | 1.42E-09 | 2.65E+05 | 3.76E-04 |
| Mutations 1-27 | 5.22E-09 | 3.04E+05 | 1.59E-03 |
| Mutations 1-28 | 2.13E-09 | 1.45E+05 | 3.09E-04 |
| Mutations 1-29 | 3.32E-09 | 3.48E+05 | 1.16E-03 |
| Mutations 1-30 | 2.48E-09 | 2.31E+05 | 5.73E-04 |
| Mutations 1-31 | 3.16E-09 | 1.57E+05 | 4.96E-04 |
| Mutations 1-32 | 3.84E-09 | 1.56E+05 | 5.99E-04 |
| Mutations 1-33 | 1.92E-09 | 2.42E+05 | 4.65E-04 |
| Mutations 1 to 34 | 2.42E-09 | 4.12E+05 | 9.97E-04 |
| Mutations 1-35 | 3.29E-09 | 9.87E+05 | 3.25E-03 |
| Mutations 1 to 36 | 2.66E-09 | 1.58E+05 | 4.20E-04 |
| Mutations 1-37 | 2.44E-09 | 4.58E+05 | 1.12E-03 |
| Mutations 1-38 | 1.74E-09 | 3.70E+05 | 6.44E-04 |
| Mutations 1-39 | 3.88E-09 | 3.50E+05 | 1.36E-03 |
| Mutations 1-40 | 2.43E-09 | 2.07E+05 | 5.02E-04 |
| Mutations 1-41 | 2.52E-09 | 2.32E+05 | 5.83E-04 |
| Mutations 1-42 | 7.95E-09 | 2.34E+05 | 1.86E-03 |
| Mutations 1-43 | 1.68E-09 | 1.49E+05 | 2.50E-04 |
| Mutations 1-44 | 5.68E-09 | 4.16E+05 | 2.36E-03 |
| Mutations 1-45 | 1.77E-09 | 3.06E+05 | 5.42E-04 |
| Mutations 1-46 | 7.12E-10 | 4.16E+05 | 2.96E-04 |
| Mutations 1-47 | 1.81E-09 | 4.38E+05 | 7.93E-04 |
| Mutations 1-48 | 3.67E-09 | 2.39E+05 | 8.77E-04 |
| Mutations 1-49 | 1.77E-09 | 5.04E+05 | 8.92E-04 |
| Mutations 1-50 | 6.18E-09 | 2.95E+05 | 1.82E-03 |
| Mutations 1-51 | 2.08E-09 | 2.45E+05 | 5.10E-04 |
| Mutations 1-52 | 2.62E-09 | 4.24E+05 | 1.11E-03 |
As can be seen from table 4, the mutation sites listed in table 3 have little effect on the affinity of the antibody.
To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.
TABLE 5 mutations with WT as backbone
| Site of the body | CDR-VH1X2/X3 | CDR-VH2X1/X2 | CDR-VH3X1/X2 | CDR-VL1X1/X3 | CDR-VL2X2 | CDR-VL3X2 |
| WT | E/V | I/N | D/E | I/L | D | D |
| WT 1-5 | D/I | L/N | E/D | L/I | E | Q |
| WT 1-10 | E/I | I/N | E/D | V/I | Q | Q |
| WT 1-20 | E/I | I/Y | D/E | V/I | E | Q |
| WT 1-30 | E/I | I/Y | E/D | I/L | D | N |
| WT 1-40 | D/I | L/Y | D/D | V/L | E | Q |
Table 6 affinity assay data
From the analyses in tables 5 and 6, the association between the mutation site and other sites was not significant on the premise that the antibody activity was ensured.
SEQUENCE LISTING
<110> Dongguan City of Pengzhi Biotech Co., Ltd
<120> recombinant antibody against human cardiac troponin I
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 25
<212> PRT
<213> Mus musculus
<400> 1
Asp Ile Leu Leu Thr Gln Ser Pro Val Ile Leu Ser Val Ser Pro Gly
1 5 10 15
Glu Arg Val Ser Phe Ser Cys Arg Ala
20 25
<210> 2
<211> 15
<212> PRT
<213> Mus musculus
<400> 2
Trp Tyr Gln Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile Lys
1 5 10 15
<210> 3
<211> 33
<212> PRT
<213> Mus musculus
<400> 3
Gly Ile Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
1 5 10 15
Leu Ser Ile Asn Ser Val Glu Ser Glu Asp Ile Ala Asp Tyr Tyr Cys
20 25 30
Gln
<210> 4
<211> 10
<212> PRT
<213> Mus musculus
<400> 4
Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
1 5 10
<210> 5
<211> 25
<212> PRT
<213> Mus musculus
<400> 5
Glu Val Gln Leu Gln Gln Ser Gly Pro Asp Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Val Arg Ile Ser Cys Lys Ala Ser
20 25
<210> 6
<211> 14
<212> PRT
<213> Mus musculus
<400> 6
Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile Gly
1 5 10
<210> 7
<211> 35
<212> PRT
<213> Mus musculus
<400> 7
Lys Phe Lys Ser Lys Ala Thr Leu Thr Val Asp Ser Ser Ser Asn Thr
1 5 10 15
Ala Tyr Met Asp Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
20 25 30
Phe Cys Ala
35
<210> 8
<211> 11
<212> PRT
<213> Mus musculus
<400> 8
Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala
1 5 10
<210> 9
<211> 107
<212> PRT
<213> Mus musculus
<400> 9
Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu
1 5 10 15
Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe
20 25 30
Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg
35 40 45
Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser
50 55 60
Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu
65 70 75 80
Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser
85 90 95
Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys
100 105
<210> 10
<211> 335
<212> PRT
<213> Mus musculus
<400> 10
Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Cys Gly
1 5 10 15
Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys Leu Val Lys Gly Tyr
20 25 30
Phe Pro Glu Ser Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser
35 40 45
Ser Val His Thr Phe Pro Ala Leu Leu Gln Ser Gly Leu Tyr Thr Met
50 55 60
Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val
65 70 75 80
Thr Cys Ser Val Ala His Pro Ala Ser Ser Thr Thr Val Asp Lys Lys
85 90 95
Leu Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro Cys Pro Pro Cys
100 105 110
Lys Glu Cys His Lys Cys Pro Ala Pro Asn Leu Glu Gly Gly Pro Ser
115 120 125
Val Phe Ile Phe Pro Pro Asn Ile Lys Asp Val Leu Met Ile Ser Leu
130 135 140
Thr Pro Lys Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro
145 150 155 160
Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu Val His Thr Ala
165 170 175
Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr Ile Arg Val Val
180 185 190
Ser Thr Leu Pro Ile Gln His Gln Asp Trp Met Ser Gly Lys Glu Phe
195 200 205
Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ser Pro Ile Glu Arg Thr
210 215 220
Ile Ser Lys Ile Lys Gly Leu Val Arg Ala Pro Gln Val Tyr Ile Leu
225 230 235 240
Pro Pro Pro Ala Glu Gln Leu Ser Arg Lys Asp Val Ser Leu Thr Cys
245 250 255
Leu Val Val Gly Phe Asn Pro Gly Asp Ile Ser Val Glu Trp Thr Ser
260 265 270
Asn Gly His Thr Glu Glu Asn Tyr Lys Asp Thr Ala Pro Val Leu Asp
275 280 285
Ser Asp Gly Ser Tyr Phe Ile Tyr Ser Lys Leu Asn Met Lys Thr Ser
290 295 300
Lys Trp Glu Lys Thr Asp Ser Phe Ser Cys Asn Val Arg His Glu Gly
305 310 315 320
Leu Lys Asn Tyr Tyr Leu Lys Lys Thr Ile Ser Arg Ser Pro Gly
325 330 335
<210> 11
<211> 214
<212> PRT
<213> Mus musculus
<400> 11
Asp Ile Leu Leu Thr Gln Ser Pro Val Ile Leu Ser Val Ser Pro Gly
1 5 10 15
Glu Arg Val Ser Phe Ser Cys Arg Ala Ser Gln Ser Ile Gly Ser Asn
20 25 30
Leu Tyr Trp Tyr Gln Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile
35 40 45
Lys Tyr Ala Thr Asp Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Ser
65 70 75 80
Glu Asp Ile Ala Asp Tyr Tyr Cys Gln Gln Ser Gln Asp Trp Pro Tyr
85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala
100 105 110
Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Leu Thr Ser Gly
115 120 125
Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro Lys Asp Ile
130 135 140
Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly Val Leu
145 150 155 160
Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser
165 170 175
Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr
180 185 190
Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro Ile Val Lys Ser
195 200 205
Phe Asn Arg Asn Glu Cys
210
<210> 12
<211> 454
<212> PRT
<213> Mus musculus
<400> 12
Glu Val Gln Leu Gln Gln Ser Gly Pro Asp Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Val Arg Ile Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Glu Tyr
20 25 30
Asn Val His Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Pro Asn Asn Gly Ile Ser Gly Tyr Asn Gln Lys Phe
50 55 60
Lys Ser Lys Ala Thr Leu Thr Val Asp Ser Ser Ser Asn Thr Ala Tyr
65 70 75 80
Met Asp Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys
85 90 95
Ala Arg Asp Ala Tyr Glu Tyr Asp Trp Ile Ala Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr
115 120 125
Pro Leu Ala Pro Gly Cys Gly Asp Thr Thr Gly Ser Ser Val Thr Leu
130 135 140
Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Ser Val Thr Val Thr Trp
145 150 155 160
Asn Ser Gly Ser Leu Ser Ser Ser Val His Thr Phe Pro Ala Leu Leu
165 170 175
Gln Ser Gly Leu Tyr Thr Met Ser Ser Ser Val Thr Val Pro Ser Ser
180 185 190
Thr Trp Pro Ser Gln Thr Val Thr Cys Ser Val Ala His Pro Ala Ser
195 200 205
Ser Thr Thr Val Asp Lys Lys Leu Glu Pro Ser Gly Pro Ile Ser Thr
210 215 220
Ile Asn Pro Cys Pro Pro Cys Lys Glu Cys His Lys Cys Pro Ala Pro
225 230 235 240
Asn Leu Glu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Asn Ile Lys
245 250 255
Asp Val Leu Met Ile Ser Leu Thr Pro Lys Val Thr Cys Val Val Val
260 265 270
Asp Val Ser Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn
275 280 285
Asn Val Glu Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr
290 295 300
Asn Ser Thr Ile Arg Val Val Ser Thr Leu Pro Ile Gln His Gln Asp
305 310 315 320
Trp Met Ser Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu
325 330 335
Pro Ser Pro Ile Glu Arg Thr Ile Ser Lys Ile Lys Gly Leu Val Arg
340 345 350
Ala Pro Gln Val Tyr Ile Leu Pro Pro Pro Ala Glu Gln Leu Ser Arg
355 360 365
Lys Asp Val Ser Leu Thr Cys Leu Val Val Gly Phe Asn Pro Gly Asp
370 375 380
Ile Ser Val Glu Trp Thr Ser Asn Gly His Thr Glu Glu Asn Tyr Lys
385 390 395 400
Asp Thr Ala Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe Ile Tyr Ser
405 410 415
Lys Leu Asn Met Lys Thr Ser Lys Trp Glu Lys Thr Asp Ser Phe Ser
420 425 430
Cys Asn Val Arg His Glu Gly Leu Lys Asn Tyr Tyr Leu Lys Lys Thr
435 440 445
Ile Ser Arg Ser Pro Gly
450
Claims (24)
1. An isolated binding protein comprising an antigen binding domain, wherein said antigen is cardiac troponin I, and wherein said antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL 3; and has K with cardiac troponin ID≤1.39×10-8Affinity of mol/L;
CDR-VH1 is G-X1-T-F-T-X2-Y-N-X3-H, wherein,
x1 is F or Y, X2 is E or D, X3 is V, L or I;
CDR-VH2 is Y-X1-Y-P-X2-N-G-I-X3-G-Y-N-Q, wherein,
x1 is I or L, X2 is N or Y, X3 is S or T;
CDR-VH3 is R-X1-A-Y-X2-Y-D-W-X3-A-Y, wherein,
x1 is D or E, X2 is E or D, X3 is L or I;
the complementarity determining region CDR-VL1 is S-Q-S-X1-G-X2-N-X3-Y, wherein,
x1 is I, V or L, X2 is T or S, X3 is L or I;
the complementarity determining region CDR-VL2 is Y-A-X1-X2-S-I-S, wherein,
x1 is S or T, X2 is D, Q or E;
the CDR-VL3 is Q-S-X1-X2-W-P-Y-T, wherein,
x1 is Q or N, X2 is D, Q or N.
2. The binding protein according to claim 1, wherein in the complementarity determining region CDR-VH1, X1 is Y;
in the complementarity determining region CDR-VH2, X3 is T;
in the complementarity determining region CDR-VH3, X3 is L;
in the complementarity determining region CDR-VL1, X2 is T;
in the complementarity determining region CDR-VL2, X1 is S;
in the complementarity determining region CDR-VL3, X1 is N.
3. The binding protein according to claim 1, wherein in the complementarity determining region CDR-VH1, X1 is F;
in the complementarity determining region CDR-VH2, X3 is S;
in the complementarity determining region CDR-VH3, X3 is I;
in the complementarity determining region CDR-VL1, X2 is S;
in the complementarity determining region CDR-VL2, X1 is T;
in the complementarity determining region CDR-VL3, X1 is Q.
4. An isolated binding protein comprising an antigen binding domain, wherein said antigen is cardiac troponin I, and wherein said antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL 3;
CDR-VH1 is G-X1-T-F-T-X2-Y-N-X3-H, wherein X1 is Y;
CDR-VH2 is Y-X1-Y-P-X2-N-G-I-X3-G-Y-N-Q, wherein X3 is T;
CDR-VH3 is R-X1-A-Y-X2-Y-D-W-X3-A-Y, wherein X3 is L;
CDR-VL1 is S-Q-S-X1-G-X2-N-X3-Y, wherein X2 is T;
CDR-VL2 is Y-A-X1-X2-S-I-S, wherein X1 is S;
CDR-VL3 is Q-S-X1-X2-W-P-Y-T, wherein X1 is N;
the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:
。
5. An isolated binding protein comprising an antigen binding domain, wherein said antigen is cardiac troponin I, and wherein said antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL 3;
CDR-VH1 is G-X1-T-F-T-X2-Y-N-X3-H, wherein X1 is F;
CDR-VH2 is Y-X1-Y-P-X2-N-G-I-X3-G-Y-N-Q, wherein X3 is S;
CDR-VH3 is R-X1-A-Y-X2-Y-D-W-X3-A-Y, wherein X3 is I;
CDR-VL1 is S-Q-S-X1-G-X2-N-X3-Y, wherein X2 is S;
CDR-VL2 is Y-A-X1-X2-S-I-S, wherein X1 is T;
CDR-VL3 is Q-S-X1-X2-W-P-Y-T, wherein X1 is Q;
the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:
。
6. The isolated binding protein comprising an antigen binding domain according to any one of claims 1 to 5, wherein said binding protein is F (ab')2Fab', Fab, Fv, scFv and diabody.
7. The isolated binding protein comprising an antigen binding domain according to any of claims 1 to 5, wherein the binding protein comprises the light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4, in that order, as set forth in SEQ ID Nos. 1 to 4, and/or the heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4, in that order, as set forth in SEQ ID Nos. 5 to 8.
8. The isolated binding protein comprising an antigen binding domain according to any one of claims 1 to 5, wherein the binding protein further comprises an antibody constant region sequence.
9. The binding protein according to claim 8, wherein said constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.
10. The binding protein of claim 9, wherein the species of said constant region is derived from a cow, horse, pig, sheep, goat, rat, mouse, dog, cat, rabbit, donkey, deer, mink, chicken, duck, goose, or human.
11. The binding protein of claim 10, wherein said species source of the constant region is a bovine.
12. The binding protein of claim 10, wherein said species of constant region is derived from turkey or turkey.
13. The binding protein of claim 10, wherein said constant region is of murine origin.
14. The binding protein according to claim 13, wherein the light chain constant region sequence is set forth in SEQ ID NO 9;
the heavy chain constant region sequence is shown in SEQ ID NO 10.
15. An isolated nucleic acid molecule which is DNA or RNA encoding the binding protein of any one of claims 1 to 14.
16. A vector comprising the nucleic acid molecule of claim 15.
17. A host cell transformed with the vector of claim 16.
18. A method of producing a binding protein according to any one of claims 1 to 14, comprising the steps of:
culturing the host cell of claim 17 in a culture medium and under suitable culture conditions, and recovering the binding protein so produced from the culture medium or from the cultured host cell.
19. Use of a binding protein according to any one of claims 1 to 14 for the preparation of a diagnostic agent or kit for the diagnosis of acute myocardial infarction, acute coronary syndrome, pulmonary infarction, unstable angina pectoris, myocardial injury.
20. Use of a binding protein according to any one of claims 1 to 14 for the preparation of a kit for detecting cardiac troponin I in a test sample.
21. The use according to claim 20, wherein the kit is for:
a) contacting a troponin I antigen in the test sample with a binding protein according to claims 1-14 under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex; and
b) detecting the presence of said immune complex, the presence of said complex being indicative of the presence of said troponin I antigen in said test sample.
22. The use according to claim 21,
in step a), a second antibody is further included in the immune complex, which second antibody binds to the binding protein.
23. The use according to claim 21,
in step a), a second antibody is further included in the immune complex, said second antibody binding to the troponin I antigen.
24. A kit for detecting cardiac troponin I comprising a binding protein according to any one of claims 1 to 14.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811180351.XA CN111018975B (en) | 2018-10-10 | 2018-10-10 | Recombinant antibody of anti-human cardiac troponin I |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811180351.XA CN111018975B (en) | 2018-10-10 | 2018-10-10 | Recombinant antibody of anti-human cardiac troponin I |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111018975A CN111018975A (en) | 2020-04-17 |
| CN111018975B true CN111018975B (en) | 2022-04-01 |
Family
ID=70192404
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811180351.XA Active CN111018975B (en) | 2018-10-10 | 2018-10-10 | Recombinant antibody of anti-human cardiac troponin I |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111018975B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113929778A (en) * | 2020-07-14 | 2022-01-14 | 东莞市朋志生物科技有限公司 | Anti-myoglobin antibody and kit |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101105497A (en) * | 2006-07-13 | 2008-01-16 | 上海凯创生物技术有限公司 | Cardiac muscle troponin I detection reagent kit and its preparation method |
| CN101942416A (en) * | 2010-07-23 | 2011-01-12 | 中国医学科学院放射医学研究所 | Anti-human cardiac troponin I specific monoclonal antibody and preparation method thereof |
| CN103173420A (en) * | 2013-04-08 | 2013-06-26 | 深圳市菲鹏生物股份有限公司 | Hybridoma cell capable of secreting anti-cardiac troponin I monoclonal antibodies and applications thereof |
| CN103694355A (en) * | 2013-12-11 | 2014-04-02 | 深圳市菲鹏生物股份有限公司 | Recombinant antibody of anti-human cardiac troponin I as well as construction method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FI20030652A0 (en) * | 2003-04-30 | 2003-04-30 | Susann Eriksson | Improved immune determination |
-
2018
- 2018-10-10 CN CN201811180351.XA patent/CN111018975B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101105497A (en) * | 2006-07-13 | 2008-01-16 | 上海凯创生物技术有限公司 | Cardiac muscle troponin I detection reagent kit and its preparation method |
| CN101942416A (en) * | 2010-07-23 | 2011-01-12 | 中国医学科学院放射医学研究所 | Anti-human cardiac troponin I specific monoclonal antibody and preparation method thereof |
| CN103173420A (en) * | 2013-04-08 | 2013-06-26 | 深圳市菲鹏生物股份有限公司 | Hybridoma cell capable of secreting anti-cardiac troponin I monoclonal antibodies and applications thereof |
| CN103694355A (en) * | 2013-12-11 | 2014-04-02 | 深圳市菲鹏生物股份有限公司 | Recombinant antibody of anti-human cardiac troponin I as well as construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111018975A (en) | 2020-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111217911B (en) | Recombinant antibody of anti-human pepsinogen II | |
| CN111333727B (en) | Binding protein containing NT-proBNP antigen binding structural domain | |
| CN111018976B (en) | Recombinant antibody of anti-human cardiac troponin I | |
| CN111018974B (en) | Recombinant antibody of anti-human cardiac troponin I | |
| CN110818797B (en) | Recombinant antibody of anti-human CA153 protein | |
| CN110818796B (en) | Recombinant antibody of anti-human CA153 protein | |
| CN111018975B (en) | Recombinant antibody of anti-human cardiac troponin I | |
| US20210395394A1 (en) | Antibody against pan-species-specific plasmodium lactate dehydrogenase | |
| CN111018973B (en) | Recombinant antibody of anti-human cardiac troponin I | |
| CN113004405B (en) | Isolated binding protein comprising NT-proBNP antigen binding domain | |
| CN111363035B (en) | Recombinant antibody of anti-heart fatty acid binding protein | |
| CN111363036B (en) | Recombinant antibody of anti-heart fatty acid binding protein | |
| CN111349172B (en) | Recombinant antibody of anti-human creatine kinase isoenzyme CK-MB | |
| CN111349160B (en) | Recombinant antibody of anti-human gastrin releasing peptide precursor | |
| CN111018977B (en) | Recombinant antibody of anti-human cardiac troponin I | |
| WO2020073833A1 (en) | Antibody against human cardiac troponin i and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |