CN111018973B

CN111018973B - Recombinant antibody of anti-human cardiac troponin I

Info

Publication number: CN111018973B
Application number: CN201811179508.7A
Authority: CN
Inventors: 崔鹏; 何志强; 孟媛; 钟冬梅; 游辉; 范凌云
Original assignee: Dongguan Pengzhi Biotechnology Co Ltd
Current assignee: Dongguan Pengzhi Biotechnology Co Ltd
Priority date: 2018-10-10
Filing date: 2018-10-10
Publication date: 2022-04-01
Anticipated expiration: 2038-10-10
Also published as: CN111018973A

Abstract

The invention discloses a recombinant antibody of anti-human cardiac troponin I, relates to a novel separated binding protein containing a cTnI antigen binding structural domain, and researches on the aspects of preparation, application and the like of the binding protein. The binding protein has strong activity and high affinity with human cTnI protein, and can be widely applied to the field of detection of the cTnI protein.

Description

Recombinant antibody of anti-human cardiac troponin I

Technical Field

The invention relates to the technical field of immunity, in particular to a recombinant antibody of an anti-human cardiac troponin I.

Background

Before the 80's of the 20 th century, the World Health Organization (WHO) has used the activity of the myocardial zymogram as one of the diagnostic criteria for Acute Myocardial Infarction (AMI). At the end of the 80's 20 th century, researchers found that troponin (Tn) had higher sensitivity and specificity than biomarkers such as phosphocreatine kinase (CK), phosphocreatine kinase isoenzyme (CK-MB), lactate dehydrogenase, and aspartate aminotransferase. The cardiac troponin I (cTnI) is only present in cardiac muscle, is a marker of cardiac muscle cells, can affect the contraction and relaxation functions of the heart by abnormal change, can be used for diagnosing myocardial necrosis, judging cardiac muscle injury and the like, becomes one of the markers with the strongest damage sensitivity and specificity of the cardiac muscle cells, and is a main biochemical marker which is generally accepted to rapidly diagnose AMI and Acute Coronary Syndrome (ACS) and assist ACS risk stratification and reflect the prognosis of the ACS.

The cTnI content in normal human blood is generally lower than 0.3 mu g/L. When the integrity of the cell membrane of the cardiomyocytes is damaged by ischemia or hypoxia, the free cTnI can rapidly penetrate the cell membrane and enter the blood stream. Therefore, the rapid, sensitive and accurate determination of cTnI and its change trend in human blood at the early stage of onset has important clinical significance for the diagnosis of acute myocardial infarction, risk stratification of acute coronary syndrome, monitoring of myocardial damage caused by various factors, and the like. The clinical methods for detecting the cTnI level include enzyme-linked immunosorbent assay (ELISA), chemiluminescence, colloidal gold and the like, and different methods have respective advantages and disadvantages, but all require specific monoclonal antibodies aiming at the cTnI.

The existing cTnI antibody has low activity and poor affinity, and cannot be well applied to the detection of cTnI protein, so that the field has strong demand for an antibody which can effectively and specifically bind and detect cTnI.

Disclosure of Invention

The present invention relates to a novel isolated binding protein comprising a cTnI antigen binding domain and studies on the preparation, use, etc. of the binding protein.

The antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences set forth below; or; has at least 80% sequence identity with the complementarity determining regions of the amino acid sequence described below and has K with cardiac troponin I_D≤1.23×10^-8Affinity of mol/L;

CDR-VH1 is G-X1-N-I-X2-D-Y-X3-M-H, wherein,

x1 is F or Y, X2 is R or K, X3 is Y or F;

CDR-VH2 is R-X1-D-P-E-X2-G-E-T-K-Y-X3-P-E-F-Q, wherein,

x1 is I or L, X2 is D or E, X3 is P or A;

CDR-VH3 is A-R-Y-Y-X1-S-Y-X2-P-X3-V-Y-W, wherein,

x1 is T or S, X2 is I, L or V, X3 is F or W;

the CDR-VL1 is R-S-X1-Q-S-L-X2-Y-S-X3-H-T-X4-L,

x1 is S or T, X2 is L or I, X3 is N or Q, X4 is Y or F;

the complementarity determining region CDR-VL2 is K-X1-S-N-X2-F-S, wherein,

x1 is I, V or L, X2 is K or R;

the complementarity determining region CDR-VL3 is S-X1-S-T-H-X2-P-X3-T-F, wherein,

x1 is Q or N, X2 is I or L, and X3 is Y, F or W.

An important advantage is that the binding protein is highly active and has a high affinity for the human cTnI protein.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is an electrophoretogram of a monoclonal antibody against a recombinant antibody against human cardiac troponin I of the present invention.

Detailed Description

The present invention may be understood more readily by reference to the following description of certain embodiments of the invention and the detailed description of the examples included therein.

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such embodiments are necessarily varied. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Noun definitions

"isolated binding protein comprising an antigen binding domain" broadly refers to all proteins/protein fragments that comprise a CDR region. The term "antibody" includes polyclonal and monoclonal antibodies and antigenic compound-binding fragments of these antibodies, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies and minimal recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".

The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region (VL or VH) is composed of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The extent of the framework regions and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest), E.Kabat et al, U.S. department of Health and Human Services (U.S.. department of Health and Human Services), (1983), and Chothia. The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.

As used herein, the "framework" or "FR" regions mean the regions of the antibody variable domain excluding those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3 and FR 4).

Typically, the variable domains VL/VH of the heavy and light chains are obtained by linking the CDRs and FRs numbered as follows in a combinatorial arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR 4.

As used herein, the term "purified" or "isolated" in relation to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its native medium or native form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally bound to or normally mixed with it or in solution. Isolated polypeptides include the naturally-produced polypeptide contained in a cell lysate, the polypeptide in purified or partially purified form, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous host cell or culture. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

Exemplary embodiments of the invention

The present invention relates to an isolated binding protein comprising an antigen binding domain, wherein the antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences set forth in seq id nos; or; has at least 80% sequence identity with the complementarity determining regions of the amino acid sequence described below and has K with cardiac troponin I_D≤1.23×10^-8Affinity of mol/L;

CDR-VH1 is G-X1-N-I-X2-D-Y-X3-M-H, wherein,

x1 is F or Y, X2 is R or K, X3 is Y or F;

CDR-VH2 is R-X1-D-P-E-X2-G-E-T-K-Y-X3-P-E-F-Q, wherein,

x1 is I or L, X2 is D or E, X3 is P or A;

CDR-VH3 is A-R-Y-Y-X1-S-Y-X2-P-X3-V-Y-W, wherein,

x1 is T or S, X2 is I, L or V, X3 is F or W;

the CDR-VL1 is R-S-X1-Q-S-L-X2-Y-S-X3-H-T-X4-L,

x1 is S or T, X2 is L or I, X3 is N or Q, X4 is Y or F;

the complementarity determining region CDR-VL2 is K-X1-S-N-X2-F-S, wherein,

x1 is I, V or L, X2 is K or R;

x1 is Q or N, X2 is I or L, and X3 is Y, F or W.

In some embodiments, the antigen binding domain has at least 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to a complementarity determining region of an amino acid sequence having K with cardiac troponin I_D≤1.23×10^-8mol/L，K_DThe value can also be selected to be 1 × 10^-9mol/L、2×10^-9mol/L、3×10^-9mol/L、4×10^-9mol/L、4.5×10^-9mol/L、5×10^-9mol/L、6×10^-9mol/L、7×10^-9mol/L、8×10^-9mol/L、9×10^-9mol/L、1×10^-10mol/L、3×10^-10mol/L、5×10^-10mol/L、7×10^-10mol/L、9×10^-10mol/L or 1X 10^-8mol/L；

Or 8.62X 10^-10mol/L≤K_D≤1.23×10^-8mol/L；

Wherein the affinity is determined according to the method of the present specification.

In some embodiments:

in the complementarity determining region CDR-VH1, X2 is K;

in the complementarity determining region CDR-VH2, X2 is D;

in the complementarity determining region CDR-VH3, X1 is S;

in the complementarity determining region CDR-VL1, X1 is S;

in the complementarity determining region CDR-VL2, X2 is R;

in the complementarity determining region CDR-VL3, X1 is Q.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is F.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is Y.

In some embodiments, in the complementarity determining region CDR-VH1, X3 is Y.

In some embodiments, in the complementarity determining region CDR-VH1, X3 is F.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is I.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is L.

In some embodiments, in the complementarity determining region CDR-VH2, X3 is P.

In some embodiments, in the complementarity determining region CDR-VH2, X3 is a.

In some embodiments, in the complementarity determining region CDR-VH2, X4 is R.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is I.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is L.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is V.

In some embodiments, in the complementarity determining region CDR-VH3, X3 is F.

In some embodiments, in the complementarity determining region CDR-VH3, X3 is W.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is L.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is I.

In some embodiments, in the complementarity determining region CDR-VL1, X3 is N.

In some embodiments, in the complementarity determining region CDR-VL1, X3 is Q.

In some embodiments, in the complementarity determining region CDR-VL1, X4 is Y.

In some embodiments, in the complementarity determining region CDR-VL1, X4 is F.

In some embodiments, in the complementarity determining region CDR-VL2, X1 is I.

In some embodiments, in the complementarity determining region CDR-VL2, X1 is V.

In some embodiments, in the complementarity determining region CDR-VL2, X1 is L.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is I.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is L.

In some embodiments, in the complementarity determining region CDR-VL3, X3 is Y.

In some embodiments, in the complementarity determining region CDR-VL3, X3 is F.

In some embodiments, in the complementarity determining region CDR-VL3, X3 is W.

In some embodiments, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:

in some embodiments, the binding protein includes at least 3 CDRs (e.g., 3 light chain CDRs or 3 heavy chain CDRs); alternatively, the binding protein comprises at least 6 CDRs.

In some embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.

In some embodiments, the binding protein is a "functional fragment" of an antibody, e.g., a nanobody, F (ab')₂Fab', Fab, Fv, scFv, diabody and antibody minimal recognition unit.

scFv (sc ═ single chain), bispecific antibodies (diabodies).

The "functional fragment" as defined in the present invention particularly refers to an antibody fragment having the same specificity for cTnI as the parent antibody. In addition to the above functional fragments, any fragment having an increased half-life is also included.

These functional fragments typically have the same binding specificity as the antibody from which they are derived. As the person skilled in the art deduces from the description of the invention, the antibody fragment of the invention may be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction cleavage of disulfide bonds.

Antibody fragments can also be obtained by peptide synthesis by recombinant genetic techniques also known to those skilled in the art or by, for example, automated peptide synthesizers, such as those sold by Applied BioSystems and the like.

In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence shown in SEQ ID NOS: 1-4, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence shown in SEQ ID NOS: 5-8.

In addition to the amino acid sequences disclosed herein above, the framework regions may be derived from human species to constitute humanized antibodies.

In some embodiments, the binding protein further comprises an antibody constant region sequence.

In some embodiments, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.

In some embodiments, the constant region is derived from a mouse;

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

According to one aspect of the invention, the invention also relates to an isolated nucleic acid molecule, which is DNA or RNA, encoding a binding protein as described above.

According to one aspect of the invention, the invention also relates to a vector comprising a nucleic acid molecule as described above.

The invention further comprises at least one nuclear construct, e.g. a plasmid, further an expression plasmid, encoding a nucleic acid molecule as described above, the construction of which vector will be described in one embodiment of the present application.

According to one aspect of the invention, the invention also relates to a host cell transformed with a vector as described above.

The host cell may be a eukaryotic cell, such as a mammalian cell.

In some embodiments, the host cell is a CHO cell.

According to one aspect of the invention, the invention also relates to a method for producing a binding protein as described above, said method comprising the steps of:

the host cells as described above are cultured in a medium and under suitable culture conditions, and the binding protein so produced is recovered from the medium or from the cultured host cells.

According to one aspect of the invention, the invention also relates to the use of a binding protein as described above for the preparation of a diagnostic agent or kit for the diagnosis of acute myocardial infarction, acute coronary syndrome, pulmonary infarction, unstable angina pectoris, myocardial injury.

According to one aspect of the invention, the invention also relates to a method for detecting troponin I antigen in a test sample, comprising:

a) contacting a troponin I antigen in the test sample with a binding protein as defined above to form an immune complex under conditions sufficient for an antibody/antigen binding reaction to occur; and

b) detecting the presence of said immune complex, the presence of said complex being indicative of the presence of said troponin I antigen in said test sample;

in this embodiment, the binding protein may be labeled with an indicator that indicates the strength of the signal, so that the complex is readily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

in this embodiment, the binding protein forms a partner antibody with the second antibody in the form of a first antibody for binding to a different epitope of cTnI;

the second antibody may be labeled with an indicator showing the intensity of the signal so that the complex is easily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, which second antibody binds to the troponin I antigen;

in this embodiment, the binding protein serves as an antigen for the second antibody, which may be labeled with an indicator of signal intensity to allow the complex to be readily detected.

In some embodiments, the indicator that shows signal intensity comprises any one of a fluorescent substance, a quantum dot, a digoxigenin-labeled probe, biotin, a radioisotope, a radiocontrast agent, a paramagnetic ion fluorescent microsphere, an electron-dense substance, a chemiluminescent label, an ultrasound contrast agent, a photosensitizer, colloidal gold, or an enzyme.

In some embodiments, the fluorescent species include Alexa 350, Alexa 405, Alexa 430, Alexa488, Alexa 555, Alexa 647, AMCA, aminoacridine, BODIPY 630/650, BODIPY650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4 ', 5' -dichloro-2 ', 7' -dimethoxyfluorescein, 5-carboxy-2 ', 4', 5', 7' -tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, dansyl chloride, fluorescein, HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-1, 3-diazole), Any one of Oregon Green 488, Oregon Green 500, Oregon Green514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresol fast violet, cresol Blue violet, brilliant cresol Blue, p-aminobenzoic acid, erythrosine, phthalocyanine, azomethine, cyanine, xanthine, succinyl fluorescein, rare earth metal cryptate, europium tripyridyldiamine, europium cryptate or chelate, diamine, bispyanine, La Jolla Blue dye, allophycocyanin, allocyanonin B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin R, REG, rhodamine Green, rhodamine isothiocyanate, rhodamine red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine, and Texas red.

In some embodiments, the radioisotope comprises¹¹⁰In、¹¹¹In、¹⁷⁷Lu、¹⁸F、⁵²Fe、⁶²Cu、⁶⁴Cu、⁶⁷Cu、⁶⁷Ga、⁶⁸Ga、⁸⁶Y、⁹⁰Y、⁸⁹Zr、⁹⁴mTc、⁹⁴Tc、⁹⁹mTc、¹²⁰I、¹²³I、¹²⁴I、¹²⁵I、¹³¹I、^154-158Gd、³²P、¹¹C、¹³N、¹⁵O、¹⁸⁶Re、¹⁸⁸Re、⁵¹Mn、⁵²mMn、⁵⁵Co、⁷²As、⁷⁵Br、⁷⁶Br、⁸²mRb and⁸³sr.

In some embodiments, the enzyme comprises any one of horseradish peroxidase, alkaline phosphatase, and glucose oxidase.

In some embodiments, the fluorescent microspheres are: the polystyrene fluorescent microsphere is internally wrapped with rare earth fluorescent ion europium.

According to one aspect of the invention, the invention also relates to a kit comprising a binding protein as described above.

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

This example provides an exemplary method for the preparation of recombinant antibodies against human cardiac troponin I.

S10, constructing an expression plasmid:

restriction enzyme, Prime Star DNA polymerase in this example was purchased from Takara;

the MagExtractor-RNA extraction kit was purchased from TOYOBO;

BD SMART^TMRACE cDNA Amplification Kit was purchased from Takara;

pMD-18T vector was purchased from Takara;

the plasmid extraction kit is purchased from Tiangen corporation;

primer synthesis and gene sequencing were done by Invitrogen;

the Anti-cTnI 5G8 monoclonal antibody is secreted as an existing hybridoma cell strain, and is recovered for later use.

S11, design and synthesis of primers:

5' RACE upstream primers for heavy and light chain amplification:

SMARTER II A Oligonucleotide：

5’>AAGCAGTGGTATCAACGCAGAGTACXXXXX<3’；

5'-RACE CDS Primer(5'-CDS)：5’>(T)₂₅VN<3’(N＝A,C,G,orT；V＝A,G,orC)；

Universal Primer A Mix(UPM):

5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’；

Nested Universal Primer A(NUP):

5’>AAGCAGTGGTATCAACGCAGAGT<3’；

mIg-kR：5’>CTAACACTCATTCCTGTTGAAGCTCTTGACAAT<3’；

mIg-HR：5’>TCATTTACCAGGAGAGTGGGAGAGGC<3’。

s12, antibody variable region gene cloning and sequencing:

extracting RNA from hybridoma cell line secreting Anti-cTnI 8B6 monoclonal antibody, and extracting with SMARTER^TMThe RACE cDNA Amplification Kit and SMARTER II A Oligonucleotide and 5' -CDS primer in the Kit are used for first strand cDNA synthesis, and the obtained first strand cDNA product is used as PCR Amplification template. The Light Chain gene was amplified with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIg-kR primers, and the Heavy Chain gene was amplified with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIg-HR primers. The primer pair of Light Chain can amplify a target band about 0.7KB, and the primer pair of Heavy Chain can amplify a target band about 1.4 KB. The product was purified and recovered by agarose gel electrophoresis, and the product was subjected to A addition reaction with rTaq DNA polymerase, inserted into pMD-18T vector, transformed into DH 5. alpha. competent cells, and after colonies were grown, 4 clones of the Heavy Chain and Light Chain gene clones were each cloned and sent to Invitrogen corporation for sequencing.

Sequence analysis of the S13, Anti-cTnI 8B6 antibody variable region genes:

putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene fragment amplified by the Light Chain, the VL gene sequence is 321bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the Heavy Chain primer pair, the VH gene sequence is 357bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.

S14, construction of recombinant antibody expression plasmid:

pcDNA^TM3.4

vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, BamHI, EcoRI and the like are introduced into the expression vector and named as pcDNA3.4A expression vector, and the vector is called as 3.4A expression vector for short in the following; according to the sequencing result of the antibody variable region gene in the pMD-18T, VL and VH gene specific primers of the Anti-cTnI 8B6 antibody are designed, wherein two ends of the primers are respectively provided with HindIII and EcoRI enzyme cutting sites and protective bases, and the primers are as follows:

cTnI-8B6-HF：5’>CCCAAGCTTATGGAATGCAGCTGTGTCATGCTCTTCTTC<3’；

cTnI-8B6-HR:5’>CCCGAATTCTCATTTACCAGGAGAGTGGGAGAGGC<3’；

cTnI-8B6-LF:5’>CCCAAGCTTATGAAGTTGCCTGTTAGGCTGTTGG<3’；

cTnI-8B6-LR:5’>CCCGAATTCCTAACACTCATTCCTGTTGAAGCTCTTGACAA<3’；

a0.72 KB Light Chain gene fragment and a 1.4KB Heavy Chain gene fragment were amplified by PCR amplification. The gene fragments of the Heavy Chain and the Light Chain are subjected to double enzyme digestion by HindIII/EcoRI respectively, the 3.4A vector is subjected to double enzyme digestion by HindIII/EcoRI, the Heavy Chain gene and the Light Chain gene are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the Heavy Chain and the Light Chain are respectively obtained.

Example 2

Recombinant antibody expression plasmid transient transfection CHO cell and expression supernatant antibody activity identification

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10⁷cells/ml in centrifuge tube, 100ul plasmid and 700ul cell mixture, transferring to electric rotor, transferring to 10ml containing CD CHO AGT culture medium, culturing in 37 degree shaker (8% CO)₂Amplitude 150); the cell viability was measured by sampling every day, and when the cell viability was less than 50%, the cell culture supernatant was centrifuged to obtain an antibody (having a light chain having a sequence shown in SEQ ID NO:11 and a heavy chain having a sequence shown in SEQ ID NO: 12).

Upon analysis, the complementarity determining region (WT) of the heavy chain:

CDR-VH1 is G-F (X1) -N-I-R (X2) -D-Y-Y (X3) -M-H;

CDR-VH2 is R-I (X1) -D-P-E-E (X2) -G-E-T-K-Y-P (X3) -P-E-F-Q;

CDR-VH3 is A-R-Y-Y-T (X1) -S-Y-I (X2) -P-F (X3) -V-Y-W;

complementarity determining regions of the light chain:

CDR-VL1 is R-S-T (X1) -Q-S-L-L (X2) -Y-S-N (X3) -H-T-Y (X4) -L;

CDR-VL2 is K-I (X1) -S-N-K (X2) -F-S;

CDR-VL3 is S-N (X1) -S-T-H-I (X2) -P-Y (X3) -T-F;

wherein, X1, X2, X3 and X4 are all the sites to be mutated.

TABLE 1 mutant sites associated with antibody Activity

The inventors performed the above-described mutation of the CDR sites in WT to obtain a more active antibody.

Diluting the cTnI quality control product recombinant antigen to 1ug/ml by the coating solution, and coating the cTnI quality control product recombinant antigen in a micropore plate at 100uL per pore at 4 ℃ overnight; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), beating to dry at 37 deg.C for 1h and 120uL per well; adding diluted cTnI monoclonal antibody, 100 uL/hole, 37 deg.c for 30 min; washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100uL per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 uL/hole), adding a developing solution B (50 uL/hole), and carrying out 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 uL/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader.

TABLE 2 antibody Activity assay data

Sample concentration ng/ml	WT	Mutation 1	Mutation 2	Mutation 3	Mutation 4	Mutation 5
							1000	2.028	2.488	2.212	2.254	2.142	2.107
200	1.906	2.470	2.301	2.276	2.102	1.984
							40	1.854	2.363	2.259	2.204	2.139	1.969
8	1.474	1.757	1.517	1.623	1.498	1.504
							1.6	0.227	0.516	0.410	0.353	0.327	0.341
0.32	0.086	0.16	0.128	0.115	0.101	0.131
							0	0.062	0.073	0.073	0.063	0.081	0.07

As can be seen from the above table, the activity effect of mutation 1 is the best, so that mutation sites with better potency are screened by using mutation 1 as a framework sequence (ensuring that the activity of the antibody obtained by screening is similar to that of mutation 1, and the antibody activity is +/-10%), and partial results are as follows.

TABLE 3 mutation sites related to antibody affinity

Affinity assay

Using AMC sensors, purified antibodies were diluted to 10ug/ml with PBST, and the cTnI quality control recombinant protein (PK2-cTnI-1,170120, from Co.) was diluted with PBST in a gradient: 769.2nmol/ml, 384.6nmol/ml, 192.3nmol/ml, 96.2nmol/ml, 48.1nmol/ml, 24nmol/ml, 12nmol/ml, 0 nmol/ml;

the operation flow is as follows: equilibrating in buffer 1(PBST) for 60s, immobilizing antibody in antibody solution for 300s, incubating in buffer 2(PBST) for 180s, binding in antigen solution for 420s, dissociating in buffer 2 for 1200s, regenerating the sensor with 10mM GLY solution pH 1.69 and buffer 3, and outputting the data. (KD represents the equilibrium dissociation constant, i.e.affinity; kon represents the association rate; kdis represents the dissociation rate.)

Table 4 affinity assay data

As can be seen from table 4, the mutation sites listed in table 3 have little effect on the affinity of the antibody.

To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.

TABLE 5 mutations with WT as backbone

Table 6 affinity assay data

From the analyses in tables 5 and 6, the association between the mutation site and other sites was not significant on the premise that the antibody activity was ensured.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Dongguan City of Pengzhi Biotech Co., Ltd

<120> recombinant antibody against human cardiac troponin I

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 23

<212> PRT

<213> Mus musculus

<400> 1

Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Ser Leu Gly

1 5 10 15

Asp Gln Ala Ser Ile Ser Cys

20

<210> 2

<211> 16

<212> PRT

<213> Mus musculus

<400> 2

His Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Phe

1 5 10 15

<210> 3

<211> 32

<212> PRT

<213> Mus musculus

<400> 3

Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

1 5 10 15

Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys

20 25 30

<210> 4

<211> 9

<212> PRT

<213> Mus musculus

<400> 4

Gly Ser Gly Thr Lys Leu Glu Ile Lys

1 5

<210> 5

<211> 25

<212> PRT

<213> Mus musculus

<400> 5

Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Thr Ala Ser

20 25

<210> 6

<211> 14

<212> PRT

<213> Mus musculus

<400> 6

Trp Met Lys Gln Arg Thr Glu Gln Gly Leu Asp Trp Ile Gly

1 5 10

<210> 7

<211> 31

<212> PRT

<213> Mus musculus

<400> 7

Gly Lys Ala Thr Ile Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr Leu

1 5 10 15

Gln Leu Ser Thr Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

20 25 30

<210> 8

<211> 10

<212> PRT

<213> Mus musculus

<400> 8

Gly Gln Gly Thr Leu Val Thr Ala Ser Ala

1 5 10

<210> 9

<211> 107

<212> PRT

<213> Mus musculus

<400> 9

Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu

1 5 10 15

Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

20 25 30

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg

35 40 45

Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser

50 55 60

Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu

65 70 75 80

Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser

85 90 95

Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210> 10

<211> 323

<212> PRT

<213> Mus musculus

<400> 10

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala Gln Thr Lys Pro Arg Glu Glu Gln Ile Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro

195 200 205

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln

210 215 220

Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val

225 230 235 240

Ser Leu Thr Cys Met Ile Thr Asn Phe Phe Pro Glu Asp Ile Thr Val

245 250 255

Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln

260 265 270

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn

275 280 285

Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val

290 295 300

Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His

305 310 315 320

Ser Pro Gly

<210> 11

<211> 219

<212> PRT

<213> Artificial sequence

<400> 11

Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Ser Leu Gly

1 5 10 15

Asp Gln Ala Ser Ile Ser Cys Arg Ser Thr Gln Ser Leu Leu Tyr Ser

20 25 30

Gln Arg His Thr Phe Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Lys Leu Leu Ile Phe Lys Ile Ser Asn Lys Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Asn Ser

85 90 95

Thr His Leu Pro Tyr Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

100 105 110

Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu

115 120 125

Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

130 135 140

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg

145 150 155 160

Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser

165 170 175

Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu

180 185 190

Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser

195 200 205

Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

210 215

<210> 12

<211> 442

<212> PRT

<213> Artificial sequence

<400> 12

Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile Arg Asp Tyr

20 25 30

Tyr Met His Trp Met Lys Gln Arg Thr Glu Gln Gly Leu Asp Trp Ile

35 40 45

Gly Arg Ile Asp Pro Glu Glu Gly Glu Thr Lys Tyr Pro Pro Glu Phe

50 55 60

Gln Gly Lys Ala Thr Ile Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr

65 70 75 80

Leu Gln Leu Ser Thr Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Thr Ser Tyr Ile Pro Phe Val Tyr Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Ala Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr

115 120 125

Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu

130 135 140

Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp

145 150 155 160

Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser

180 185 190

Thr Trp Pro Ser Gln Thr Val Thr Cys Asn Val Ala His Pro Ala Ser

195 200 205

Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys

210 215 220

Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro

225 230 235 240

Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr

245 250 255

Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser

260 265 270

Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Lys Pro Arg

275 280 285

Glu Glu Gln Ile Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile

290 295 300

Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn

305 310 315 320

Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys

325 330 335

Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu

340 345 350

Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asn Phe

355 360 365

Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala

370 375 380

Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr

385 390 395 400

Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly

405 410 415

Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His

420 425 430

Thr Glu Lys Ser Leu Ser His Ser Pro Gly

435 440

Claims

1. An isolated binding protein comprising an antigen binding domain, wherein said antigen is cardiac troponin I, and wherein said antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL 3; and has K with cardiac troponin I_D≤1.23×10^-8Affinity of mol/L;

CDR-VH1 is G-X1-N-I-X2-D-Y-X3-M-H, wherein,

x1 is F or Y, X2 is R or K, X3 is Y or F;

CDR-VH2 is R-X1-D-P-E-X2-G-E-T-K-Y-X3-P-E-F-Q, wherein,

x1 is I or L, X2 is D or E, X3 is P or A;

CDR-VH3 is A-R-Y-Y-X1-S-Y-X2-P-X3-V-Y-W, wherein,

x1 is T or S, X2 is I, L or V, X3 is F or W;

the CDR-VL1 is R-S-X1-Q-S-L-X2-Y-S-X3-H-T-X4-L,

x1 is S or T, X2 is L or I, X3 is N or Q, X4 is Y or F;

the complementarity determining region CDR-VL2 is K-X1-S-N-X2-F-S, wherein,

x1 is I, V or L, X2 is K or R;

x1 is Q or N, X2 is I or L, and X3 is Y, F or W.

2. The binding protein according to claim 1, wherein in the complementarity determining region CDR-VH1, X2 is K;

in the complementarity determining region CDR-VH2, X2 is D;

in the complementarity determining region CDR-VH3, X1 is S;

in the complementarity determining region CDR-VL1, X1 is S;

in the complementarity determining region CDR-VL2, X2 is R;

in the complementarity determining region CDR-VL3, X1 is Q.

3. The binding protein according to claim 1, wherein in the complementarity determining region CDR-VH1, X2 is R;

in the complementarity determining region CDR-VH2, X2 is E;

in the complementarity determining region CDR-VH3, X1 is T;

in the complementarity determining region CDR-VL1, X1 is T;

in the complementarity determining region CDR-VL2, X2 is K;

in the complementarity determining region CDR-VL3, X1 is N.

4. An isolated binding protein comprising an antigen binding domain, wherein said antigen is cardiac troponin I, and wherein said antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL 3;

CDR-VH1 is G-X1-N-I-X2-D-Y-X3-M-H, wherein X2 is K;

CDR-VH2 is R-X1-D-P-E-X2-G-E-T-K-Y-X3-P-E-F-Q, wherein X2 is D;

CDR-VH3 is A-R-Y-Y-X1-S-Y-X2-P-X3-V-Y-W, wherein X1 is S;

CDR-VL1 is R-S-X1-Q-S-L-X2-Y-S-X3-H-T-X4-L, wherein X1 is S;

CDR-VL2 is K-X1-S-N-X2-F-S, wherein X2 is R;

CDR-VL3 is S-X1-S-T-H-X2-P-X3-T-F, wherein X1 is Q;

the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:

site of the body CDR-VH1X1/X3 CDR-VH2X1/X3 CDR-VH3X2/X3 CDR-VL1X2/X3/X4 CDR-VL2X1 CDR-VL3X2/X3 Mutant combination 1 F/Y I/P I/F L/N/Y I I/Y Combination of mutations 2 F/F L/P L/F I/N/F V I/F Combination of mutations 3 Y/Y I/A V/F I/Q/Y L I/W Combination of mutations 4 Y/F L/A I/W I/Q/F I L/Y Combination of mutations 5 F/Y L/A L/W L/N/Y V L/F Combination of mutations 6 F/F I/A V/W L/N/F L I/W Mutant combination 7 Y/Y L/P I/F L/Q/Y I I/F Combination of mutations 8 Y/F I/P I/W L/Q/F V L/Y Combination of mutations 9 F/Y L/P L/F L/N/Y L L/W Combination of mutations 10 F/F L/A L/W I/N/F I L/Y Combination of mutations 11 Y/Y I/A V/F L/Q/Y V I/W Mutant combination 12 Y/F I/P V/W I/Q/F L I/F Mutant combinations 13 F/Y I/A I/W L/N/Y I I/F Combination of mutations 14 F/F L/A I/F I/N/F V L/W Combination of mutations 15 Y/Y I/P V/W L/Q/Y L L/Y Mutant combinations 16 Y/F L/P V/F I/Q/F I L/W Mutant combinations 17 F/Y I/P L/W L/N/Y V I/Y Mutant combinations 18 F/F L/P L/F I/N/F L I/F Combination of mutations 19 Y/Y I/A I/F L/Q/Y I I/W Combination of mutations 20 Y/F L/A L/F L/Q/F V L/F Mutant combination 21 F/Y L/A V/F I/N/Y L L/Y Mutant combination 22 F/F I/A I/W I/N/F I L/W Mutant combination 23 Y/Y L/P L/W I/Q/Y V I/F Mutant combinations 24 Y/F I/P V/W I/Q/F L I/Y Mutant combinations 25 F/Y L/P I/F I/N/Y I I/Y Mutant combinations 26 F/F L/A I/W I/N/F V L/F Mutant combinations 27 Y/Y I/A L/F I/Q/Y L L/W Mutant combinations 28 Y/F I/P L/W I/Q/F I L/Y Mutant combinations 29 F/Y I/A V/F I/N/Y V I/F Combination of mutations 30 F/F L/A V/W L/N/F L I/W Combination of mutations 31 Y/Y I/P I/W L/Q/Y I I/F Mutant combinations 32 Y/F L/P I/F L/Q/F V L/Y Mutant combinations 33 F/Y I/P V/W L/Q/Y L L/W Mutant combinations 34 F/F L/P V/F L/N/F I I/Y Combination of mutations 35 Y/Y I/A L/W I/N/Y V I/W Combination of mutations 36 F/Y L/A I/F I/N/F L L/F Mutant combinations 37 F/F I/A L/F L/Q/Y I L/W Combination of mutations 38 Y/Y L/P V/F I/Q/F V I/Y Mutant combinations 39 Y/F I/P I/W L/Q/Y L I/W Combination of mutations 40 F/Y L/P L/W I/N/F I L/Y Mutant combination 41 F/F L/A V/W L/N/Y V L/F Combination of mutations 42 Y/Y I/A I/F L/Q/F L I/W Mutant combinations 43 Y/F I/P I/W L/Q/Y I L/F Mutant combinations 44 F/Y I/A L/F L/N/F V L/Y Combination of mutations 45 F/F L/A L/W L/N/Y L I/W Mutant combinations 46 Y/Y I/P V/F I/Q/F I I/F Mutant combinations 47 Y/F L/P V/W I/Q/Y V L/Y Mutant combinations 48 F/Y I/P I/W I/N/F L L/Y Mutant combinations 49 F/F L/P I/F I/N/Y I I/F Mutant combinations 50 Y/Y I/A V/W I/N/F V I/W Mutant combinations 51 Y/F L/A V/F I/Q/Y L L/Y Mutant combinations 52 F/Y L/A L/W I/Q/F I L/F Mutant combination 53 F/F I/A L/F I/Q/Y V I/W Mutant combinations 54 Y/Y L/P I/F L/N/F L I/F Mutant combinations 55 Y/F I/P L/F L/N/Y I L/Y Mutant combinations 56 F/Y L/P V/F L/Q/F V L/W Mutant combinations 57 F/F L/A I/W L/Q/Y L I/Y Mutant combinations 58 Y/Y I/A L/W I/N/F I I/W

。

5. An isolated binding protein comprising an antigen binding domain, wherein said antigen is cardiac troponin I, and wherein said antigen binding domain comprises complementarity determining region CDR-VH1, complementarity determining region CDR-VH2, complementarity determining region CDR-VH3, complementarity determining region CDR-VL1, complementarity determining region CDR-VL2, and complementarity determining region CDR-VL 3;

CDR-VH1 is G-X1-N-I-X2-D-Y-X3-M-H, wherein X2 is R;

CDR-VH2 is R-X1-D-P-E-X2-G-E-T-K-Y-X3-P-E-F-Q, wherein X2 is E;

CDR-VH3 is A-R-Y-Y-X1-S-Y-X2-P-X3-V-Y-W, wherein X1 is T;

CDR-VL1 is R-S-X1-Q-S-L-X2-Y-S-X3-H-T-X4-L, wherein X1 is T;

CDR-VL2 is K-X1-S-N-X2-F-S, wherein X2 is K;

CDR-VL3 is S-X1-S-T-H-X2-P-X3-T-F, wherein X1 is N;

site of the body CDR-VH1X1/X3 CDR-VH2X1/X3 CDR-VH3X2/X3 CDR-VL1X2/X3/X4 CDR-VL2X1 CDR-VL3X2/X3 WT F/Y I/P I/F L/N/Y I I/Y WT 1-10 Y/Y I/A V/F I/N/F I I/W WT 1-15 Y/F L/P V/F L/Q/F V L/W WT 1-25 F/F L/A I/W L/N/Y V I/F WT 1-43 F/Y I/A L/F I/N/F I L/Y

。

6. The composition of any one of claims 1-5 comprising an antigen binding structureAn isolated binding protein of domain, wherein said binding protein is F (ab')₂Fab', Fab, Fv, scFv and diabody.

7. The isolated binding protein comprising an antigen binding domain according to any of claims 1 to 5, wherein the binding protein comprises the light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4, in that order, as set forth in SEQ ID Nos. 1 to 4, and/or the heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4, in that order, as set forth in SEQ ID Nos. 5 to 8.

8. The isolated binding protein comprising an antigen binding domain according to any one of claims 1 to 5, wherein the binding protein further comprises an antibody constant region sequence.

9. The binding protein according to claim 8, wherein said constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

10. The binding protein of claim 9, wherein the species of said constant region is derived from a cow, horse, pig, sheep, goat, rat, mouse, dog, cat, rabbit, donkey, deer, mink, chicken, duck, goose, or human.

11. The binding protein of claim 10, wherein said species source of the constant region is a bovine.

12. The binding protein of claim 10, wherein said species of constant region is derived from turkey or turkey.

13. The binding protein of claim 10, wherein said constant region is of murine origin.

14. The binding protein according to claim 13, wherein the light chain constant region sequence is set forth in SEQ ID NO 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

15. An isolated nucleic acid molecule which is DNA or RNA encoding the binding protein of any one of claims 1 to 14.

16. A vector comprising the nucleic acid molecule of claim 15.

17. A host cell transformed with the vector of claim 16.

18. A method of producing a binding protein according to any one of claims 1 to 14, comprising the steps of:

culturing the host cell of claim 17 in a culture medium and under suitable culture conditions, and recovering the binding protein so produced from the culture medium or from the cultured host cell.

19. Use of a binding protein according to any one of claims 1 to 14 for the preparation of a diagnostic agent or kit for the diagnosis of acute myocardial infarction, acute coronary syndrome, pulmonary infarction, unstable angina pectoris, myocardial injury.

20. Use of a binding protein according to any one of claims 1 to 14 for the preparation of a kit for detecting cardiac troponin I in a test sample.

21. The use according to claim 20, wherein the kit is for:

a) contacting a troponin I antigen in the test sample with a binding protein according to claims 1-14 under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex; and

b) detecting the presence of said immune complex, the presence of said complex being indicative of the presence of said troponin I antigen in said test sample.

22. The use according to claim 21,

in step a), a second antibody is further included in the immune complex, which second antibody binds to the binding protein.

23. The use according to claim 21,

in step a), a second antibody is further included in the immune complex, said second antibody binding to the troponin I antigen.

24. A kit for detecting cardiac troponin I comprising a binding protein according to any one of claims 1 to 14.