CN110818796A

CN110818796A - Recombinant antibody of anti-human CA153 protein

Info

Publication number: CN110818796A
Application number: CN201810903076.3A
Authority: CN
Inventors: 崔鹏; 何志强; 孟媛; 游辉
Original assignee: Dongguan Pengzhi Biotechnology Co Ltd
Current assignee: Dongguan Pengzhi Biotechnology Co Ltd
Priority date: 2018-08-09
Filing date: 2018-08-09
Publication date: 2020-02-21
Anticipated expiration: 2038-08-09
Also published as: CN110818796B

Abstract

The invention relates to a novel isolated binding protein containing an antigen binding domain of a CA153 protein, and researches on the preparation, application and the like of the binding protein. The binding protein has strong activity and high affinity with the human CA153 protein, and can be widely applied to the field of detection of the CA153 protein.

Description

Recombinant antibody of anti-human CA153 protein

Technical Field

The invention relates to the technical field of immunization, in particular to a recombinant antibody of anti-human CA153 protein.

Background

Breast Cancer (Breast Cancer) is one of the most common malignancies in women, with about 120 million women worldwide each year having Breast Cancer, and about 50 million deaths from Breast Cancer. In recent years, the incidence of breast cancer in China is on the trend of increasing year by year, and the pathogenic characteristics of the breast cancer are that the onset age is younger, the early stage is more asymptomatic, the disease period is relatively late when the patient is in treatment, and the survival period is shortened due to metastasis, so that early diagnosis and early treatment are the key points for improving the survival rate of patients.

How to improve the early diagnosis rate of breast cancer is a common concern of scholars at home and abroad at present. The clinical use of serum markers associated with breast cancer is limited by their low sensitivity and specificity when used alone for early diagnosis. In recent years, the detection of tumor markers is increasingly applied to clinical diagnosis and treatment of malignant tumors, and various tumor markers related to breast cancer exist. CA153 is a tumor marker recognized at present and specific to breast cancer, is over-expressed in breast cancer, is not related to pathological types, and is related to clinical staging, tumor size, axillary lymph nodes condition and estrogen-progestogen receptors. CA153 is a variant of the epithelial surface glycoprotein of breast cells and is an important marker of breast cancer. The assay for CA153 can assist in the monitoring of treatment in breast cancer patients, and its dynamic assay can help in early detection of recurrence after treatment in stage II and III breast cancer patients, and monitoring the responsiveness of breast cancer metastasis patients to treatment. It is the most useful index for detecting postoperative recurrence of breast cancer, and CA153 is obviously increased in 96% of patients with local or systemic recurrence before various detections in radiology and clinic. The increased concentration in serum is also closely related to the severity of the tumor; otherwise; its value is reduced, and its therapeutic effect is obvious. The clinical methods for detecting the level of CA153 include enzyme-linked immunosorbent assay (ELISA), chemiluminescence, colloidal gold and the like, and different methods have respective advantages and disadvantages, but all require specific monoclonal antibodies aiming at CA 153. The traditional clinical diagnosis uses monoclonal antibodies of murine origin.

The existing CA153 antibody has low activity and poor affinity, and cannot be well applied to the detection of CA153 protein, so there is a strong need in the art for an antibody that can effectively and specifically bind to and detect CA 153.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The invention relates to a novel isolated binding protein containing a CA153 antigen binding domain, and researches on the preparation, application and the like of the binding protein.

The antigen binding domainAt least one complementarity determining region comprising an amino acid sequence selected from the group consisting of: or; has at least 80% sequence identity to the complementarity determining regions of the amino acid sequence described below and has K with the CA153 protein_D≤2.44×10^-8Affinity of mol/L;

CDR-VH1 is G-X1-T-F-X2-N-Y-W, wherein,

x1 is A or F, X2 is T or S;

CDR-VH2 is E-I-R-X1-K-S-N-X2-Y-A-X3-H-Y-A-E-S-V, wherein,

x1 is I, L or V, X2 is Q or N, X3 is T or S;

CDR-VH3 is R-X1-X2-T-T-X3-Y-Y-A-M-D-Y, wherein,

x1 is Q, E or G, X2 is I or L, X3 is L or I;

the CDR-VL1 is S-K-S-L-L-H-X1-X2-G-N-T-X3-L-Y, wherein,

x1 is S or R, X2 is D, V or N, X3 is Y or F;

the complementarity determining region CDR-VL2 is R-T-X1-N-L-A-S, wherein,

x1 is T or S;

the CDR-VL3 is M-X1-X2-L-E-Y-X3-F, wherein,

x1 is H or Q, X2 is Y or H, and X3 is P or A.

An important advantage is that the binding protein is highly active and has a high affinity for the human CA153 protein.

Detailed Description

The present invention may be understood more readily by reference to the following description of certain embodiments of the invention and the detailed description of the examples included therein.

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such embodiments are necessarily varied. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Noun definitions

"isolated binding protein comprising an antigen binding domain" broadly refers to all proteins/protein fragments that comprise a CDR region. The term "antibody" includes polyclonal and monoclonal antibodies and antigenic compound-binding fragments of these antibodies, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies and minimal recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".

The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region (VL or VH) is composed of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The extent of the framework regions and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of immunological interest), E.Kabat et al, U.S. department of Health and human services (U.S. department of Health and human services), (1983), and Chothia. The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.

As used herein, the "framework" or "FR" regions mean the regions of the antibody variable domain excluding those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3 and FR 4).

Typically, the variable domains VL/VH of the heavy and light chains are obtained by linking the CDRs and FRs numbered as follows in a combinatorial arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR 4.

As used herein, the term "purified" or "isolated" in relation to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its native medium or native form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally bound to or normally mixed with it or in solution. Isolated polypeptides include the naturally-produced polypeptide contained in a cell lysate, the polypeptide in purified or partially purified form, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous host cell or culture. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

Exemplary embodiments of the invention

The present invention relates to an isolated binding protein comprising an antigen binding domain, wherein the antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences recited in seq id nos: or; has at least 80% sequence identity to the complementarity determining regions of the amino acid sequence described below and has K with the CA153 protein_D≤2.44×10^-8Affinity of mol/L;

CDR-VH1 is G-X1-T-F-X2-N-Y-W, wherein,

x1 is A or F, X2 is T or S;

CDR-VH2 is E-I-R-X1-K-S-N-X2-Y-A-X3-H-Y-A-E-S-V, wherein,

x1 is I, L or V, X2 is Q or N, X3 is T or S;

CDR-VH3 is R-X1-X2-T-T-X3-Y-Y-A-M-D-Y, wherein,

x1 is Q, E or G, X2 is I or L, X3 is L or I;

the CDR-VL1 is S-K-S-L-L-H-X1-X2-G-N-T-X3-L-Y, wherein,

x1 is S or R, X2 is D, V or N, X3 is Y or F;

the complementarity determining region CDR-VL2 is R-T-X1-N-L-A-S, wherein,

x1 is T or S;

the CDR-VL3 is M-X1-X2-L-E-Y-X3-F, wherein,

x1 is H or Q, X2 is Y or H, and X3 is P or A.

In some embodiments, the antigen binding domain has at least 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to a complementarity determining region of an amino acid sequence having a K with CA153 protein_D≤2.44×10^-8mol/L, 1.0X 10 can also be selected^-9mol/L、2.0×10^-9mol/L、3.0×10^-9mol/L、4.0×10^-9mol/L、5.0×10^-9mol/L、6.0×10^-9mol/L、7.0×10^- ⁹mol/L、8.0×10^-9mol/L、9.0×10^-9mol/L、1.0×10^-10mol/L、3.0×10^-10mol/L、5.0×10^- ¹⁰mol/L、7.0×10^-10mol/L、8.7×10^-10mol/L、9.0×10^-10Affinity of mol/L; or 8.92 × 10^- ¹⁰mol/L≤K_D≤2.44×10^-8mol/L。

Wherein the affinity is determined according to the method of the present specification.

In some embodiments:

in the complementarity determining region CDR-VH1, X2 is S;

in the complementarity determining region CDR-VH2, X3 is T;

in the complementarity determining region CDR-VH3, X1 is E;

in the complementarity determining region CDR-VL1, X1 is R;

in the complementarity determining region CDR-VL2, X1 is S;

in the CDR-VL3, X3 is P.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is a.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is F.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is I and X2 is Q.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is L and X2 is Q.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is V and X2 is Q.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is I and X2 is N.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is L and X2 is N.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is V and X2 is N.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is I and X3 is L.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is L and X3 is L.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is I and X3 is I.

In some embodiments, in the complementarity determining region CDR-VH3, X2 is L and X3 is I.

In some embodiments, the complementarity determining region CDR-VL1, X2 is D and X3 is Y.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is V and X3 is Y.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is N and X3 is Y.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is D and X3 is F.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is V and X3 is F.

In some embodiments, in the complementarity determining region CDR-VL1, X2 is N and X3 is F.

In some embodiments, in the complementarity determining region CDR-VL3, X1 is H and X2 is Y.

In some embodiments, in the complementarity determining region CDR-VL3, X1 is Q and X2 is Y.

In some embodiments, in the complementarity determining region CDR-VL3, X1 is H and X2 is H.

In some embodiments, in the complementarity determining region CDR-VL3, X1 is Q and X2 is H.

In some embodiments, the binding protein includes at least 3 CDRs (e.g., 3 CDRs of a heavy chain, or 3 CDRs of a light chain); alternatively, the binding protein comprises at least 6 CDRs.

In some embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.

In some embodiments, the binding protein is a "functional fragment" of an antibody, e.g., a nanobody, F (ab')₂Fab', Fab, Fv, scFv, diabody and antibody minimal recognition unit.

scFv (sc ═ single chain), bispecific antibodies (diabodies).

The term "functional fragment" as used herein refers in particular to an antibody fragment having the same specificity for CA153 as the parent antibody. In addition to the above functional fragments, any fragment having an increased half-life is also included.

These functional fragments typically have the same binding specificity as the antibody from which they are derived. As the person skilled in the art deduces from the description of the invention, the antibody fragment of the invention may be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction cleavage of disulfide bonds.

Antibody fragments can also be obtained by peptide synthesis by recombinant genetic techniques also known to those skilled in the art or by, for example, automated peptide synthesizers, such as those sold by Applied BioSystems and the like.

In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence shown in SEQ ID NOS: 1-4, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence shown in SEQ ID NOS: 5-8.

In addition to the amino acid sequences disclosed herein above, the framework regions may be derived from human species to constitute humanized antibodies.

In some embodiments, the binding protein further comprises an antibody constant region sequence.

In some embodiments, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.

In some embodiments, the constant region is derived from a mouse;

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

According to one aspect of the invention, the invention also relates to an isolated nucleic acid molecule, which is DNA or RNA, encoding a binding protein as described above.

According to one aspect of the invention, the invention also relates to a vector comprising a nucleic acid molecule as described above.

The invention further comprises at least one nuclear construct, e.g. a plasmid, further an expression plasmid, encoding a nucleic acid molecule as described above, the construction of which vector will be described in one embodiment of the present application.

According to one aspect of the invention, the invention also relates to a host cell transformed with a vector as described above.

The host cell may be a eukaryotic cell, such as a mammalian cell.

In some embodiments, the host cell is a CHO cell.

According to one aspect of the invention, the invention also relates to a method for producing a binding protein as described above, said method comprising the steps of:

the host cells as described above are cultured in a medium and under suitable culture conditions, and the binding protein so produced is recovered from the medium or from the cultured host cells.

According to one aspect of the invention, the invention also relates to the use of a binding protein as described above for the preparation of a diagnostic agent or kit for the diagnosis of breast cancer, lung cancer, ovarian cancer, lung adenocarcinoma or colorectal cancer.

According to one aspect of the invention, the invention also relates to a method of detecting CA153 protein in a test sample, comprising:

a) contacting a CA153 protein in the test sample with a binding protein of claim above under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex; and

b) detecting the presence of said immune complex, the presence of said complex indicating the presence of said CA153 protein in said test sample;

in this embodiment, the binding protein may be labeled with an indicator that indicates the strength of the signal, so that the complex is readily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

in this embodiment, the binding protein is in the form of a first antibody that forms a partner antibody with the second antibody for binding to a different epitope of CA 153;

the second antibody may be labeled with an indicator showing the intensity of the signal so that the complex is easily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, which second antibody binds to the CA153 protein;

in this embodiment, the binding protein serves as an antigen for the second antibody, which may be labeled with an indicator of signal intensity to allow the complex to be readily detected.

In some embodiments, the indicator that shows signal intensity comprises any one of a fluorescent substance, a quantum dot, a digoxigenin-labeled probe, biotin, a radioisotope, a radiocontrast agent, a paramagnetic ion fluorescent microsphere, an electron-dense substance, a chemiluminescent label, an ultrasound contrast agent, a photosensitizer, colloidal gold, or an enzyme.

In some embodiments, the fluorescent species include Alexa 350, Alexa 405, Alexa 430, Alexa488, Alexa 555, Alexa 647, AMCA, aminoacridine, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4 ', 5' -dichloro-2 ', 7' -dimethoxyfluorescein, 5-carboxy-2 ', 4', 5', 7' -tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, dansyl chloride, fluorescein, HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-1, 3-diazole), Any one of Oregon Green488, Oregon Green 500, Oregon Green514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresol fast violet, cresol Blue violet, brilliant cresol Blue, p-aminobenzoic acid, erythrosine, phthalocyanine, azomethine, cyanine, xanthine, succinyl fluorescein, rare earth metal cryptate, europium trisbipyridinediamine, europium cryptate or chelate, diamine, bispyanine, La Jolla Blue dye, allophycocyanin, allocyanin B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin R, REG, rhodamine Green, rhodamine isothiocyanate, rhodamine red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine, and Texas red.

In some embodiments, the radioisotope comprises¹¹⁰In、¹¹¹In、¹⁷⁷Lu、¹⁸F、⁵²Fe、⁶²Cu、⁶⁴Cu、⁶⁷Cu、⁶⁷Ga、⁶⁸Ga、⁸⁶Y、⁹⁰Y、⁸⁹Zr、⁹⁴mTc、⁹⁴Tc、⁹⁹mTc、¹²⁰I、¹²³I、¹²⁴I、¹²⁵I、¹³¹I、^154-158Gd、³²P、¹¹C、¹³N、¹⁵O、¹⁸⁶Re、¹⁸⁸Re、⁵¹Mn、⁵²mMn、⁵⁵Co、⁷²As、⁷⁵Br、⁷⁶Br、⁸²mRb and⁸³sr.

In some embodiments, the enzyme comprises any one of horseradish peroxidase, alkaline phosphatase, and glucose oxidase.

In some embodiments, the fluorescent microspheres are: the polystyrene fluorescent microsphere is internally wrapped with rare earth fluorescent ion europium.

According to one aspect of the invention, the invention also relates to a kit comprising a binding protein as described above.

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

Restriction enzyme, Prime Star DNA polymerase, was purchased from Takara in this example. MagExtractor-RNA extraction kit was purchased from TOYOBO. The SMARTERTM RACE cDNA amplification kit was purchased from Takara. pMD-18T vector was purchased from Takara. Plasmid extraction kits were purchased from Tiangen corporation. Primer synthesis and gene sequencing were performed by Invitrogen corporation.

1.1 primers

Amplification of Heavy Chain and Light Chain 5' RACE primers:

SMARTER II A Oligonucleotide：

5’>AAGCAGTGGTATCAACGCAGAGTACXXXXX<3’；

5'-RACE CDS Primer(5'-CDS)：5’>(T)₂₅VN<3’(N＝A,C,G,orT；V＝A,G,orC)；

Universal Primer A Mix(UPM):

5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’

Nested Universal Primer A(NUP):

5’>AAGCAGTGGTATCAACGCAGAGT<3’

mIg-kR：5’>CCCGAATTCCTAACACTCATTCCTGTTGAAGCTCTTGAC<3’。

mIg-HR：5’>TTTACCAGGAGAGTGGGAGAGGCTCTTC<3’。

1.2 cloning and sequencing of antibody variable region genes

Extracting RNA from hybridoma cell line secreting Anti-CA 1533G 6 monoclonal antibody with MagExtractor-RNA extraction kit, and extracting with SMARTER^TMA first strand cDNA is synthesized by SMARTER II A Oligonucleotide and 5' -CDS Primer in RACE cDNA Amplification Kit and Kit, the obtained first strand cDNA product is used as PCR Amplification template, the Light Chain gene is amplified by Universal Primer A Mix (UPM), NestedUniversal Primer A (NUP) and mkR Primer, the Light Chain gene is amplified by Universal Primer AMIX (UPM), Nested Universal Primer A (NUP) and mHR Primer, the Light Chain Primer pair amplifies about 0.72KB of target band, the Heavy Chain Primer pair amplifies about 1.4KB of target band, the products are purified and recovered by agarose gel electrophoresis, the products are added with rTaq DNA polymerase, inserted into pMD-18T vector, transformed into 5 α state cell, and the Light Chain gene clone and Invitrogen clone are respectively taken out to test the clone 4 Invitrogen clone.

1.3 sequence analysis of Anti-CA 1533G 6 antibody variable region genes

Putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene fragment amplified by the Light Chain, the VL gene sequence is 339bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the HeavyChain primer pair, the VH gene sequence is 366bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.

1.4 construction of recombinant antibody expression plasmid

pcDNA^TM3.4

vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, BamHI, EcoRI and the like are introduced into the expression vector and named as pcDNA3.4A expression vector, and the vector is called as 3.4A expression vector for short in the following; according to the sequencing result of the antibody gene in the pMD-18T, designing the specificity primers of the Heavy Chain and Light Chain of the Anti-CA 1533G 6 antibody, wherein the two ends of the primers are respectively provided with HindIII, EcoRI restriction sites and protective bases, and the primers are as follows:

CA153-3G6-HF：

5’>CCCAAGCTTGCCGCCACCATGGAATGCAGCTGTGTCATGCTCTTCTTCCT<3’；

CA153-3G6-HR:

5’>CCCGAATTCTGATTTACCAGGAGAGTGGGAGAGGCTC<3’；

CA153-3G6-LF:

5’>CCCAAGCTTGCCGCCACCATGAAGTTGCCTGTTAGGCTGTTGGTGCTGA<3’；

CA153-3G6-LR:

5’>CCCGAATTCCTAACACTCATTCCTGTTGAAGCTCTTGAC<3’；

a0.72 KB Light Chain gene fragment and a 1.4KB Heavy Chain gene fragment were amplified by PCR amplification. The gene fragments of the Heavy Chain and the Light Chain are subjected to double enzyme digestion by HindIII/EcoRI respectively, the 3.4A vector is subjected to double enzyme digestion by HindIII/EcoRI, the Heavy Chain gene and the Light Chain gene are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the Heavy Chain and the Light Chain are respectively obtained.

Example two

Recombinant antibody expression plasmid transient transfection CHO cell and expression supernatant antibody activity identification

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10⁷cells/ml in centrifuge tube, 100ul plasmid and 700ul cell mixture, transferring into electric rotating cup, electric rotating, transferring into 10ml culture medium containing CD CHO AGTCultivation in 37 ℃ shaker (8% CO)₂Amplitude 150); the cell viability was measured by sampling every day, and when the cell viability was less than 50%, the cell culture supernatant was centrifuged to obtain an antibody (having light and heavy chains having the sequences shown in SEQ ID NOS: 11 and 12).

Upon analysis, the complementarity determining region (WT) of the heavy chain:

CDR-VH1 is G-A (X1) -T-F-T (X2) -N-Y-W

CDR-VH2 is E-I-R-V (X1) -K-S-N-Q (X2) -Y-A-S (X3) -H-Y-A-E-S-V;

CDR-VH3 is R-Q (X1) -I (X2) -T-T-L (X3) -Y-Y-A-M-D-Y;

complementarity determining regions of the light chain:

CDR-VL1 is S-K-S-L-L-H-S (X1) -D (X2) -G-N-T-Y (X3) -L-Y;

CDR-VL2 is R-T-T (X1) -N-L-A-S;

CDR-VL3 is M-H (X1) -Y (X2) -L-E-Y-A (X3) -F;

wherein, X1, X2 and X3 are all the sites to be mutated.

TABLE 1 mutant sites associated with antibody Activity

The inventors performed the above-described mutation of the CDR sites in WT to obtain a more active antibody.

Diluting goat anti-mouse IgG 1ug/ml with the coating solution to coat the microplate, wherein each well is 100uL, and the temperature is 4 ℃ overnight; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), beating to dry at 37 deg.C for 1h and 120uL per well; adding diluted CA153 monoclonal antibody, 100 uL/hole, 37 deg.C, 60 min; throwing off liquid in the plate, patting dry, adding 20% of mouse negative blood, sealing, keeping the temperature at 37 ℃ for 1h, wherein each hole is 120 ul; throwing off liquid in the plate, patting dry, adding 100 times diluted CA153 antigen (the constant value of the CA153 in tumor ascites is 8.2KU/ml), 100uL per hole, 37 ℃,40 min; washing with washing solution for 5 times, and drying; adding a CA153 monoclonal antibody (1:4K) marked with another HRP strain, wherein each well is 100uL at 37 ℃ for 30 min; adding a developing solution A (50 uL/hole), adding a developing solution B (50 uL/hole), and carrying out 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 uL/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader.

TABLE 2 antibody Activity assay data

Antibody concentration (ng/mL)	WT	Mutation 1	Mutation 2	Mutation 3	Mutation 4	Mutation 5
							1000	1.415	2.233	2.215	1.820	1.826	1.725
200	1.008	1.648	1.308	1.398	1.278	1.201
							40	0.104	0.242	0.204	0.115	0.124	0.128
8	0.070	0.140	0.090	0.120	0.131	0.129
							1.6	0.098	0.164	0.088	0.111	0.124	0.124
0.32	0.089	0.155	0.099	0.109	0.132	0.128
							0	0.098	0.099	0.098	0.099	0.097	0.098

As can be seen from Table 2, since the activity of mutation 1 was most effective, mutation sites with better potency were selected by using mutation 1 as the framework sequence (ensuring that the activity of the antibody obtained by the screening was similar to that of mutation 1, and the antibody activity was. + -. 10%), and some results are as follows.

TABLE 3 mutation sites related to antibody affinity

Affinity analysis of mutant sites

Using AMC sensors, purified antibodies were diluted to 10ug/ml with PBST, and CA153 ascites specimens (tumor ascites CA153 fixed at 8.2KU/ml) were diluted with PBST in a gradient: 400U/ml, 200U/ml, 100U/ml, 50U/ml, 25U/ml, 12.5U/ml, 6.25U/ml, 0U/ml;

the operation flow is as follows: equilibrating in buffer 1(PBST) for 60s, immobilizing antibody in antibody solution for 300s, incubating in buffer 2(PBST) for 180s, binding in antigen solution for 420s, dissociating in buffer 2 for 1200s, regenerating the sensor with 10mM GLY solution pH 1.69 and buffer 3, and outputting the data. (K)_DRepresenting the equilibrium solution affinity constant, i.e. affinity forces; kon denotes the binding rate; kdis denotes the off-rate. In the calculation, it is assumed that 1U/ml of the CA153 ascites specimen corresponds to 1 nmol/ml. )

Table 4 affinity assay data

As can be seen from table 4, the mutation sites listed in table 3 have little effect on the affinity of the antibody.

To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.

TABLE 5 mutations with WT as backbone

Table 6 affinity assay data

From the analyses in tables 5 and 6, the association between the mutation site and other sites was not significant on the premise that the antibody activity was ensured.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Dongguan City of Pengzhi Biotech Co., Ltd

<120> a recombinant antibody against human CA153 protein

<160>12

<170>PatentIn version 3.3

<210>1

<211>25

<212>PRT

<213>Mus musculus

<400>1

Asp Ile Val Met Thr Gln Ala Ala Pro Ser Val Pro Val Thr Pro Gly

1 5 10 15

Glu Ser Val Ser Ile SerCys Arg Ser

20 25

<210>2

<211>15

<212>PRT

<213>Mus musculus

<400>2

Trp Phe Leu Gln Arg Pro Gly Gln Ser Pro Gln Leu Leu Ile Tyr

1 5 10 15

<210>3

<211>32

<212>PRT

<213>Mus musculus

<400>3

Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Ala Phe Thr

1 5 10 15

Leu Arg Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys

20 25 30

<210>4

<211>12

<212>PRT

<213>Mus musculus

<400>4

Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg

1 5 10

<210>5

<211>25

<212>PRT

<213>Mus musculus

<400>5

Glu Val Lys Leu Glu Glu Ser Gly Gly Asp Leu Val Gln Pro Gly Gln

1 5 10 15

Ser Met Lys Leu Ser Cys Val Ala Ser

20 25

<210>6

<211>16

<212>PRT

<213>Mus musculus

<400>6

Met Asn Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val Ala

1 5 10 15

<210>7

<211>33

<212>PRT

<213>Mus musculus

<400>7

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ser Val Tyr

1 5 10 15

Leu Gln Met Asn Asn Leu Arg Ala Glu Asp Thr Gly Ile Tyr Tyr Cys

20 25 30

Thr

<210>8

<211>11

<212>PRT

<213>Mus musculus

<400>8

Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

15 10

<210>9

<211>106

<212>PRT

<213>Mus musculus

<400>9

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

1 5 10 15

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

20 25 30

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

35 40 45

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

50 55 60

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

65 70 75 80

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

85 90 95

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210>10

<211>323

<212>PRT

<213>Mus musculus

<400>10

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala GlnThr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro

195 200 205

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln

210 215 220

Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val

225 230 235 240

Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val

245 250 255

Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln

260 265 270

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn

275 280 285

Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val

290 295 300

Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His

305 310 315 320

Ser Pro Gly

<210>11

<211>219

<212>PRT

<213> Artificial sequence

<400>11

Asp Ile Val Met Thr Gln Ala Ala Pro Ser Val Pro Val Thr Pro Gly

1 5 10 15

Glu Ser Val Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser

20 25 30

Asp Gly Asn Thr Tyr Leu Tyr Trp Phe Leu Gln Arg Pro Gly Gln Ser

35 40 45

Pro Gln Leu Leu Ile Tyr Arg Thr Thr Asn Leu Ala Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Ala Phe Thr Leu Arg Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met His Tyr

85 90 95

Leu Glu Tyr Ala Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

100 105 110

Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu

115 120 125

Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

130 135 140

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg

145 150 155 160

Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser

165 170 175

Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu

180 185 190

Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser

195 200 205

Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

210 215

<210>12

<211>445

<212>PRT

<213> Artificial sequence

<400>12

Glu Val Lys Leu Glu Glu Ser Gly Gly Asp Leu Val Gln Pro Gly Gln

1 5 10 15

Ser Met Lys Leu Ser Cys Val Ala Ser Gly Ala Thr Phe Thr Asn Tyr

20 25 30

Trp Met Asn Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val

35 40 45

Ala Glu Ile Arg Val Lys Ser Asn Gln Tyr Ala Ser His Tyr Ala Glu

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ser

65 70 75 80

Val Tyr Leu Gln Met Asn Asn Leu Arg Ala Glu Asp Thr Gly Ile Tyr

85 90 95

Tyr Cys Thr Arg Gln Ile Thr Thr Leu Tyr Tyr Ala Met Asp Tyr Trp

100 105 110

Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro

115 120 125

Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met

130 135 140

Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr

145 150 155 160

Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro

165 170 175

Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val

180 185 190

Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys Asn Val Ala His

195 200 205

Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys

210 215 220

Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe

225 230 235 240

Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro

245 250 255

Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val

260 265 270

Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr

275 280 285

Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu

290 295 300

Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys

305 310 315 320

Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser

325 330 335

Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro

340 345 350

Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile

355 360 365

Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly

370 375 380

Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp

385 390 395 400

Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp

405 410 415

Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His

420 425 430

Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly

435 440 445

Claims

1. An isolated binding protein comprising an antigen binding domain, wherein the antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences recited in seq id nos: or; complementarity determining regions with the following amino acid sequencesHas at least 80% sequence identity and has K with CA153 protein_D≤2.44×10^-8Affinity of mol/L;

CDR-VH1 is G-X1-T-F-X2-N-Y-W, wherein,

x1 is A or F, X2 is T or S;

CDR-VH2 is E-I-R-X1-K-S-N-X2-Y-A-X3-H-Y-A-E-S-V, wherein,

x1 is I, L or V, X2 is Q or N, X3 is T or S;

CDR-VH3 is R-X1-X2-T-T-X3-Y-Y-A-M-D-Y, wherein,

x1 is Q, E or G, X2 is I or L, X3 is L or I;

the CDR-VL1 is S-K-S-L-L-H-X1-X2-G-N-T-X3-L-Y, wherein,

x1 is S or R, X2 is D, V or N, X3 is Y or F;

the complementarity determining region CDR-VL2 is R-T-X1-N-L-A-S, wherein,

x1 is T or S;

the CDR-VL3 is M-X1-X2-L-E-Y-X3-F, wherein,

x1 is H or Q, X2 is Y or H, X3 is P or A;

preferably:

in the complementarity determining region CDR-VH1, X2 is S;

in the complementarity determining region CDR-VH2, X3 is T;

in the complementarity determining region CDR-VH3, X1 is E;

in the complementarity determining region CDR-VL1, X1 is R;

in the complementarity determining region CDR-VL2, X1 is S;

in the complementarity determining region CDR-VL3, X3 is P;

preferably, in the complementarity determining region CDR-VH1, X1 is a;

preferably, in the complementarity determining region CDR-VH1, X1 is F;

preferably, in the complementarity determining region CDR-VH2, X1 is I, X2 is Q;

preferably, in the complementarity determining region CDR-VH2, X1 is L, and X2 is Q;

preferably, in the complementarity determining region CDR-VH2, X1 is V, X2 is Q;

preferably, in the complementarity determining region CDR-VH2, X1 is I, X2 is N;

preferably, in the complementarity determining region CDR-VH2, X1 is L, and X2 is N;

preferably, in the complementarity determining region CDR-VH2, X1 is V, X2 is N;

preferably, in the complementarity determining region CDR-VH3, X2 is I, X3 is L;

preferably, in the complementarity determining region CDR-VH3, X2 is L, and X3 is L;

preferably, in the complementarity determining region CDR-VH3, X2 is I, and X3 is I;

preferably, in the complementarity determining region CDR-VH3, X2 is L, and X3 is I;

preferably, in the complementarity determining region CDR-VL1, X2 is D, X3 is Y;

preferably, in the complementarity determining region CDR-VL1, X2 is V, X3 is Y;

preferably, in the complementarity determining region CDR-VL1, X2 is N, X3 is Y;

preferably, in the complementarity determining region CDR-VL1, X2 is D, X3 is F;

preferably, in the complementarity determining region CDR-VL1, X2 is V, X3 is F;

preferably, in the complementarity determining region CDR-VL1, X2 is N, X3 is F;

preferably, in the complementarity determining region CDR-VL3, X1 is H, X2 is Y;

preferably, in the complementarity determining region CDR-VL3, X1 is Q, X2 is Y;

preferably, in the complementarity determining region CDR-VL3, X1 is H, X2 is H;

preferably, in the complementarity determining region CDR-VL3, X1 is Q and X2 is H.

2. The isolated binding protein comprising an antigen binding domain according to claim 1, wherein at least 3 CDRs are included in the binding protein; alternatively, the binding protein comprises at least 6 CDRs;

preferably, the binding protein is a nanobody,F(ab’)₂One of, Fab', Fab, Fv, scFv, diabody, and antibody minimal recognition unit;

preferably, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 which have the sequences shown in SEQ ID NO. 1-4 in sequence, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 which have the sequences shown in SEQ ID NO. 5-8 in sequence.

3. The isolated binding protein comprising an antigen binding domain according to claim 1 or 2, wherein the binding protein further comprises an antibody constant region sequence;

preferably, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD;

preferably, the species of the constant region is from a cow, horse, cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fight, or human;

preferably, the constant region is derived from a mouse;

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

4. An isolated nucleic acid molecule which is DNA or RNA encoding the binding protein of any one of claims 1 to 3.

5. A vector comprising the nucleic acid molecule of claim 4.

6. A host cell transformed with the vector of claim 5.

7. A method of producing the binding protein of any one of claims 1 to 3, comprising the steps of:

culturing the host cell of claim 6 in a culture medium and under suitable culture conditions, and recovering the binding protein so produced from the culture medium or from the cultured host cell.

8. Use of a binding protein according to any one of claims 1 to 3 in the manufacture of a diagnostic agent or kit for the diagnosis of breast, lung, ovarian, lung adenocarcinoma or colorectal cancer.

9. A method of detecting CA153 protein in a test sample, comprising:

a) contacting a CA153 protein in the test sample with the binding protein of any one of claims 28-31 under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex; and

preferably, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

preferably, in step a), a second antibody is further included in the immune complex, and the second antibody binds to the CA153 protein.

10. A kit comprising the binding protein of any one of claims 1 to 3.