CN111349704A

CN111349704A - Diagnostic product and therapeutic composition for liver cancer

Info

Publication number: CN111349704A
Application number: CN202010188047.0A
Authority: CN
Inventors: 窦剑; 赵鑫; 张颖; 刘文鹏; 刘宝旺; 崔自强; 曾强; 王洋; 滕亮; 张军红; 曹经琳; 高庆军
Original assignee: Third Hospital of Hebei Medical University
Current assignee: Third Hospital of Hebei Medical University
Priority date: 2020-03-17
Filing date: 2020-03-17
Publication date: 2020-06-30
Anticipated expiration: 2040-03-17
Also published as: CN111349704B

Abstract

The invention discloses a diagnosis product and a treatment composition for liver cancer. The invention describes the expression condition of miR-6761-5p in liver cancer, and simultaneously describes the influence of miR-6761-5p on the proliferation, migration and invasion of liver cancer cells.

Description

Diagnostic product and therapeutic composition for liver cancer

Technical Field

The invention belongs to the field of biological medicine, and relates to a diagnosis product and a treatment composition for liver cancer.

Background

Hepatocellular carcinoma (HCC; liver cancer for short) belongs to highly malignant tumor, has hidden disease, short course and high mortality rate, and is the main cause of death related to the fourth most common cancer worldwide (Bray F, Ferlay J, Soerjomataram I, et al. Global cancer 2018. GLOBOCAN cancers of invasion and mortalities for 36cancers in 185countries [ J ]. CA cancer J C1in,2018,68(6):394 and 424.). Researches show that the degree of the liver cancer in China is the third in the morbidity and accounts for 17.33 percent of the total cancer, and the degree of the death is the second and accounts for 12.88 percent of the total cancer. The incidence of liver cancer increases with age, but in the elderly population, there is a downward trend, with men being more susceptible than women (Singh AK, Kumar R, PandeyAK. hepatocellular Carcinoma: Causes, Mechanism of progress and biomakers [ J ]. Curr Chem Genom Transl Med,2018,12: 9-26.). Liver cancer onset is usually caused by the combined action of multiple factors, and the risk factors related to liver cancer occurrence are currently found to be hepatitis virus infection, aflatoxin B1, alcohol, congenital and acquired metabolic diseases and the like. In recent years, the diagnosis and treatment of liver cancer has been greatly advanced, but most patients are diagnosed at an advanced stage, with low cure rate and long-term survival rate, placing a heavy burden on the family and society (Switlink WZ, Bielecka-Kowalska, Karbownik MS, et al. forms of diagnostic materials industries of miRNA bipolar in hepatocellular carcinoma machinery a preliminary study [ J ]. Biomark Med, 2019.). At present, imaging means and serum markers are commonly used methods for screening liver cancer, but the methods still lack sensitivity and specificity for early diagnosis of liver cancer. Therefore, it is important to find sensitive and specific biomarkers for diagnosis, treatment and prognosis of liver cancer.

MicroRNAs (miRNA) are small non-coding RNAs with the length of about 18-25 nucleotides, and are gradually processed by a series of endonucleases and transporters in cell nucleus and cytoplasm. The precursor is double-stranded RNA, and the mature body is single-stranded RNA. Generally, one of the miRNAs becomes a mature body to play a role after being melted, and the other miRNA is degraded; but there are also two chains that exert different functions simultaneously. miRNA has high conservative property, sequence homology and tissue specificity. Studies have shown that (YangN, Ekanem NR, Sakyi CA, et al: Lipocalular Carcinoma and microRNA: Newswerties on therapeutics and diagnostics [ J ]. Adv Drug Deliv Rev,2015,81:62-74.), miRNA inhibits target gene expression by binding to target gene mRNA 3' Untranslated Region (UTR) specific base pairing. Extensive research proves that (Liu K, Liu S, Zhang W, et al. miR-494 proteins cell promotion, migration and invasion, and sorafenib resistance in hepatocellular carcinoma by targeting PTEN [ J ]. Oncol Rep,2015,34(2):1003-1010.), abnormal expression of miRNA in tumor is an important factor influencing liver cancer treatment and prognosis by acting on key factors such as cancer suppressor genes, protooncogenes, apoptosis factors, growth factors, transcription factors, cyclin, cancer signal pathways and the like to regulate and control the biological behaviors of tumor cell proliferation, cycle change, apoptosis, invasion and metastasis, autophagy, drug resistance and the like, so that research on miRNA related to liver cancer occurrence and development provides an important means for diagnosis and treatment of liver cancer.

Disclosure of Invention

The invention aims to provide a marker for detecting liver cancer of a subject, wherein the marker is miR-6761-5 p.

The invention also aims to provide application of miR-6761-5p in preparation of a product for diagnosing liver cancer and a product for diagnosing liver cancer.

The invention also aims to provide application of miR-6761-5p in preparation of a pharmaceutical composition for treating liver cancer and a pharmaceutical composition for treating liver cancer.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides a marker for detecting liver cancer of a subject, which comprises a miR-6761-5p gene product.

The invention provides application of a reagent for detecting miR-6761-5p in preparation of a product for diagnosing liver cancer of a subject, wherein the diagnosis comprises

1) Identifying expression of miR-6761-5p relative to a control; and

2) when the subject has reduced expression of miR-6761-5p as compared to a control, the subject is indicated as having liver cancer.

Further, the reagent comprises

An oligonucleotide probe for specifically recognizing miR-6761-5 p; or

And (3) primers for specifically amplifying miR-6761-5 p.

Further, the primer sequence is shown as SEQ ID NO. 1.

The invention provides a product for diagnosing hepatocellular carcinoma, which comprises a reagent for detecting miR-6761-5p in a sample of a subject.

Further, the reagent comprises an oligonucleotide probe which specifically recognizes miR-6761-5 p; or a primer for specifically amplifying miR-6761-5 p.

Further, the primer sequence is shown as SEQ ID NO. 1.

Further, the product includes a kit or a microarray.

The invention provides the use of any one of:

1) application of miR-6761-5p in preparing a pharmaceutical composition for treating hepatocellular carcinoma;

2) application of miR-6761-5p in preparing a pharmaceutical composition for treating hepatocellular carcinoma invasion;

3) application of miR-6761-5p in preparing a pharmaceutical composition for treating hepatocellular carcinoma metastasis;

4) application of miR-6761-5p in screening of candidate drugs for treating hepatocellular carcinoma.

Further, the pharmaceutical composition comprises the isolated miR-6761-5p gene product and a pharmaceutically acceptable carrier.

Further, the method of screening in 4) comprises providing a test agent to the cells and measuring the level of miR-6761-5p, wherein an increase in the level of miR-6761-5p in the cells, relative to suitable control cells, is indicative of the test agent being a candidate drug for the treatment of hepatocellular carcinoma.

The invention provides a pharmaceutical composition for treating hepatocellular carcinoma, which comprises an isolated miR-6761-5p gene product and a pharmaceutically acceptable carrier.

In the present invention, "miR gene product", "microrna", "miR", or "miRNA" are used interchangeably and refer to unprocessed or processed RNA transcripts from a miR gene. The term "miR gene product" does not include proteins, as the miR gene product is not translated into proteins. Unprocessed miR gene transcripts, also referred to as "miR precursors," typically comprise RNA transcripts that are about 70-100 nucleotides in length. The miR precursors can be processed to active 19-25 nucleotide RNA molecules by digestion with RNAses (e.g., Dicer, Argonaut, or RNAse III (e.g., E.coli RNAse III)). This active 19-25 nucleotide RNA molecule is also referred to as a "processed" miR gene transcript or a "mature" miRNA.

An "isolated" miR gene product is a product that is synthesized or altered or obtained from a natural state by human intervention. For example, a synthetic miR gene product or a miR gene product that is partially or completely isolated from coexisting materials in its natural state is considered "isolated". The isolated miR gene product can exist in a substantially purified form, or can exist in a cell into which the miR gene product has been delivered. Thus, a miR gene product that is intentionally delivered to, or intentionally expressed in, a cell is considered an "isolated" miR gene product. A miR gene product produced in a cell from a molecule of miR precursor is also considered an "isolated" molecule. Isolated miR gene products can be obtained using a number of standard techniques. For example, the miR gene products can be chemically synthesized or recombinantly produced using methods known in the art. In one embodiment, the miRNA is isolated from a cell or tissue. Techniques for isolating mirnas from cells or tissues are well known to those of ordinary skill in the art. For example, mirVana miRNA isolation kits from Ambion, Inc may be used to isolate mirnas from total RNA. Another technique utilizes a flashpage framer System (Ambion, Inc.) for PAGE purification of small nucleic acids.

mirnas can be obtained by preparing recombinant forms thereof (i.e., by using genetic engineering techniques to produce recombinant nucleic acids, which can then be isolated or purified by techniques well known to those of ordinary skill in the art). This embodiment involves growing a culture of host cells in a suitable medium and purifying the miRNA from the cells or the culture in which the cells are grown. For example, the methods include processes for producing mirnas, wherein a host cell comprising a suitable expression vector comprising a nucleic acid encoding a miRNA is cultured under conditions that allow expression of the encoded miRNA. In a preferred embodiment, the nucleic acid encodes miR-6761-5 p. mirnas can be recovered from culture, from culture media, or from lysates prepared from host cells, and further purified. The host cell may be a higher eukaryotic host cell, such as a mammalian cell, a lower eukaryotic host cell, such as a yeast cell, or the host cell may be a prokaryotic cell, such as a bacterial cell. Introduction of a vector comprising a nucleic acid encoding a miRNA into a host cell can be achieved by calcium phosphate transfection, DEAE, dextran-mediated transfection, or electroporation.

Any host/vector system can be used to express one or more of the miRNAs. These include, but are not limited to, eukaryotic hosts such as HeLa cells and yeast, and prokaryotic hosts such as e.coli (e.coli) and bacillus subtilis (b.subtilis). Mirnas can be expressed in mammalian cells, yeast, bacteria, or other cells, where the miRNA gene is under the control of a suitable promoter.

In a preferred embodiment, the miRNA is synthetically obtained, e.g. by chemical synthesis of the nucleic acid via any synthetic method known to the skilled person. The synthesized miRNA can then be purified by any method known in the art. Methods for chemically synthesizing nucleic acids include, but are not limited to, in vitro chemical synthesis using phosphotriester, phosphate or phosphoramidite chemistry and solid phase techniques, or via deoxynucleoside hydrogen phosphonate intermediates. In certain circumstances, for example, where increased nuclease stability is desired, nucleic acids having nucleic acid analogs and/or modified internucleoside linkages may be preferred. Nucleic acids comprising modified internucleoside linkages can also be synthesized using reagents and methods well known in the art. For example, methods for synthesizing nucleic acids comprising the following internucleoside linkages are well known in the art: phosphonates, thiosulfates, dithiosulfates, phosphoramidates, methoxyethyl phosphoramidates, formals (formacetal), thioformals (thioformacetal), diisopropylsilyl, acetamides (acetamidates), carbamates, dimethylene-sulfides (- -CH2- -S- -CH2), dimethylene-sulfoxides (- -CH2- -SO- -CH2), dimethylene-sulfones (- -CH2- -SO2- -CH2), 2 ' -O-alkyls, and 2 ' -deoxy-2 ' -fluorosulfate internucleoside linkages.

It is to be understood that miR-6761-5p of the present invention includes functional equivalents, i.e., variants, of constitutive nucleic acid molecules, with "variants" referring to mirnas that have less than 100% identity to the corresponding wild-type miRNA gene product and that have one or more biological activities of the corresponding wild-type miRNA gene product. Examples of such biological activities include, but are not limited to, inhibition of cellular processes (e.g., cell differentiation, cell growth, cell death) that progress with liver cancer. These variants include species variants and variants resulting from one or more mutations (e.g., substitutions, deletions, insertions) of the miRNA gene.

The miR-6761-5p nucleic acid molecule can exist in a single-stranded or double-stranded form. Mature miR-6761-5p is mainly in a single-stranded form, while the miR-6761-5p precursor is partially self-complementary to form a double-stranded structure. The nucleic acid molecules of the invention may be in the form of RNA, DNA, PNA, LNA.

In the present invention, the level of at least one miR gene product can be measured in cells of a biological sample obtained from the subject. For example, a tissue sample may be removed from a subject suspected of having hepatocellular carcinoma by conventional biopsy techniques. In another embodiment, a blood sample may be removed from the subject and leukocytes isolated for DNA extraction by standard techniques. Preferably, the blood or tissue sample is obtained from the subject prior to radiotherapy, chemotherapy or other therapeutic treatment. The corresponding control tissue or blood sample, or control reference sample, may be obtained from unaffected tissues of the subject, from a normal human individual or population of normal individuals, or from cultured cells corresponding to the majority of cells in the subject sample. The control tissue or blood sample is then processed, along with the sample from the subject, so that the level of miR gene product produced from a given miR gene in cells from the subject's sample can be compared to the corresponding miR gene product level in cells from the control sample. Alternatively, a reference sample can be obtained and processed separately from the test sample (e.g., at different times), and the level of a miR gene product produced from a given miR gene in cells from the test sample can be compared to the corresponding miR gene product level from the reference sample.

In the present invention, the level of a miR gene product in a sample can be measured using any technique suitable for detecting the level of RNA expression in a biological sample. Suitable techniques (e.g., northern blot analysis, RT-PCR, in situ hybridization) for determining RNA expression levels in biological samples (e.g., cells, tissues) are well known to those skilled in the art.

In the present invention, the chip (i.e., microarray) contains a set of oligonucleotide (e.g., oligodeoxynucleotide) probes specific for miR-6761-5 p. By using such a microarray, the expression level of a plurality of microRNAs in a biological sample can be determined by reverse transcribing the RNAs to produce a set of target oligodeoxynucleotides, which are then hybridized to probe oligodeoxynucleotides on the microarray to produce a hybridization or expression profile. A miRNA-specific probe oligonucleotide or a probe oligonucleotide specific for a miRNA refers to a probe oligonucleotide having a sequence selected to hybridize to a particular miRNA gene product or to a reverse transcript of the particular miRNA gene product.

The oligonucleotide probe of the invention can also comprise an oligonucleotide probe aiming at miRNA which is reported in the prior art and can be used for diagnosing liver cancer. The condition that the detection probes of multiple miRNAs are placed on the same chip to jointly diagnose the liver cancer by detecting multiple miRNA indexes is also included in the protection scope of the invention. The reagent also comprises primers and/or probes aiming at the miRNA for diagnosing the liver cancer reported in the prior art. The condition that the detection primers and/or probes of multiple miRNAs are placed in the same kit and liver cancer is jointly diagnosed by detecting multiple miRNA indexes is also included in the protection scope of the invention.

As used herein, "treating," "treatment," and "medical" refer to ameliorating symptoms associated with a disease or disorder, such as a solid cancer, including preventing or delaying the onset of disease symptoms and/or reducing the severity or frequency of symptoms of the disease or disorder. The terms "subject," "patient," and "individual" are defined herein to include animals such as mammals, including, but not limited to, primates, cows, sheep, goats, horses, dogs, cats, rabbits, guinea pigs, rats, mice or other bovine, ovine, equine, canine, feline, rodent, or murine species. In a preferred embodiment, the animal is a human.

In the present invention, a pharmaceutical composition that promotes miR-6761-5p expression can be administered to a subject by any method suitable for delivering the pharmaceutical composition to cancer cells of the subject. For example, agents that promote mirnas can be administered by methods suitable for transfecting cells of a subject with these pharmaceutical compositions or with a nucleic acid comprising a sequence encoding miR-6761-5 p. In one embodiment, the cells are transfected with a plasmid or viral vector comprising a sequence encoding miR-6761-5 p.

Transfection methods for eukaryotic cells are well known in the art and include, for example, direct injection of nucleic acids into the nucleus or pronuclei of a cell, electroporation, liposome transfer or transfer mediated by lipophilic materials, receptor-mediated nucleic acid delivery, biobalsistic or particle acceleration; calcium phosphate precipitation and transfection mediated by viral vectors.

The invention has the advantages and beneficial effects that:

the invention discovers that the expression of miR-6761-5p is reduced in a hepatocellular carcinoma patient for the first time, and whether the patient suffers from liver cancer or risks of the liver cancer can be judged by detecting the level of miR-6761-5 p.

The invention provides a product for diagnosing liver cancer and a pharmaceutical composition for treating liver cancer, and provides a molecular means for diagnosing and treating liver cancer.

Drawings

FIG. 1 is a graph of miR-6761-5p expression in tissues;

FIG. 2 is a ROC plot demonstrating the diagnostic efficacy of miR-6761-5 p;

FIG. 3 is a graph of the effect of miR-6761-5p on the proliferative capacity of cells;

FIG. 4 is a graph showing the effect of miR-6761-5p on cell migration and invasion, wherein Panel A is a graph showing the effect of cell migration, and Panel B is a graph showing the effect of cell invasion.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are provided only for the purpose of illustration and are not meant to limit the scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 QPCR detection of miR-6761-5p expression in hepatocellular carcinoma

First, experimental material

1. Experimental reagents and instruments

Synthesizing miRNA first chain cDNA, performing production, with a product number of B532451-0020,

miRNA fluorescent quantitative PCR kit, birth control, cat number B532461-0002,

NanoVue Plus, BIOCHROM LTD, model 28956057,

fluorescent quantitative PCR instrument, Applied Biosystems, model ABI7300

2. Experimental sample

32 cancer tissues of patients with primary liver cancer and corresponding para-cancer tissue samples of more than 3cm are collected, all samples are put into a freezing storage tube after surgical excision and separation for 30min, and are quickly put into a liquid nitrogen tank and transferred to a laboratory at the ultralow temperature of-80 ℃.

Exclusion criteria: the patient has a history of malignant tumor of other organs after the preoperative anti-tumor treatment.

Second, Experimental methods

1. Primer design

A primer for synthesizing miR-6761-5p is designed in Bomaide company, and a U6 internal reference primer is purchased from Tiangen company, wherein the specific primer sequence is as follows: TCTGAGAGAGCTCGATGGCAG (SEQ ID NO.1)

2. Extraction of RNA

Tissue total RNA was extracted using the TRIzol method.

1) Adding 1mL of TRIzol into a glass homogenizing bottle in an ultraclean bench, pressing the homogenizing bottle onto an instrument, weighing 50-100mg of tissues into the glass homogenizing bottle, adjusting the rotation speed to about 1500 revolutions, starting homogenizing in an ice-water bath, grinding for 30s, stopping 30s, and repeating for 3-4 times. The sample volume should not exceed 10% of the TRIzol volume.

2) The sample added with TRIzol was left at room temperature for 10min to completely separate the nucleic acid-protein complex.

3) Adding 200 μ L chloroform into 1mL TRIzol, shaking vigorously for 2min, shaking for two times every 1min, and standing for 7min after 5-6 times.

4) Centrifuge at 12000rpm for 15min at 4 ℃. The sample was divided into three layers: the bottom layer is a yellow organic phase, and the upper layer is a colorless aqueous phase and an intermediate layer. The RNA is predominantly in the aqueous phase, which is about 60% of the volume of TRIzol used.

5) The upper aqueous phase was transferred to a new EP tube (about 400. mu.L, with as little intermediate layer as possible to avoid contamination). Add 500. mu.L of isopropanol and let stand at room temperature for 10 min.

6) Centrifugation was carried out at 12000rpm for 15min at 4 ℃ and a white precipitate appeared at the bottom of the tube after centrifugation. The supernatant was carefully removed with a pipette.

7) 1mL of 75% cold ethanol was added and the precipitate was washed with shaking. Centrifuge at 7500rpm for 5min at 4 ℃ and carefully discard the supernatant.

9) The EP tube is reversely buckled on the filter paper to absorb excessive water, a 10-microliter gun head is used for carefully absorbing liquid in the tube (the gun head does not contact RNA), the EP tube is placed for 5min at room temperature, and the RNA becomes transparent;

10) add 40. mu.L RNase-free water (DEPC water) and measure OD and concentration with naodrop, and mark on the tube.

2. Reverse transcription synthesis of miRNA cDNA

miRNA cDNA reverse transcription is carried out by adopting miRNA first strand cDNA synthesis (cargo number: B532451-0020), ToTal RNA 2 mu g, 2 × miRNA RT SoluTion Mix 10 mu L, miRNA RT Enzyme Mix 2 mu L and RNase-Free water are respectively added into a test tube and supplemented to 20 mu L, the prepared reaction SoluTion is gently mixed by a pipettor, and the mixture is heated in a water bath kettle at 37 ℃ for 60min and at 85 ℃ for 5min, and is stored in a refrigerator at-20 ℃ after short centrifugation.

3. Fluorescent quantitative detection

After diluting each sample micDNA 50 times, taking 1 mul as a template, and respectively amplifying by using a target gene primer and an internal reference gene primer. At the same time, the dissolution curve analysis is carried out at 60-95 ℃.

1) The PCR reaction system was configured as shown in Table 1

TABLE 1 reaction System

2) PCR reaction program was set up as in Table 2

TABLE 2 reaction conditions

3) Relative quantification

According to RealTimePCR original detection result, according to 2^-△△ctRelative quantitative calculation formula, i.e.

And calculating the relative quantitative result of the target gene of each sample, namely the difference of the target gene miRNA transcription level of other samples relative to the control sample.

Three, result in

The QPCR result is shown in figure 1, compared with the tissue beside the cancer, the expression of miR-6761-5P in the liver cancer tissue is obviously reduced, and the difference has statistical significance (P is less than 0.05).

Specifically, there were 31 samples presenting significant miR-6761-5p, 25 samples with significant downregulation in cancer tissues, and 6 samples with significant downregulation in paracarcinoma tissues.

Example 2 validation of diagnostic efficacy of biomarkers

1. Data collection

Collecting miRNA expression profile data of 342 liver cancer tissues and 50 paracarcinoma tissues from a TCGA database, and analyzing the expression level of miR-6761-5p in the liver cancer tissues and the paracarcinoma tissues.

2. ROC curve analysis

And (3) analyzing the working characteristics of the miR-6761-5p subject by using a pROC package in the R language, calculating two accurate confidence spaces, and drawing an ROC curve.

3. Results

The ROC analysis result of the miR-6761-5p is shown in figure 2, the AUC value of the miR-6761-5p as the test result variable is 0.744, and the area under the curve is higher, so that the diagnosis of the liver cancer by using the miR-6761-5p has higher sensitivity and specificity and better diagnosis efficiency.

Example 3 detection of expression levels of miRNA in liver cancer cells

1. Cell culture

Culturing human normal liver cell line L-02, low invasion metastatic ability liver cancer cell line HepG2, and high invasion metastatic ability liver cancer cell line Huh7, culturing cells in 1640 cell culture medium containing 10% FBS, 100units/ml penicillin and 100ug/ml streptomycin at 37 deg.C and 5% CO₂And culturing under saturated humidity.Cells were changed every 2 days and passaged 1: 3.

2. Extraction of cellular RNA

Total cellular RNA was extracted using the TRIzol method.

Collecting cells in logarithmic phase, adding 1ml of TRIzol, and mixing uniformly; the cells were disrupted and the DNA sheared by repeated aspiration using a 1ml syringe and allowed to stand at room temperature for 5min, the rest being the same as in example 1.

3. Reverse transcription and fluorescent quantitative detection

The experimental procedure was as in example 1.

4. Statistical treatment

All data are expressed as mean ± standard deviation (mean ± SD). Comparisons between two groups were performed using a two-sided Student's t test, and three and more groups were analyzed using one-way anova. All results were plotted using GraphPad Software, with P <0.05 as the test level, and differences of P <0.05 were statistically significant.

5. Results

The results show that compared with the control group L-02(1 +/-0.08), the expression of miR-6761-5p in liver cancer cell strains HepG2(0.35 +/-0.092) and Huh7(0.183 +/-0.06) is obviously reduced, and the expression level in Huh7 cells is the lowest. Huh7 cells were therefore selected for subsequent experiments.

Example 4 Effect of miR-6761-5p on hepatoma cells

1. Cell transfection

Both the mimics NC (negative control) and the miR-6761-5p mimics used in the experiment were synthesized by Shanghai Gima.

Huh7 cells were cultured and digested with trypsin for passage when the cell growth was approximately 80-90% under the microscope. According to the transfection reagent Lipofectamine^TM3000 Instructions for transfection of Huh7 cells. The method comprises the following specific steps:

1) 24h before transfection, 3.0 × 10 was inoculated in 6-well plates filled with medium⁵Individual cells, the cell fusion degree reaches 50% when the cells are transfected;

2) preparing a transfection substance, namely adding 125 mul of serum-free and antibiotic-free RMPI1640 culture medium into 9 mul of miR-6761-5p mimics and NC, and adding 5 mul of Lipofectamine into each hole^TM3000 reagent, fully beating and uniformly mixing, and then standing for 5min；

3) The culture medium in the 6-well plate was aspirated by a pipette, and then 800. mu.l of a culture medium containing 10% fetal bovine serum and a transfection product prepared in advance were added to each well;

4) and (5) slightly shaking the culture plate to fully mix the reagents, placing the mixture in an incubator to continue culturing, and replacing fresh culture solution after 6 h.

2. CCK8 experiment

1) The experiment is divided into 3 groups, namely a negative control NC group, a miR-6761-5p mimics group and a blank control group, wherein each group is provided with 5 multiple holes;

2) transfected Huh7 cells were cultured for 72h, cell counts were performed by digestion with 0.25% trypsin, and cells were plated in 96-well plates at a concentration of 1 × 10⁴Per ml, 100 mul is added in each hole;

3) adding 10 μ l of CCK8 reagent into each well of 96-well plate under dark condition, shaking the culture plate for 3min, placing the culture plate into an incubator for continuous culture, taking out after 2h, and measuring OD value at 450nm wavelength of an enzyme labeling instrument.

3. Transwell migration and invasion experiments

1) Transwell cell preparation

Melting the Matrigel in an ice bath under aseptic conditions, diluting the Matrigel glue according to the proportion of 1:8, slowly adding the Matrigel glue to the bottom of an upper chamber of a Transwell, spreading the Matrigel glue, and quickly transferring the Matrigel glue to a cell culture box at 37 ℃ for incubation until the Matrigel glue is solidified into a gel;

2) the experiment is divided into 3 groups, namely a negative control NC group, a miR-6761-5p group and a blank group of untransfected RNA, each group is provided with 3 multiple holes, and the number of the multiple holes added in the upper chamber is 2 × 10⁴Adding 600 μ l of culture medium containing 10% fetal calf serum into the lower chamber of the suspension of each cell, and culturing at 37 deg.C for 48 hr in a constant temperature incubator;

3) dyeing process

The Transwell was taken out and washed 3 times with PBS, fixed with paraformaldehyde for 30min and washed 3 times with PBS, stained with crystal violet for 30min, stopped with purified water, observed under a fluorescent microscope and counted.

4. Statistical analysis

5. Results

Cell transfection results show that the expression level (4.75 +/-0.54) of miR-6761-5p of the miR-6761-5p mimics experimental group is remarkably increased compared with that of the control group, and the negative control group (0.94 +/-0.051) and the blank control group (1 +/-0.04) have no remarkable difference.

The CCK8 detection result is shown in figure 3, compared with a negative control NC group (1.328 +/-0.0743) and a blank control group (1.4 +/-0.099), the cell proliferation of an experimental group (0.73 +/-0.0583) transfected with miR-6761-5P mimics is obviously inhibited (P is less than 0.05), and the miR-6761-5P is prompted to have obvious inhibition effect on the cell proliferation capacity of Huh 7.

The Transwell chamber detection results are shown in FIG. 4, compared with the blank control group (migration: 156.7 + -6.028; invasion: 125.3 + -7.767), the negative control group (migration: 148 + -6.557; invasion: 118.3 + -3.055) has obviously reduced migration and invasion abilities of the experimental group cells (migration: 78.33 + -6.11; invasion: 57 + -7.211), which indicates that miR-6761-5p has obvious inhibition effect on the migration and invasion of Huh7 cells.

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Hospital of Hebei medical university

<120> diagnostic product and therapeutic composition for liver cancer

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

tctgagagag ctcgatggca g 21

Claims

1. A marker for detecting liver cancer of a subject, which is characterized by comprising a marker miR-6761-5 p.

2. Use of an agent for detecting miR-6761-5p in the preparation of a product for diagnosing liver cancer in a subject, wherein the diagnosis comprises

1) Identifying expression of miR-6761-5p relative to a control; and

3. Use according to claim 2, characterized in that said agent comprises

An oligonucleotide probe for specifically recognizing miR-6761-5 p; or

And (3) primers for specifically amplifying miR-6761-5 p.

4. The use according to claim 3, wherein the primer sequence is as shown in SEQ ID No. 1.

5. A product for diagnosing liver cancer, which comprises a reagent for detecting miR-6761-5p in a sample of a subject, and is preferably an oligonucleotide probe specifically recognizing miR-6761-5 p; or a primer for specifically amplifying miR-6761-5 p.

6. The product of claim 5, wherein the product comprises a kit or microarray.

7. Use according to any one of the following:

8. The use of claim 7, wherein the pharmaceutical composition comprises the isolated miR-6761-5p gene product, and a pharmaceutically-acceptable carrier.

9. The use of claim 7, wherein the method of screening in 4) comprises providing a test agent to the cell and measuring the level of miR-6761-5p, wherein an increase in the level of miR-6761-5p in the cell, relative to a suitable control cell, is indicative of the test agent being a candidate drug for the treatment of hepatocellular carcinoma.

10. A pharmaceutical composition for treating hepatocellular carcinoma, comprising an isolated miR-6761-5p gene product and a pharmaceutically acceptable carrier.