CN111455054B

CN111455054B - Molecule for diagnosis and treatment of radioactive cancer

Info

Publication number: CN111455054B
Application number: CN202010332154.6A
Authority: CN
Inventors: 宋学术; 于维松
Original assignee: Qingdao Central Hospital
Current assignee: Qingdao Central Hospital
Priority date: 2020-04-24
Filing date: 2020-04-24
Publication date: 2021-03-16
Anticipated expiration: 2040-04-24
Also published as: CN111455054A

Abstract

The invention discloses a molecule for diagnosing and treating radioactive cancer, which is AP000251.3, and experiments prove that AP000251.3 is up-regulated in breast cancer, and the molecule can effectively distinguish the breast cancer from a normal population. The invention also proves that the proliferation activity and the invasion capacity of cancer cells can be reduced by interfering the expression of AP000251.3, and further, the breast cancer can be treated.

Description

Molecule for diagnosis and treatment of radioactive cancer

Technical Field

The invention belongs to the field of biomedicine, and relates to a molecule for diagnosing and treating radioactive cancer.

Background

With the application of ionizing radiation in medical diagnosis and treatment, various medical large-scale radiation devices and application techniques thereof are being developed, and thus radiation injuries are increasing. Cancer induced by ionizing radiation is called radioactive cancer or radioactive tumor. Radioactive cancers are clinically and pathologically indistinguishable from cancers induced by other factors. Therefore, the early diagnosis of cancer is of great significance for the early treatment of diseases with different etiologies such as radiation-induced diseases.

Breast cancer is one of the most common cancers in women and is also one of the leading causes of female deaths from cancer, and has become a global public health problem. With the popularization of early disease discovery and the comprehensive treatment of surgical treatment, radiotherapy, chemotherapy, endocrine treatment and molecular targeted drugs, the death rate of breast cancer seems to be reduced, but the recurrence of breast cancer seems to be inevitable, so that the research on the occurrence and development processes of breast cancer is of great significance.

With the development of sequencing technology, it was found that about 98% of "garbage" DNA is transcribed into non-coding RNAs (ncRNAs) (Nie L, Wu HJ, Hsu JM, et al. Long non-coding RNAs: very large master regulators of gene expression and recombinant plasmids in cancer [ J ]. Am J Transl Res 2012,4(2): 127-) 150.) an important member of the non-coding RNA family is long-chain non-coding RNAs (lncRNA) whose transcript length exceeds 200 nucleotides and which do not code for proteins. The genome can be divided into five groups according to the genome position, namely sense lncRNA, antisense lncRNA, bidirectional lncRNA, intron lncRNA and intergenic lncRNA. In recent years more and more scholars have found that lncRNA plays an important role in many biological processes. Gene regulation of lncRNA can function at different levels, including chromatin modification, transcription, post-transcriptional processing, mRNA scaffolding or induction, and post-transcriptional messenger RNA regulation. Despite relatively few research efforts on lncRNA, the clinical application of lncRNA is an emerging hot field with broad prospects as a diagnostic marker and therapeutic target (Leucci E. cancer definition and therapy resistance: spotlights on the dark side of the genome [ J ]. Pharmacol Ther,2018,189: 22-30.). Therefore, the research on the correlation between the lncRNA and the breast cancer has important significance for the diagnosis and treatment of the breast cancer.

Disclosure of Invention

In order to make up for the defects of the prior art, the invention aims to provide a diagnosis and treatment marker related to radioactive cancer-breast cancer, which can be applied to clinic to realize early diagnosis and personalized treatment of breast cancer and improve the life quality of patients.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides application of a reagent for detecting AP000251.3 in preparation of a product for diagnosing early breast cancer.

Further, the reagent comprises a reagent for detecting the expression level of the AP000251.3 by reverse transcription PCR, real-time quantitative PCR, in-situ hybridization and a chip technology.

Further, the reagent for detecting the expression level of AP000251.3 by reverse transcription PCR at least comprises a pair of primers for specifically amplifying AP000251.3, the reagent for detecting the expression level of AP000251.3 by real-time quantitative PCR at least comprises a pair of primers for specifically amplifying AP000251.3, the reagent for detecting the expression level of AP000251.3 by in situ hybridization at least comprises a probe for specifically recognizing AP000251.3, and the reagent for detecting the expression level of AP000251.3 by chip technology at least comprises a probe for specifically recognizing AP 000251.3.

Further, the primer sequence of the specific amplification AP000251.3 for detecting the expression level of AP000251.3 by real-time quantitative PCR is shown in SEQ ID NO. 1-2.

The invention provides a product for diagnosing early breast cancer, which comprises a reagent for detecting the expression level of AP 000251.3.

Further, the product comprises a chip, a kit and a nucleic acid membrane strip.

Further, the chip comprises oligonucleotide probes specifically recognizing the AP 000251.3; the kit comprises a primer pair or a chip specific to the AP 000251.3; the nucleic acid membrane strip includes an oligonucleotide probe that specifically recognizes AP 000251.3.

Furthermore, the sequence of the primer pair specific to the AP000251.3 gene is shown in SEQ ID NO. 1-2.

The invention provides application of AP000251.3 in construction of a calculation model for predicting breast cancer.

The invention provides application of AP000251.3 in preparing a pharmaceutical composition for treating breast cancer.

Further, the pharmaceutical composition comprises an inhibitor of AP 000251.3.

Further, the inhibitor is selected from: nucleic acid molecules, carbohydrates, lipids, small molecule chemicals, or interfering lentiviruses.

Further, the inhibitor is a nucleic acid molecule.

Further, the nucleic acid molecule is siRNA.

Further, the sequence of the siRNA is shown in SEQ ID NO. 5-6.

The invention provides a pharmaceutical composition for treating breast cancer, which comprises an inhibitor of AP 000251.3.

Further, the inhibitor is a nucleic acid molecule.

Further, the nucleic acid molecule is siRNA.

Further, the sequence of the siRNA is shown in SEQ ID NO. 5-6.

The invention provides a method for screening a candidate drug for treating breast cancer, wherein if a substance to be screened reduces the expression level of AP000251.3, the substance to be screened is the candidate drug for treating the breast cancer.

The invention has the advantages and beneficial effects that:

the invention discovers that the differential expression of AP000251.3 is related to the occurrence and development of breast cancer for the first time, and whether a subject suffers from early breast cancer can be judged by detecting the expression level of AP000251.3, so that the early discovery and early treatment are realized, and the life quality of a patient is improved.

The invention also proves that AP000251.3 is related to proliferation and invasion of breast cancer cells through a functional verification experiment, thereby providing a new means for treating breast cancer.

Drawings

FIG. 1 is a graph showing the expression of AP000251.3 gene in a sample.

Fig. 2 is a graph of the effect of AP000251.3 on breast cancer cell invasion.

Detailed Description

The invention is widely and deeply researched, the transcription levels of lncRNA in a breast cancer sample and a normal sample are detected by a method of combining high-throughput sequencing with bioinformatics analysis, lncRNA fragments with obvious expression difference are found, and the relation between the lncRNA fragments and the occurrence of the breast cancer is discussed, so that a better way and a better method are found for the diagnosis and treatment of the breast cancer. Through screening, the invention discovers that AP000251.3 in a breast cancer patient is significantly up-regulated for the first time, and suggests that AP000251.3 can be used as a detection index for clinical diagnosis of breast cancer. Based on the up-regulation of the expression level of AP000251.3 in breast cancer patients, breast cancer is treated by designing a method of reducing the expression level of AP000251.3 by siRNA or the like.

AP000251.3 gene

The AP000251.3 gene is located on human chromosome 21, and the AP000251.3 of the present invention includes the AP000251.3 polynucleotide or a fragment, homolog, variant or derivative thereof. A representative nucleotide sequence of the AP000251.3 gene is shown in ENST 00000433071.2.

One skilled in the art will recognize that the utility of the present invention is not limited to quantifying gene expression of any particular variant of the target gene of the present invention. Two sequences are "substantially homologous" (or substantially similar) if, when the nucleic acid or fragment thereof is optimally aligned (with appropriate nucleotide insertions or deletions) with the other nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 60% of the nucleotide bases, usually at least about 70%, more usually at least about 80%, preferably at least about 90%, and more preferably at least about 95-98% of the nucleotide bases.

The present invention may utilize any method known in the art for determining gene expression. It will be appreciated by those skilled in the art that the means by which gene expression is determined is not an important aspect of the present invention. The expression level of the biomarker can be detected at the transcriptional level. These techniques include, but are not limited to: nucleic acid sequencing techniques, nucleic acid hybridization techniques, and nucleic acid amplification techniques.

The present invention provides a computational model for predicting breast cancer, and as the skilled artisan will appreciate, the steps of correlating marker levels to a likelihood or risk can be carried out and carried out in different ways. Preferably, the measured concentrations of the marker and one or more other markers are mathematically combined and the combined value is correlated to the underlying diagnostic problem. The determination of marker values may be combined by any suitable prior art mathematical method.

Based on the findings of the present inventors, the present invention provides the use of AP000251.3 for the preparation of a pharmaceutical composition for the treatment of breast cancer, comprising an agent that specifically inhibits AP 000251.3. Such agents include, but are not limited to, nucleic acid molecules, carbohydrates, lipids, small molecule chemicals, or interfering lentiviruses.

In a preferred embodiment of the invention, the nucleic acid molecule includes, but is not limited to, an antisense oligonucleotide, double-stranded RNA (dsRNA), small interfering RNA (siRNA), or short hairpin RNA (shRNA).

Preferably, the small interfering RNA (sirna) comprises a first strand and a second strand, which are complementary to form an RNA dimer.

The small interfering RNA of the invention can be a chemically synthesized double-stranded RNA; it may also be a double-stranded RNA expressed by a vector or expression framework in which small interfering RNA expression in mammalian cells is regulated using, for example, an RNA polymerase III promoter including human or murine U6 promoter and human H1 promoter, and an RNA polymerase III terminator.

The small interfering RNA of the invention can be composed of a single small interfering RNA acting on a target sequence, or can be composed of a plurality of small interfering RNAs acting on a plurality of target sequences of a gene or target sequences on a plurality of genes; the target sequence can be the genome sequence of the AP000251.3 gene or the cDNA sequence of the AP000251.3 gene. Specifically, the small interfering RNA of the present invention may consist of at least one sequence in a sequence table.

Preferably, the short hairpin rna (shrna) comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, the sequences of the sense strand segment and the antisense strand segment being complementary. As an alternative embodiment, the sequence of the stem-loop structure of the shRNA may be selected from any one of the following sequences: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CUCGAG, AAGCUU, and CCACACC.

In preparing the pharmaceutical compositions of the present invention, the active ingredient is typically mixed with, or diluted with, excipients or enclosed within a carrier which may be in the form of a capsule or sachet. When the excipient serves as a diluent, it can be a solid, semi-solid, or liquid material that acts as a vehicle, carrier, or medium for the active ingredient. Thus, the composition may be in the form of tablets, pills, powders, solutions, syrups, sterile injectable solutions and the like. Examples of suitable excipients include lactose, dextrose, sucrose, sorbitol, mannitol, starch, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, and the like. The formulation may further comprise: wetting agents, emulsifiers, preservatives (such as methyl and propyl hydroxybenzoates), sweeteners, and the like.

The application of the pharmaceutical composition provides a method for treating tumors, in particular to a method for preventing or treating tumors in a subject, which comprises the step of administering an effective dose of the pharmaceutical composition to the subject.

When the pharmaceutical composition is used for preventing or treating tumors in a subject, an effective dose of the pharmaceutical composition needs to be administered to the subject. Using this method, the growth, proliferation, recurrence and/or metastasis of the tumor is inhibited. Further, at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% fraction of the growth, proliferation, recurrence and/or metastasis of the tumor is inhibited.

The pharmaceutical compositions of the invention may also be used in combination with other agents for the treatment of breast cancer, and other therapeutic compounds may be administered simultaneously with the main active ingredient, even in the same composition.

The present invention is further illustrated below with reference to specific examples, which are provided only for the purpose of illustration and are not meant to limit the scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 screening of Gene markers associated with early Breast cancer

1. Sample collection

31 samples of stage I-II breast cancer tissue and their corresponding paraneoplastic tissue samples (2 cm from the tumor margin) were collected, 4 of which were randomly selected for high throughput sequencing, all excluding other neoplastic diseases, autoimmune diseases and severe chronic diseases.

2. Preparation of RNA samples

The Trizol method is used for extracting RNA in tissues and comprises the following steps:

1) cutting tissue with scissors, adding 1ml Trizol, and shaking on oscillator for 1 min; standing at room temperature for 10 min.

2) Adding 200 μ l chloroform (chloroform), covering the tube, shaking vigorously for 15s, and standing at room temperature for 10 min.

3) Centrifuge at 11000rpm for 15min at 4 ℃.

4) Transferring the water sample layer into a new centrifuge tube, and adding 500 mul of isopropanol; after the mixture was inverted and mixed, the mixture was left standing at room temperature for 10 min.

5) Centrifuge at 11000rpm for 15min at 4 ℃.

6) The liquid was carefully aspirated off with a gun, the precipitate was left at the bottom of the tube, 1ml of 75% ethanol was added, the mixture was shaken on a shaker for 5s, and the precipitate was washed once.

7) Centrifuge at 8000rpm for 5min at 4 ℃.

8) Carefully removing the supernatant, drying the precipitate for 10min, and adding appropriate amount of water to dissolve the precipitate for 10 min.

3. Total RNA quantitation and purity analysis

The extracted RNA is subjected to agarose gel electrophoresis, the concentration and purity of the extracted RNA are detected by using Nanodrop2000, the integrity of the RNA is detected by the agarose gel electrophoresis, and the RIN value is determined by Agilent 2100. The total amount of RNA required for single library construction is 5 mug, the concentration is more than or equal to 200 ng/mug, and the OD260/280 is between 1.8 and 2.2.

4. Construction of cDNA library

1) Ribosomal RNA was removed from total RNA using the Ribo-Zero kit from Epicentre.

2) For the complete RNA sequence, metal ions are utilized to randomly break the RNA into small fragments of about 200 bp.

3) The construction of cDNA library was performed using Illumina Truseq RNA sample Prep Kit.

5. Sequencing

2X 150bp sequencing was performed using the Illumina X-Ten sequencing platform.

6. High throughput transcriptome sequencing data analysis

Deletion of non-detectable lncRNA differential expression analysis of reads numbers using DESeq2 in the R-3.3.3 tool, differential expression lncRNA screening criteria: FDR <0.05, abs (log2FC) > 2.

7. Results

High throughput sequencing results showed that AP000251.3 expression levels were significantly up-regulated in early breast cancer tissues compared to paracarcinoma tissues.

Example 2 QPCR sequencing verification of differential expression of AP000251.3 Gene

1. Large sample QPCR validation of AP000251.3 was performed using 31 previously collected tissue samples of early breast cancer and paracarcinoma tissue samples.

2. RNA extraction procedure as in example 1

3. qRT-PCR amplification assay

3.1 reverse transcription

The operation was carried out using a reverse transcription kit (Takara code: DRR047A) of TAKARA.

1) Removal of genomic DNA

Add 5 XgDNAeraser B. mu.ffer 2.0. mu.l, gDNA Eraser 1.0. mu.l, total RNA 1. mu.g, and RNase Free ddH into the tube₂O to make the total volume to 10 μ l, heating in water bath at 42 deg.C for 2 min.

2) Reverse transcription reaction

5 XPrime

Buffer 2 4.0μl，Prime

RT Enzyme Mix I 1.0μl，RT Primer Mix 1.0μl，RNase Free ddH₂O4.0. mu.l was added to the above test tube and mixed together to give 20. mu.l, which was then heated in a water bath at 37 ℃ for 15min and 85 ℃ for 5 s.

3.2 QPCR amplification

1) Primer design

Designing primers according to the gene sequences of AP000251.3 and GADPH, wherein the specific primer sequences are as follows:

AP000251.3(5’to 3’)：

ACGCTGTGGAAGATAAAC(SEQ ID NO.1)；

TGGGAGAGGGTTAAGAAG(SEQ ID NO.2)。

GAPDH(5’to 3’)：

AATCCCATCACCATCTTCCAG(SEQ ID NO.3)；

GAGCCCCAGCCTTCTCCAT(SEQ ID NO.4)。

2) QPCR amplification assay

By using

Premix Ex Taq^TMII (Takara Code: DRR081) kit is configured with a PCR reaction system in a Thermal Cycler

PCR amplification is carried out on a Real Time System amplification instrument, after the reaction is finished, the amplification curve and the dissolution curve of the Real Time PCR are confirmed, and relative quantification is carried out by a delta CT method.

Prepare 25. mu.l reaction:

premix Ex TaqTM II (2X) 12.5. mu.l, forward (reverse) primers 1. mu.l each, DNA template 2. mu.l, and sterile distilled water 8.5. mu.l.

Reaction conditions are as follows: 30s at 95 ℃ (5 s at 95 ℃, 30s at 60 ℃) multiplied by 40

4. Results

The QPCR results are shown in fig. 1, compared with the paracancerous tissues, AP000251.3 was up-regulated in early breast cancer tissues, and the difference was statistically significant (P <0.05), wherein 28 cases of the samples showed significant up-regulation, 25 cases of the samples showed up-regulation in breast cancer tissues, 3 cases of the samples showed up-regulation in paracancerous tissues, and the expression up-regulation was regarded as positive (+), and no significant change or down-regulation was regarded as negative (-), and the specific statistics are shown in table 1, indicating that AP000251.3 as a molecular marker applied to the diagnosis of breast cancer has higher sensitivity and specificity, and can distinguish breast cancer from control population.

TABLE 1 expression of genes in samples

Example 3 functional verification of AP000251.3

1. Cell culture

BT474 cell line for breast cancer, cultured in DMEM medium containing 10% fetal bovine serum (Gibco) in 5% CO₂And culturing at 37 deg.C in a constant temperature incubator.

2. Transfection

The general siRNA-NC and siRNA-AP000251.3 used in the application are purchased from Shanghai Ji code pharmaceutical technology GmbH, and the siRNA-AP000251.3 sequence for silencing AP000251.3 is shown as follows:

5’to 3’：

AGGUUAACAAAAAUGGAUGGG(SEQ ID NO.5)

CAUCCAUUUUUGUUAACCUCC(SEQ ID NO.6)

the experiments were divided into three groups, and the experiments were divided into 3 groups, namely a control group (BT474), a negative control group (siRNA-NC) and an experimental group (siRNA-AP 000251.3). Transfection was performed according to the instructions of the lipofectamine2000 transfection reagent from Invitrogen. The method comprises the following specific steps:

the day before the experiment, 6-well plates were plated with serum-free medium without double antibody, and the cell density was 6X 10⁵A hole. Transfection was initiated when the degree of cell fusion reached 70%. 50. mu.L of OPTI-MEM was added to each 1.5ml of EP tube, and 5. mu.L of siRNA-AP000251.3, siRNA-NC and culture medium were added thereto, and the mixture was allowed to stand at room temperature for 5 min. Adding OPTI-MEM 30 μ L into each 1.5ml EP tube, adding Lipofectamine 20002 μ L, and standing at room temperature for 5 min; the diluted siRNA was gently mixed with Lipofectamine2000 and allowed to stand at room temperature for 20 min. Adding the mixed solution into each 6-pore plate containing the OPTI-MEM, and slightly and uniformly mixing the mixture front, back, left and right; after incubation in the incubator for 6h, the transfection solution was changed to a serum-free medium without double antibody.

3. Real-time PCR assay

After 48h of transfection and culture of each group of cells, total RNA of the cells was extracted by Trizol method, reverse transcription and real-time quantitative PCR detection were performed according to the method of example 2.

4. CCK-8 detection

Collecting cells in logarithmic growth phase, wherein the number of the cells added into each hole is 5000, each group is provided with 5 multiple holes and zero setting holes, the cells are placed at 37 ℃ and 5% CO₂Culturing in an incubator, taking out cells after 48 hours, adding 10 mul of CCK-8 detection solution into each hole, continuously putting a 96-hole plate into the cell incubator to incubate for about 4 hours, detecting the absorbance value of each hole at the wavelength of 450nm by using an enzyme-labeling instrument, and recording data.

5. Transwell detection

Melting the Matrigel in an ice bath under aseptic condition, diluting the Matrigel glue according to the proportion of 1:8, slowly adding the Matrigel glue to the bottom of an upper chamber of a Transwell, spreading the Matrigel glue, and quickly transferring the Matrigel glue into a cell culture box at 37 ℃ for incubation until the Matrigel glue is solidified into a gel shape. The adding amount of the upper chamber is 1 multiplied by 10⁵The lower chamber was filled with 600. mu.l of a medium containing 10% FBS, each set was set with 3 multiple wells, and cultured in a constant temperature incubator at 37 ℃ for 48 hours. Then, the Transwell was taken out and washed with PBS for 2 times, fixed with paraformaldehyde, stained with crystal violet, stained at room temperature for 20min, rinsed with PBS for 2 times, placed under a fluorescence microscope for observation and counted.

6. Statistical analysis

The experiments were performed in 3 replicates, and the results were expressed as mean ± sd, and the difference between the two was determined by paired t-test, which was considered statistically significant when P < 0.05.

7. Results

1) The expression level of AP000251.3 (0.227 ± 0.0862) in the experimental group after transfection of siRNA-AP000251.3 was significantly lower than that in the control group and the negative control group (BT474vs siRNA-AP000251.3, P value 0.0041,; siRNA-NC vs siRNA-AP000251.3 with P value of 0.0086, x), whereas the expression level of AP000251.3 in negative control transfected siRNA-NC was not significantly changed (BT474vs siRNA-NC with P value of 0.274, ns).

2) The CCK-8 assay results showed that the OD values (0.312 ± 0.065) of the experimental group were significantly reduced compared to the OD values (0.674 ± 0.0654) of the negative control group, and the differences were statistically significant (siRNA-NC vs siRNA-AP000251.3, P ═ 0.0003, x), indicating that the proliferation of BT474 cells was significantly inhibited after knock-down of AP 000251.3.

3) The cell invasion experiment result shows that the number of cells passing through the basement membrane is obviously reduced compared with that of a negative control group after AP000251.3 is knocked down (figure 2), the difference is statistically significant (siRNA-AP000251.3vs siRNA-NC, P ═ 0.0181), and the result shows that the invasion capacity of cancer cells BT474 in vitro can be inhibited after AP000251.3 is knocked down.

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Qingdao city central hospital

<120> molecule for diagnosis and treatment of radioactive cancer

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acgctgtgga agataaac 18

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgggagaggg ttaagaag 18

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aatcccatca ccatcttcca g 21

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gagccccagc cttctccat 19

<210> 5

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agguuaacaa aaauggaugg g 21

<210> 6

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cauccauuuu uguuaaccuc c 21

Claims

1. Application of a reagent for detecting AP000251.3 in preparation of a product for diagnosing early breast cancer.

2. The use of claim 1, wherein the reagents comprise reagents for detecting the expression level of AP000251.3 by reverse transcription PCR, real-time quantitative PCR, in situ hybridization, chip technology.

3. The use according to claim 2, wherein the reagent for detecting the expression level of AP000251.3 by reverse transcription PCR comprises at least one pair of primers for specifically amplifying AP000251.3, the reagent for detecting the expression level of AP000251.3 by real-time quantitative PCR comprises at least one pair of primers for specifically amplifying AP000251.3, the reagent for detecting the expression level of AP000251.3 by in situ hybridization comprises a probe for specifically recognizing AP000251.3, and the reagent for detecting the expression level of AP000251.3 by chip technology comprises a probe for specifically recognizing AP 000251.3.

4. The use of claim 3, wherein the primer sequence of the specific amplification AP000251.3 for detecting the expression level of AP000251.3 by real-time quantitative PCR is shown as SEQ ID No. 1-2.

5. The use of claim 1, wherein the product comprises a chip, a kit, a nucleic acid membrane strip.

6. The use of claim 5, wherein the chip comprises oligonucleotide probes that specifically recognize AP 000251.3; the kit comprises a primer pair or a chip which is specifically aimed at the AP000251.3 gene; the nucleic acid membrane strip includes an oligonucleotide probe that specifically recognizes AP 000251.3.

7. The use according to claim 6, wherein the primer pair specific for the AP000251.3 gene has a sequence shown in SEQ ID No. 1-2.

Use of an inhibitor of AP000251.3 for the preparation of a pharmaceutical composition for the treatment of breast cancer, wherein said inhibitor reduces the expression level of AP 000251.3.

9. The use of claim 8, wherein the inhibitor is a nucleic acid molecule.

10. The use of claim 9, wherein the nucleic acid molecule is an siRNA.

11. The use of claim 10, wherein the siRNA has a sequence as shown in SEQ ID No. 5-6.

12. A method for screening a candidate drug for treating breast cancer, wherein if a substance to be screened decreases the expression level of AP000251.3, the substance to be screened is a candidate drug for treating breast cancer.