CN111321097A

CN111321097A - Bacillus amyloliquefaciens strain and application thereof

Info

Publication number: CN111321097A
Application number: CN201811533298.7A
Authority: CN
Inventors: 张霞; 齐建; 石增秀; 李冬冬; 黄亦钧
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Qingdao Vland Biotech Group Co Ltd
Priority date: 2018-12-14
Filing date: 2018-12-14
Publication date: 2020-06-23
Anticipated expiration: 2038-12-14
Also published as: CN111321097B

Abstract

The invention belongs to the technical field of genetic engineering and microbial engineering modification, and particularly provides a bacillus amyloliquefaciens mutant strain for high yield of neutral protease and application thereof. The preservation number of the mutant strain is CCTCC NO: M2018835. The mutant strain can efficiently express neutral protease, the shake flask fermentation enzyme activity is up to 9514U/mL, which is improved by 68% compared with the original strain, the 20L tank fermentation enzyme activity is up to 40550U/mL, which is improved by 59% compared with the original strain, and unexpected technical effects are achieved. The mutant strain can be widely applied to fermentation production of neutral protease, is beneficial to reducing the production cost of the neutral protease and promotes the popularization and application of the neutral protease.

Description

Bacillus amyloliquefaciens strain and application thereof

Technical Field

The invention relates to the technical field of genetic engineering and microbial modification, in particular to bacillus amyloliquefaciens and application thereof in production of neutral protease.

Background

Neutral proteases (Neutral proteases) are proteases that act on the peptide bonds of proteins at Neutral pH, hydrolyzing proteins into amino acids, polypeptides and free amino acids. The neutral protease has an optimum pH of about 7.0The pH value is kept stable between 6.0 and 9.0, the general molecular weight is between 35 and 40 kDa, and the active center is metal ions. The neutral protease mainly comprises Bacillus subtilis, Aspergillus oryzae, Mucoraceae, Aspergillus terreus, and Bacillus Thermus (Bacillus subtilis, Bacillus Thermus)B.thermoproteolyticus), Streptomyces avermitilis (St.griseus) and Aspergillus melleus (A. melleus)AMelleus), and the like.

The neutral proteinase is different from livestock and poultry, and is that the pH of intestinal tract of aquatic animal tends to neutral, so that the neutral proteinase is added into the feed of aquatic animal, and can raise digestion capability of aquatic animal, promote utilization of nutrient substance and reduce discharge of ammonia nitrogen.

China starts to research neutral protease from the fifties of the last century, and breeds a batch of excellent strains, such AS bacillus subtilis AS1.398, aspergillus terreus 3.942 and the like. As of the eighties and ninety years of the twentieth century, a great deal of work is done in the directions of strain mutagenesis screening, fermentation process, separation and purification and the like. By the beginning of the twenty-first century, the performance and industrial application value of neutral protease were studied by genetic means. Most of neutral protease used in the current market is derived from Bacillus (Bacillus), but the enzyme production capability of the existing neutral protease production strains is generally low, so that the production cost of the neutral protease is too high, and the wide application of the neutral protease in the fields of food, feed and the like is severely limited.

Disclosure of Invention

The invention provides a bacillus amyloliquefaciens (B) for solving the problems of the prior artBacillus amyloliquefaciens) Mutant strains and their use in the production of neutral proteases. The mutant strain obtained by screening by the applicant through an ultraviolet mutagenesis method can greatly improve the expression quantity of the neutral protease, can be widely applied to the production of the neutral protease, reduces the cost of the neutral protease and promotes the wide application of the neutral protease.

The invention provides a bacillus amyloliquefaciens engineering strain which carries a recombinant plasmid for expressing neutral protease.

The encoding nucleotide sequence of the neutral protease is SEQ ID NO. 1.

In one aspect, the invention provides a mutant strain Bacillus amyloliquefaciens SNPBacillus amyloliquefaciensSNP) which is preserved in China center for type culture collection of Wuhan university in Wuhan, China in 2018, 11 and 28 months, and the preservation number is CCTCC NO: M2018835.

The invention provides an application of the bacillus amyloliquefaciens in the production of neutral protease.

The invention also provides a method for producing neutral protease, which takes the bacillus amyloliquefaciens as a fermentation strain.

The invention also provides neutral protease which is obtained by fermenting the bacillus amyloliquefaciens.

The invention firstly constructs and obtains the bacillus amyloliquefaciens SAP-2 of the neutral protease with high-efficiency recombinant expression, and then obtains the mutant strain bacillus amyloliquefaciens SNP by screening the strain serving as an original strain through an ultraviolet mutagenesis method. The shake flask fermentation enzyme activity of the mutant strain is up to 9514U/ml, which is 68% higher than that of the original strain, and the shake flask fermentation enzyme activity of the mutant strain is up to 40550U/ml, which is 59% higher than that of the original strain, so that unexpected technical effects are obtained. The optimal action temperature of the protease produced by the mutant strain is 50 ℃, the optimal action pH value is 7.5, and the optimal action temperature is consistent with that of the original strain. However, the relative enzyme activity of the protease produced by the mutant bacteria in the range of pH7.0-8.0 is generally higher than 85%, and the protease is more suitable for functioning under neutral conditions than the original bacteria. The mutant strain bacillus amyloliquefaciens SNP provided by the invention can be widely applied to the fermentation production of neutral protease, is beneficial to reducing the production cost of the neutral protease and promotes the popularization and application of the neutral protease.

Drawings

FIG. 1 is a diagram of recombinant expression plasmid pUB110-nprEThe plasmid map of (1).

Detailed Description

The process of the present invention is further illustrated below with reference to examples, in which experimental procedures not specifying specific conditions may be performed under conventional conditions, such as those described in molecular cloning, a laboratory manual written by J. Sambruk (Sambrook), et al, or according to conditions recommended by the manufacturer. The present invention may be better understood and appreciated by those skilled in the art with reference to the following examples. However, the method of carrying out the present invention should not be limited to the specific method steps described in the examples of the present invention.

The terms and associated assay methods referred to in the present invention are explained below:

1. the protease activity determination method comprises the following steps: the method for determining the protease preparation is adopted (GB/T25327-2009).

2. Definition of enzyme activity unit: 1 g of solid enzyme powder (or 1 mL of liquid enzyme) hydrolyzes casein for 1 min under the conditions of certain temperature and pH value to generate 1 mu g of tyrosine, namely 1 enzyme activity unit expressed by U/g (U/mL).

3. Protease activity assays were performed using the forskolin method using solutions comprising: folin use solution (one commercial Folin solution was mixed with two portions of water, shaken up), sodium carbonate solution (42.4 g/L), trichloroacetic acid (65.4 g/L), gradient pH buffer, casein solution (10.0 g/L). The reaction process is as follows: adding 1 mL enzyme solution into the test tube, performing warm bath at 40 deg.C for 2 min, adding 1 mL casein solution, shaking, performing warm bath at 40 deg.C for 10 min, adding 2 mL trichloroacetic acid solution, and shaking (adding trichloroacetic acid and casein solution into blank control). Taking out, standing for 10 min, and filtering with chronic qualitative filter paper. Taking 1 mL of filtrate, adding 5 mL of sodium carbonate solution, adding 1 mL of forskolin reagent solution, developing at 40 ℃ for 20 min, and measuring absorbance at 680 nm wavelength by using a 10 mm cuvette.

The present invention will be described in detail with reference to specific embodiments.

EXAMPLE 1 screening and cloning of neutral protease Gene

1. Extraction of Bacillus amyloliquefaciens SAP chromosome

A single colony of fresh wild type bacillus amyloliquefaciens SAP (screened and separated from mountain Laoshan forest soil in Qingdao city in 2015 and 10 months by the inventor) is picked into 5 mL of LB liquid medium, shaking and culturing are carried out on a shaker at 37 ℃ at 200 rpm for overnight, and chromosomes of the bacillus amyloliquefaciens SAP are extracted according to the instruction of a Tiangen bacterial genome extraction kit (Tiangen Biochemical technology Co., Ltd.).

2. Screening of neutral protease Gene

Whole genome sequencing of Bacillus amyloliquefaciens SAP was performed by southern genome sequencing center. According to the sequencing annotation, a neutral protease gene is searched, and the nucleotide sequence of the neutral protease gene is SEQ ID NO. 1. The sequence was determined to be a neutral protease gene by NCBI homology alignment.

3. Synthesis of primers

Designing a cloning primer, cloning a sequence containing SEQ ID NO. 1 into a pUB110 expression vector,

the upstream primer isnprE-F：

5' GACCGAGATTTTTTTGAGCAACTTCAGTTTTCATTTGGAATGGGC 3'；

The downstream primer isnprE-R：

5' CTTGTAGCCATAACAGTTCTTGATCTGTCCGTCCTTCCTTTTTTCC 3'。

4. PCR amplification of target genes

Using Bacillus amyloliquefaciens SAP chromosome as a template and upstream and downstream primers, and performing amplification by using Phusion fidelity enzyme of NEB company under the following amplification conditions: pre-denaturation at 98 ℃ for 2 min, denaturation at 98 ℃ for 10 s, annealing at 58 ℃ for 20 s, extension at 72 ℃ for 60 s, and extension at 72 ℃ for 5 min after 30 cycles. The gel recovery kit is used for recovering PCR amplification products and is namednprEAnd a size of about 2.4 kbp.

EXAMPLE 2 construction of genetically engineered Strain for recombinant expression of neutral protease

1. Construction of recombinant vectors

The vector pUB110 was digested with restriction enzymesBamHI, enzyme digestion is carried out for 30 min at 37 ℃, and then gel electrophoresis is carried out for recovery. Recovery of fragments after PCRnprEMixing with single enzyme digested vector pUB10 at a molar ratio of 3:1, performing cloning reaction with Takara In Fusion kit, reacting at 50 deg.C for 15 min, and transforming Bacillus subtilis to the reaction systemBacillus subtilis1A751, coating an LB plate containing 20 mu g/mL kanamycin and 1% skimmed milk, selecting a transformant with a more remarkable transparent circle, inoculating an LB liquid culture medium containing 20 mu g/mL kanamycin, carrying out overnight culture at 37 ℃, centrifugally collecting thalli, treating the thalli with lysozyme with the final concentration of 1mg/mL, extracting plasmids according to the Omega plasmid extraction kit operation, and obtaining a recombinant expression plasmid pUB110-nprE(the plasmid map is shown in FIG. 1). The recombinant plasmid is sent to Jinzhi sequencing company for sequencing analysis, and the correct reading frame is determined.

2. Host strain competent cell preparation

1) Inoculating host bacteria, namely bacillus amyloliquefaciens SAP into 5 ml of LB culture medium, and culturing overnight.

2) 400 μ L of overnight culture was inoculated into 40 ml (LB + 0.5M sorbitol), cultured at 37 ℃ and 200 rpm to OD₆₀₀=0.85~0.95。

3) And (3) carrying out ice-water bath on the bacterial liquid for 10 min, and then centrifuging at 5000 g and 5 min at 4 ℃ to collect thalli.

4) Resuspend the cells in 50ml of pre-chilled electroporation medium (0.5M sorbitol, 0.5M mannitol, 10% glycerol), centrifuge at 4 ℃ for 5 min at 5000 g, remove the supernatant and rinse 4 times.

5) The washed cells were suspended in 1 ml of an electroporation medium and 60. mu.L of the cells were dispensed into each EP tube.

6) Mu.l of DNA (50-100 ng/. mu.l) was added to 60. mu.l of competent cells, incubated on ice for 2 min, added to a pre-cooled electric rotor (1 mm), and shocked once. The electrotransformation instrument sets up: 2.2 kv, 1 mm, 1 time of electric shock. (electric shock results: time constant =4.5~5.0 ms, if the time constant <4.2, need to increase the number of times of the rinsing of the electroporation medium or increase the competent dilution times to get higher transformation efficiency)

7) After the electric shock, the cup was taken out and 1 ml of RM (LB + 0.5M sorbitol + 0.38M mannitol) was immediately added thereto, and after resuscitating at 37 ℃ and 200 rpm for 3 hours, the plate was smeared. The cells were cultured at 37 ℃ overnight.

3. Transformation of recombinant plasmids

1) The recombinant plasmid pUB110-nprETransformation of Bacillus amyloliquefaciens SAP competent cells.

2) LB plates containing 20. mu.g/mL kanamycin and 1% skim milk were spread, the clear circles were compared, and 21 transformants having larger clear circles were selected and named SAP-1, SAP-2, … …, and SAP-21, respectively.

4. Fermentation validation and enzyme activity determination

And (3) selecting the activated host bacteria, namely the Bacillus amyloliquefaciens SAP and the 21 transformants, respectively inoculating the host bacteria, namely the Bacillus amyloliquefaciens SAP and the 21 transformants into 20 mL of LB culture medium, and culturing the host bacteria and the transformants at 37 ℃ and 200 rpm for 6-8 hours to obtain seed liquid. Inoculating the seed liquid to 50mL of fermentation medium (glucose 5%, soybean cake powder 3%, bran 3%, Na) according to the inoculation amount of 5%₂HPO₄0.78%，KH₂PO₄0.05 percent) and fermented and cultured for 72 hours at 34 ℃ and 220 rpm to obtain fermentation liquor. And centrifuging to remove thalli to obtain a crude enzyme solution containing neutral protease.

The enzyme activity of the neutral protease in the crude enzyme liquid fermented by the host bacteria and the transformant is respectively measured, and the result shows that the enzyme activity of the protease in the crude enzyme liquid fermented by the host bacteria SAP is 956U/mL, the enzyme activity of the protease in the crude enzyme liquid fermented by the SAP-2 in the 21 transformants is the highest and reaches 5663U/mL, and the enzyme activity of the protease in the crude enzyme liquid fermented by a 20L tank is as high as 25503U/mL. Thus, the recombinant engineering strain of the bacillus amyloliquefaciens SAP-2 constructed by the invention can efficiently over-express the neutral protease gene thereofnprE。

Example 3 analysis of enzymatic Properties

3.1 optimum action pH analysis

The fermentation supernatant of the recombinant strain bacillus amyloliquefaciens SAP-2 is diluted by adopting disodium hydrogen phosphate-citric acid buffer solutions with the pH values of 5.5, 6.0, 6.5, 7.0, 7.5 and 8.0 respectively and borax-boric acid buffer solutions with the pH values of 8.5 and 9.0 respectively, substrates are prepared by using the buffer solutions with the corresponding pH values respectively, protease activity is measured at 40 ℃, relative enzyme activity is calculated by taking the highest enzyme activity as 100 percent, and a pH-relative enzyme activity curve is made. The result shows that the optimal action pH value of the protease produced by the recombinant strain bacillus amyloliquefaciens SAP-2 obtained by the invention is 7.5, and the protease is neutral protease.

3.2 optimum action temperature analysis

And respectively carrying out protease enzyme activity determination on the recombinant strain bacillus amyloliquefaciens SAP-2 fermentation supernatant under the conditions of 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃ and pH7.0, calculating relative enzyme activity by taking the highest enzyme activity as 100 percent, and making a temperature-relative enzyme activity curve. The result shows that the optimal action temperature of the protease produced by the recombinant strain bacillus amyloliquefaciens SAP-2 is 50 ℃, and the relative enzyme activity of more than 90 percent can be maintained within the range of 45-55 ℃.

EXAMPLE 4 mutagenic screening of strains producing high amounts of neutral protease

The mutation caused by ultraviolet mutagenesis has strong randomness, and the effect generated by mutation is random and difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to perform multiple rounds of ultraviolet mutagenesis, the screening workload is large, and the possibility that effective positive mutations cannot be obtained exists. However, ultraviolet mutagenesis requires simple equipment and low cost, and can obtain a large number of mutants in a short time, so that it is still a common mutagenesis breeding method.

The applicant constructed the recombinant strain Bacillus amyloliquefaciens SAP-2 (in example 2)Bacillus amyloliquefaciensSAP-2) is an original strain, and is genetically modified by an ultraviolet mutagenesis method, so that the yield of neutral protease is further improved.

4.1 preparation of bacterial suspension

Streaking and inoculating the original bacillus amyloliquefaciens SAP-2 on an LB inclined plane (0.5 percent of yeast powder, 1 percent of peptone, 1 percent of NaCl and 2 percent of agar), and culturing for 24 hours at 37 ℃; 5 mL of 0.85% sterile was addedThe normal saline washes off all the thalli on the inclined plane, transfers the thalli into a sterile test tube containing glass beads, and performs vortex oscillation for 10 min to completely break the thalli into unicellular thalli; transferring all the bacterial suspension into a 15 mL centrifuge tube, centrifuging at 6000 rpm for 3 min, collecting thalli, taking supernatant, and suspending the thalli by using 10 mL physiological saline; the cells were washed twice and finally the cell concentration was adjusted to 10⁸one/mL.

4.2 UV mutagenesis treatment and determination of the mutagenic dose

Opening a 9W ultraviolet lamp switch, and preheating for about 30 min; taking a sterile plate with the diameter of 9 cm, adding the above cell concentration of 10⁸Adding 10 mL of bacteria suspension per mL, adding a sterile magnetic stirring rotor, opening a magnetic stirrer, opening a dish cover, and respectively stirring and irradiating for 1 min, 2 min, 3 min, 4 min and 5 min at a vertical distance of 15 cm; and (4) covering the dish cover, closing the ultraviolet lamp, and incubating for 30 min in the dark.

Diluting the irradiated bacterial suspension to 10% with 0.85% physiological saline gradient^-1~10^-6(ii) a Get 10^-4、10^-5、10^-6Coating LB plate with 100 μ L of each of the three dilutions of bacterial suspension, and coating three plates with each dilution; in the same manner, the bacterial solution which was not subjected to the ultraviolet irradiation treatment was diluted and plated as a control. The plates were spread evenly, wrapped in black cloth or newspaper, and incubated overnight at 37 ℃.

Counting the number of single colonies growing on the plate under each dilution under different irradiation time, and if the number of single colonies growing under a certain dilution is 30-300, determining that the dilution is proper. The number of single colonies growing on the three plates under the dilution was averaged, and the bacterial suspension concentration was calculated according to the following formula:

bacterial suspension concentration (CFU/mL) = average number of colonies × dilution × 10 under certain dilution

The lethality at a certain uv treatment dose was calculated according to the following formula:

mortality (%) = (1-concentration of bacterial suspension after certain dose treatment/concentration of bacterial suspension before treatment) × 100%

The calculated lethality of Bacillus amyloliquefaciens SAP-2 at different UV mutagen doses is shown in Table 1.

Table 1: lethality rate induced by ultraviolet light

Time/min	1	2	3	4	5
						Mortality rate/%	96.1	97.9	98.6	99.8	99.9

As can be seen from Table 1, the lethality of the bacterial suspension after 1 min of ultraviolet irradiation reaches more than 95%, so that the final mutagenesis time is determined to be 1 min.

4.3 Primary sieve for transparent ring of skimmed milk powder plate

Colonies were picked from LB plates with 95% lethality, and streaked to obtain single colonies which were spotted onto skimmed milk powder (skim milk powder 1%, yeast powder 0.25%, peptone 0.5%, NaCl0.5%, agar 2%) plates, 3 of which were set in parallel, and the starting strains were spotted simultaneously as controls. After culturing at 37 ℃ for 36 h, 10% trichloroacetic acid is uniformly dropped. And selecting a single colony of which the ratio of the diameter of the transparent ring to the diameter of the colony is larger than that of the grown-out bacterium, purifying again, and screening 98 mutant strains in total.

4.4 Shake flask rescreening

Respectively inoculating the 98 mutant strains obtained by screening into 50mL shake flask fermentation medium (glucose 5%, bean cake powder 3%, bran 3%, Na)₂HPO₄0.78%，KH₂PO₄0.05 percent) and fermented and cultured at 34 ℃ and 220 rpm for 72 hours, then the supernatant fluid is obtained by centrifugation, the protease activity in the fermented supernatant fluid is respectively measured, and meanwhile, the original strain is used as the reference.

The result shows that in 98 mutant strains obtained by the first round of ultraviolet mutagenesis screening, the protease enzyme activity of 83 mutant strains is basically equivalent to that of the original strain, and the enzyme activity of the rest 15 mutant strains is only improved by 4-9% compared with that of the original strain, so the effect is not ideal.

The applicant carries out 6 rounds of mutagenesis screening according to the method, and finally obtains 1 mutant strain with the yield of neutral protease obviously higher than that of the original strain, namely bacillus amyloliquefaciens SNP (((a) and a (b)Bacillus amyloliquefaciensSNP). 50mL of shake flask fermentation medium (glucose 5%, bean cake powder 3%, bran 3%, Na) for the strain₂HPO₄0.78%，KH₂PO₄0.05 percent), fermenting and culturing at 34 ℃ and 220 rpm for 72 hours, centrifuging and taking supernatant, wherein the protease activity in the supernatant is up to 9514u/ml, which is 68 percent higher than that of the original strain; the protease activity in the crude enzyme liquid fermented in the 20L tank is as high as 40550U/mL, which is improved by 59% compared with the original strain, and unexpected technical effect is achieved.

Applicants have SNP of Bacillus amyloliquefaciens in 2018 at 11/28%Bacillus amyloliquefaciensSNP) is preserved in China center for type culture Collection of Wuhan university in Wuhan, China with the preservation number of CCTCC NO: M2018835.

Example 5 analysis of enzymatic Properties of neutral protease produced by mutant bacteria

5.1 optimum action pH analysis

The fermentation supernatant of the mutant bacillus amyloliquefaciens SNP is diluted by adopting disodium hydrogen phosphate-citric acid buffer solutions with the pH values of 5.5, 6.0, 6.5, 7.0, 7.5 and 8.0 respectively and borax-boric acid buffer solutions with the pH values of 8.5 and 9.0 respectively, substrates are prepared by using the buffer solutions with the corresponding pH values respectively, protease activity is determined at 40 ℃, relative enzyme activity is calculated by taking the highest enzyme activity as 100 percent, and a pH-relative enzyme activity curve is made. The result shows that the optimum action pH value of the protease produced by the mutant strain bacillus amyloliquefaciens SNP is 7.5, the protease is neutral protease and is consistent with the original strain. However, the relative enzyme activity of the protease produced by the mutant bacillus amyloliquefaciens SNP in the pH range of 7.0-8.0 is higher than 85%, and the protease is more suitable for playing a role under a neutral condition than the original bacterium and has a wider application prospect.

5.2 optimum action temperature analysis

And (2) respectively carrying out protease enzyme activity determination on the fermentation supernatant of the mutant bacillus amyloliquefaciens SNP at the conditions of 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃ and pH7.0, calculating relative enzyme activity by taking the highest enzyme activity as 100 percent, and making a temperature-relative enzyme activity curve. The result shows that the optimal action temperature of the protease produced by the mutant bacillus amyloliquefaciens SNP is 50 ℃, and the relative enzyme activity of more than 90 percent can be kept within the range of 45-55 ℃, and is consistent with the original strain.

In conclusion, the mutant strain bacillus amyloliquefaciens SNP obtained by the ultraviolet mutagenesis method can obviously improve the yield of neutral protease, the shake flask fermentation enzyme activity is as high as 9514U/mL which is 68 percent higher than that of the original strain, the 20L tank fermentation enzyme activity is as high as 40550U/mL which is 59 percent higher than that of the original strain, and the protease produced by the mutant strain is more suitable for playing a role under a neutral condition than that of the original strain, so that unexpected technical effects are obtained.

Sequence listing

<110> Islands blue biological group Co Ltd

<120> bacillus amyloliquefaciens strain and application thereof

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>1623

<212>DNA

<213>Bacillus amyloliquefaciens

<400>1

atgctggttt attataacaa tataagtttt cattattttc aaaaaggggg atttattgtg 60

ggtttaggta agaaattgtc tgttgctgtc gccgcttcct ttatgagttt aaccatcagt 120

cttccgggtg ttcaggccgc tgagaatcct cagcttaaag aaaacctgac gaactttgtg 180

ccgaagcatt ctttggtgca atctgaattg ccttcagtca gtgacaaagc aatcaagcaa 240

tacttgaaac aaaacggcaa agtcttcaaa ggcaaccctt ctgagagact gaagctaatt 300

gaccacacga ccgatgatct cggctacaag cacttccgtt atgtgcctgt cgttaacggt 360

gtgcctgtga aagactcgca agtcattatt cacgtcgata aatccaacaa tgtctatgcg 420

attaacggag aattaaacaa cgatgcttct gccaaaacgg caaacagcaa aaaattatct 480

gcaaatcaag cgctggatca tgcttttaaa gcaatcggca aatcacctga agccgtctct 540

aacggcaacg ttgcaaacaa aaacaaagcc gagctgaaag cagcggccac aaaagacggt 600

aaataccgac tcgcctatga tgtaaccatc cgctacatcg aaccggaacc agctaactgg 660

gaagtaaccg ttgatgcgga aacagggaaa gtcctgaaaa agcaaaacaa agtggagcat 720

gccgctgcaa ccggaacagg tacgactctt aaaggaaaaa cggtctcatt aaatatttct 780

tctgaaagcg gcaaatatgt aatgcgtgat ctttctaaac ctaccggaac gcaaattatt 840

acgtacgatc tgcaaaaccg acaatataac ctgccgggca cgctcgtatc aagcactaca 900

aaccagttca caacttcttc tcagcgcgct gccgttgatg cgcattacaa tctcggcaaa 960

gtgtacgatt atttctatca gacgtttaaa cgcaacagct acgacaataa aggcggcaaa 1020

atcgtatctt ccgttcatta cggcagcaaa tacaacaacg cggcctggat cggcgaccaa 1080

atgatttacg gtgacggtga cggctcattc ttctcgcctc tttccggttc aatggacgta 1140

acggcccatg aaatgacaca cggtgttaca caggaaacag ccaacctgaa ctatgaaaat 1200

caaccgggtgctttaaacga atccttctct gatgtattcg gatacttcaa tgatactgag 1260

gactgggata tcggtgaaga tattacggtc agccagccgg ctctccgcag tttatccaat 1320

ccgacaaaat acggacagcc cgaccattac aaaaattatc gaaaccttcc gaatactgat 1380

gccggcgact acggcggcgt gcatacaaac agcggaattc cgaacaaagc cgcttacaac 1440

acgattacaa aaatcggcgt gaaaaaagcg gagcagattt actaccgtgc actgacggta 1500

tatctcactc cgtcatcaag ctttaaagat gcaaaagcag ctttgattca atcagcgcgg 1560

gacctttacg gctctcaaga cgctgcaagc gtagaagcgg cctggaatgc ggtcggcttg 1620

taa 1623

Claims

1. The bacillus amyloliquefaciens engineering strain is characterized by carrying a recombinant plasmid for recombinant expression of neutral protease.

2. The engineered strain of Bacillus amyloliquefaciens according to claim 1, wherein the neutral protease has the coding nucleotide sequence of SEQ ID NO. 1.

3. The bacillus amyloliquefaciens mutant strain is characterized in that the preservation number of the bacillus amyloliquefaciens mutant strain is CCTCC NO: M2018835.

4. The use of the engineered strain of Bacillus amyloliquefaciens of claim 1 in the production of neutral protease.

5. Use of the mutant strain of bacillus amyloliquefaciens of claim 3 for producing a neutral protease.

6. A method for producing a neutral protease, which comprises producing a neutral protease by fermentation using the strain according to claim 1 or 3.