CN111321097B - Bacillus amyloliquefaciens strain and application thereof - Google Patents
Bacillus amyloliquefaciens strain and application thereof Download PDFInfo
- Publication number
- CN111321097B CN111321097B CN201811533298.7A CN201811533298A CN111321097B CN 111321097 B CN111321097 B CN 111321097B CN 201811533298 A CN201811533298 A CN 201811533298A CN 111321097 B CN111321097 B CN 111321097B
- Authority
- CN
- China
- Prior art keywords
- neutral protease
- bacillus amyloliquefaciens
- protease
- strain
- enzyme activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Molecular Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention belongs to the technical field of genetic engineering and microbial engineering modification, and particularly provides a bacillus amyloliquefaciens mutant strain for high yield of neutral protease and application thereof. The preservation number of the mutant strain is CCTCC NO: M2018835. The mutant strain can efficiently express neutral protease, the shake flask fermentation enzyme activity is as high as 9514 u/mL which is 68% higher than that of the original strain, the 20L flask fermentation enzyme activity is as high as 40550U/mL which is 59% higher than that of the original strain, and unexpected technical effects are achieved. The mutant strain can be widely applied to fermentation production of neutral protease, is beneficial to reducing the production cost of the neutral protease and promotes the popularization and application of the neutral protease.
Description
Technical Field
The invention relates to the technical field of genetic engineering and microbial modification, in particular to bacillus amyloliquefaciens and application thereof in production of neutral protease.
Background
Neutral proteases (Neutral proteases) are proteases that act on the peptide bonds of proteins at Neutral pH, hydrolyzing proteins into amino acids, polypeptides and free amino acids. The neutral protease has an optimum pH of about 7.0, is stable within a pH range of 6.0 to 9.0, has a general molecular weight of 35 to 40 kDa, and has an active center of metal ions. The main production strains of the neutral protease comprise bacillus subtilis Aspergillus oryzae (A. Oryzae), mucor (Mucor aceae),Aspergillus terreus (Aspergillus terricola), bacillus caldovelox (Bacillus caldovelox), (B.ferox)B. thermoproteolyticus), streptomyces avermitilis (St.griseus) and Aspergillus melleus (A. Melleus)AMelleus), and the like.
The main application markets of the neutral protease are beer brewing and aquatic feeds. As is known, malt is the most important raw material in beer brewing, the quality of malt has great influence on the quality of beer, but because the solubility of some domestic barley malt is poor, the protein decomposition is incomplete, the alpha-amino nitrogen is insufficient in the saccharification process, and the flavor of the beer is reduced; meanwhile, the existence of a large amount of protein can be combined with polyphenols, so that wort is turbid, and finally, the quality of beer is defective. Compared with plant protease, the neutral protease produced by the microorganism can hydrolyze macromolecular protein, is not influenced by the plant protease inhibitor, and can be added in the malt saccharification process to obviously improve the problems. Different from livestock and poultry, the pH of the intestinal tract of the aquatic animals tends to be neutral, so that the neutral protease is added into the aquatic animal feed, the digestion capability of the aquatic animals can be improved, the utilization of nutrient substances by the aquatic animals is promoted, and the excretion of ammonia nitrogen is reduced. In addition, the neutral protease can also be applied to industries such as detergents, brewing, tanning, medicines and the like.
China begins to research neutral protease from the fifties of the last century, and breeds a batch of excellent strains, such AS bacillus subtilis AS1.398, aspergillus terreus 3.942 and the like. In the eighty-ninety years of the twentieth century, a great deal of work is done in the directions of strain mutagenesis screening, fermentation process, separation and purification and the like. By the beginning of the twenty-first century, the performance and industrial application value of neutral protease were studied by genetic means. Most of neutral protease used in the current market is derived from Bacillus (Bacillus), but the enzyme production capability of the existing neutral protease production strains is generally low, so that the production cost of the neutral protease is too high, and the wide application of the neutral protease in the fields of food, feed and the like is severely limited.
Disclosure of Invention
The invention provides a bacillus amyloliquefaciens (B) for solving the problems of the prior artBacillus amyloliquefaciens) Mutant strains and their use in the production of neutral proteases. The mutant strain obtained by screening by the applicant through an ultraviolet mutagenesis method can greatly improve the expression quantity of the neutral protease, can be widely applied to the production of the neutral protease, reduces the cost of the neutral protease and promotes the wide application of the neutral protease.
The invention provides a bacillus amyloliquefaciens engineering strain which carries a recombinant plasmid for expressing neutral protease.
The coding nucleotide sequence of the neutral protease is SEQ ID NO. 1.
In one aspect, the invention provides a mutant strain Bacillus amyloliquefaciens SNPBacillus amyloliquefaciensSNP), which has been preserved in China center for type culture Collection of Wuhan university in Wuhan, china in 2018, 11/28 th month, with the preservation number of CCTCC NO: M2018835.
The invention provides an application of the bacillus amyloliquefaciens in the production of neutral protease.
The invention also provides a method for producing neutral protease, which takes the bacillus amyloliquefaciens as a fermentation strain.
The invention also provides neutral protease which is obtained by fermenting the bacillus amyloliquefaciens.
The invention firstly constructs and obtains the bacillus amyloliquefaciens SAP-2 of the neutral protease with high-efficiency recombinant expression, and then obtains the mutant strain bacillus amyloliquefaciens SNP by screening the strain serving as an original strain through an ultraviolet mutagenesis method. The shake flask fermentation enzyme activity of the mutant strain is as high as 9514U/ml, which is improved by 68% compared with the original strain, the shake flask fermentation enzyme activity of the 20L tank fermentation enzyme activity is as high as 40550U/ml, which is improved by 59% compared with the original strain, and unexpected technical effects are achieved. The optimal action temperature of the protease produced by the mutant strain is 50 ℃, the optimal action pH value is 7.5, and the optimal action temperature is consistent with that of the original strain. However, the relative enzyme activity of the protease produced by the mutant bacteria in the range of pH7.0-8.0 is generally higher than 85%, and the protease is more suitable for functioning under neutral conditions than the original bacteria. The mutant strain bacillus amyloliquefaciens SNP provided by the invention can be widely applied to the fermentation production of neutral protease, is beneficial to reducing the production cost of the neutral protease and promotes the popularization and application of the neutral protease.
Drawings
FIG. 1 is a diagram of recombinant expression plasmid pUB110-nprEThe plasmid map of (1).
Detailed Description
The process of the present invention is further illustrated below with reference to examples, in which experimental procedures not specifying specific conditions may be performed under conventional conditions, such as those described in molecular cloning, a laboratory manual written by J. Sambruk (Sambrook), et al, or according to conditions recommended by the manufacturer. The present invention may be better understood and appreciated by those skilled in the art with reference to the following examples. However, the method of carrying out the present invention should not be limited to the specific method steps described in the examples of the present invention.
The terms and associated assay methods referred to in the present invention are explained below:
1. the protease activity determination method comprises the following steps: the method for determining the protease preparation is adopted (GB/T25327-2009).
2. Definition of enzyme activity unit: 1 g solid enzyme powder (or 1 mL liquid enzyme), under certain temperature and pH condition, 1 min hydrolyzes casein to generate 1 mug tyrosine, namely 1 enzyme activity unit, expressed as U/g (U/mL).
3. Protease activity assays were performed using the forskolin method using solutions comprising: folin use solution (one commercial Folin solution was mixed with two portions of water, shaken up), sodium carbonate solution (42.4 g/L), trichloroacetic acid (65.4 g/L), gradient pH buffer, casein solution (10.0 g/L). The reaction process is as follows: adding 1 mL enzyme solution into the test tube, carrying out warm bath at 40 ℃ for 2 min, adding 1 mL casein solution, shaking uniformly, carrying out warm bath at 40 ℃ for 10 min, adding 2 mL trichloroacetic acid solution, and shaking uniformly (adding trichloroacetic acid and then adding casein solution into blank control). Taking out, standing for 10 min, and filtering with chronic qualitative filter paper. The 1 mL filtrate was taken, added with sodium carbonate solution 5 mL, added with forskolin reagent 1 mL, developed at 40 ℃ for 20 min, and absorbance was measured at 680 nm wavelength using a 10 mm cuvette.
The present invention will be described in detail with reference to specific embodiments.
EXAMPLE 1 screening and cloning of neutral protease Gene
1. Extraction of Bacillus amyloliquefaciens SAP chromosome
A single colony of fresh wild-type bacillus amyloliquefaciens SAP (the inventor is built in mountain Laoshan forest land soil of Qingdao city and selected and separated in 2015 and 10 months) is taken to be put in 5 mL of LB liquid culture medium, shaking and culturing are carried out at 37 ℃ and 200 rpm in a shaking table overnight, and chromosomes of the bacillus amyloliquefaciens SAP are extracted according to the instruction of a Tiangen bacterial genome extraction kit (Tiangen Biochemical technology Co., ltd.).
2. Screening of neutral protease Gene
Whole genome sequencing of Bacillus amyloliquefaciens SAP was performed by southern genome sequencing center. According to the sequence annotation, a neutral protease gene is searched, and the nucleotide sequence of the neutral protease gene is SEQ ID NO 1. The sequence was determined to be a neutral protease gene by NCBI homology alignment.
3. Synthesis of primers
Designing a cloning primer, cloning a sequence containing SEQ ID NO. 1 into a pUB110 expression vector,
the upstream primer isnprE-F：
5' GACCGAGATTTTTTTGAGCAACTTCAGTTTTCATTTGGAATGGGC 3'；
The downstream primer isnprE-R：
5' CTTGTAGCCATAACAGTTCTTGATCTGTCCGTCCTTCCTTTTTTCC 3'。
4. PCR amplification of target genes
Using Bacillus amyloliquefaciens SAP chromosome as a template and upstream and downstream primers, and performing amplification by using Phusion fidelity enzyme of NEB company under the following amplification conditions: pre-denaturation at 98 ℃ for 2 min, denaturation at 98 ℃ for 10 s, annealing at 58 ℃ for 20 s, extension at 72 ℃ for 60 s, and extension at 72 ℃ for 5 min after 30 cycles. The gel recovery kit is used for recovering PCR amplification products and is namednprEAnd a size of about 2.4 kbp.
EXAMPLE 2 construction of genetically engineered Strain for recombinant expression of neutral protease
1. Construction of recombinant vectors
The vector pUB110 was digested with restriction enzymesBam HI, enzyme digestion is carried out for 30 min at 37 ℃, and then gel electrophoresis is carried out for recovery. Recovery of fragments after PCRnprEMixing with single enzyme digested vector pUB10 at a molar ratio of 3:1, performing cloning reaction with Takara In Fusion kit, reacting at 50 deg.C for 15 min, and transforming Bacillus subtilis to the reaction systemBacillus subtilis1A751, coating an LB plate containing 20 mu g/mL of kanamycin and 1% of skimmed milk, selecting a transformant with a more remarkable transparent circle, inoculating an LB liquid culture medium containing 20 mu g/mL of kanamycin, carrying out overnight culture at 37 ℃, centrifugally collecting thalli, treating the thalli by lysozyme with the final concentration of 1 mg/mL, and extracting plasmids according to the operation of an Omega plasmid extraction kit to obtain a recombinant expression plasmid pUB110-nprE(the plasmid map is shown in FIG. 1). The recombinant plasmid is sent to Jin Weizhi sequencing company for sequencing analysis, and the correct reading frame is determined.
2. Preparation of host bacterium competent cell
1) Inoculating host bacteria bacillus amyloliquefaciens SAP in 5 ml LB culture medium and culturing overnight.
2) 400 μ L of overnight culture was inoculated into 40 ml (LB + 0.5M sorbitol) and cultured at 37 ℃ and 200 rpm to OD 600 =0.85~0.95。
3) And (3) carrying out ice-water bath on the bacterial liquid for 10 min, then carrying out centrifugation at 5000 g for 5 min and at 4 ℃ to collect thalli.
4) The cells were resuspended in 50ml precooled electroporation medium (0.5M sorbitol, 0.5M mannitol, 10% glycerol), 5000 g,5 min, centrifuged at 4 ℃ to remove the supernatant, and rinsed 4 times.
5) The washed cells were suspended in 1 ml electroporation medium and dispensed 60. Mu.L per EP tube.
6) Mu.l of competent cells was added to 10. Mu.L of DNA (50-100 ng/. Mu.L), incubated on ice for 2 min, and added to a pre-cooled electric rotor (1 mm) and shocked once. The electrotransformation instrument sets up: 2.2 kv,1 mm, shock 1 time. ( And (3) electric shock result: the time constant is =4.5 to 5.0 ms, if the time constant is less than 4.2, the rinsing times of the electric rotating culture medium or the dilution times of competence are required to be increased to obtain higher transformation efficiency )
7) After the electric shock, the cup was taken out and 1 ml of RM (LB + 0.5M sorbitol + 0.38M mannitol) was immediately added, and after 3 h was recovered at 37 ℃ and 200 rpm, the plate was smeared. The cells were cultured at 37 ℃ overnight.
3. Transformation of recombinant plasmids
1) The recombinant plasmid pUB110-nprETransformation of Bacillus amyloliquefaciens SAP competent cells.
2) LB plates containing 20. Mu.g/mL kanamycin and 1% skim milk were applied, the clear circles were compared, and 21 transformants having larger clear circles were selected and named SAP-1, SAP-2, … …, and SAP-21, respectively.
4. Fermentation validation and enzyme activity determination
The activated host bacteria, namely the Bacillus amyloliquefaciens SAP and the 21 transformants are selected and respectively inoculated into 20 mL of LB culture medium, and cultured at 37 ℃ and 200 rpm for 6-8 h to obtain seed liquid. Inoculating the seed liquid to 50mL fermentation culture medium (glucose 5%, bean cake powder 3%, bran 3%, na) at an inoculation amount of 5% 2 HPO 4 0.78%，KH 2 PO 4 0.05 percent) and 72 h are fermented and cultured at 34 ℃ and 220 rpm to obtain fermentation liquor. And centrifuging to remove thalli to obtain a crude enzyme solution containing neutral protease.
The enzyme activity of the neutral protease in the host bacteria and the transformant fermentation crude enzyme liquid is respectively measured, and the result shows that the enzyme activity of the protease in the host bacteria SAP fermentation crude enzyme liquid is 956U/mL, the enzyme activity of the protease in the fermentation crude enzyme liquid of SAP-2 in 21 transformants is the highest and reaches 5663U/mL, and the enzyme activity of the protease in the fermentation crude enzyme liquid of a 20L tank is 25503U/mL. Thereby demonstrating that the recombinant engineering strain bacillus amyloliquefaciens SAP-2 constructed by the invention can efficiently over-express the neutral protease gene thereofnprE。
Example 3 analysis of enzymatic Properties
3.1 pH optimum assay
The fermentation supernatant of the recombinant strain bacillus amyloliquefaciens SAP-2 is diluted by adopting disodium hydrogen phosphate-citric acid buffer solutions with the pH values of 5.5, 6.0, 6.5, 7.0, 7.5 and 8.0 respectively and borax-boric acid buffer solutions with the pH values of 8.5 and 9.0 respectively, substrates are prepared by using the buffer solutions with the corresponding pH values respectively, protease activity is measured at 40 ℃, relative enzyme activity is calculated by taking the highest enzyme activity as 100 percent, and a pH-relative enzyme activity curve is made. The result shows that the optimal action pH value of the protease produced by the recombinant strain bacillus amyloliquefaciens SAP-2 obtained by the invention is 7.5, and the protease is neutral protease.
3.2 Optimum action temperature analysis
And respectively carrying out protease enzyme activity determination on the recombinant strain bacillus amyloliquefaciens SAP-2 fermentation supernatant under the conditions of 30 ℃, 35 ℃,40 ℃, 45 ℃,50 ℃, 55 ℃,60 ℃ and pH7.0, calculating relative enzyme activity by taking the highest enzyme activity as 100 percent, and making a temperature-relative enzyme activity curve. The result shows that the optimal action temperature of the protease produced by the recombinant strain bacillus amyloliquefaciens SAP-2 is 50 ℃, and the relative enzyme activity of more than 90 percent can be maintained within the range of 45-55 ℃.
EXAMPLE 4 mutagenic screening of strains producing high amounts of neutral protease
The mutation caused by ultraviolet mutagenesis has strong randomness, and the effect generated by mutation is random and is difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to perform multiple rounds of ultraviolet mutagenesis, the screening workload is large, and the possibility that effective positive mutations cannot be obtained exists. However, ultraviolet mutagenesis requires simple equipment and low cost, and can obtain a large number of mutants in a short time, so that it is still a common mutagenesis breeding method.
The applicant constructed the recombinant strain Bacillus amyloliquefaciens SAP-2 (in example 2)Bacillus amyloliquefaciensSAP-2) is an original strain, and is genetically modified by an ultraviolet mutagenesis method, so that the yield of neutral protease is further improved.
4.1 preparation of the bacterial suspension
Streaking and inoculating the original bacillus amyloliquefaciens SAP-2 on an LB inclined plane (0.5 percent of yeast powder, 1 percent of peptone, 1 percent of NaCl and 2 percent of agar), and culturing at 37 ℃ for 24 h; adding 5 mL of 0.85% sterile physiological saline, completely washing the thalli on the inclined plane, transferring the thalli into a sterile test tube containing glass beads, and performing vortex oscillation for 10 min to completely beat the thalli into single-cell thalli; transferring the bacterial suspension into 15 mL centrifuge tube, centrifuging at 6000 rpm for 3 min, and collectingTaking the supernatant of the thallus, and suspending the thallus by using 10 mL physiological saline; the cells were washed twice and finally the cell concentration was adjusted to 10 8 one/mL.
4.2 Ultraviolet mutagenesis treatment and mutagenesis dose determination
Opening a 9W ultraviolet lamp switch, and preheating for about 30 min; taking a sterile plate with the diameter of 9 cm, adding the cell with the concentration of 10 8 Adding a sterile magnetic stirring rotor into each/mL bacterial suspension 10 mL, opening the magnetic stirrer, opening the dish cover, and respectively stirring and irradiating for 1 min,2 min,3 min,4 min and 5 min at the vertical distance of 15 cm; and (4) covering a flat dish cover, closing the ultraviolet lamp, and incubating for 30 min in the dark.
Diluting the irradiated bacterial suspension to 10% with 0.85% physiological saline gradient -1 ~10 -6 (ii) a Get 10 -4 、10 -5 、10 -6 100 μ L of each of the three dilutions of the bacterial suspension was spread on LB plates, three plates were spread for each dilution; in the same manner, a bacterial solution not subjected to ultraviolet irradiation treatment was diluted and plated as a control. The plates were covered with black cloth or newspaper and incubated overnight at 37 ℃.
Counting the number of single colonies growing on the plate under each dilution under different irradiation times, and if the number of single colonies growing under a certain dilution is between 30 and 300, determining that the dilution is proper. The number of single colonies growing on the three plates under the dilution was averaged, and the bacterial suspension concentration was calculated according to the following formula:
bacterial suspension concentration (CFU/mL) = average number of colonies at a certain dilution × dilution multiple × 10
The lethality at a certain uv treatment dose was calculated according to the following formula:
lethality (%) = (1-concentration of bacterial suspension after certain dose treatment/concentration of bacterial suspension before treatment) × 100%
The calculated lethality of Bacillus amyloliquefaciens SAP-2 at different UV mutagen doses is shown in Table 1.
Table 1: lethality rate induced by ultraviolet light
| Time/ |
1 | 2 | 3 | 4 | 5 |
| Mortality rate/% | 96.1 | 97.9 | 98.6 | 99.8 | 99.9 |
As can be seen from Table 1, the lethality of the bacterial suspension after 1 min of ultraviolet irradiation reaches more than 95%, so that the final mutagenesis time is determined to be 1 min.
4.3 Transparent ring size primary screen for defatted milk powder flat plate
Colonies were picked from LB plates with 95% lethality, and streaked to obtain single colonies which were spotted onto skimmed milk powder (skim milk powder 1%, yeast powder 0.25%, peptone 0.5%, naCl0.5%, agar 2%) plates, 3 of which were set in parallel, and the starting strains were spotted simultaneously as controls. After culturing 36 h at 37 ℃,10% trichloroacetic acid was uniformly dropped. And selecting a single colony of which the ratio of the diameter of the transparent ring to the diameter of the colony is larger than that of the grown-out bacterium, purifying again, and screening 98 mutant strains in total.
4.4 Shake flask rescreen
The 98 mutant strains obtained by screening are respectively inoculated in 50mL shake flask fermentation medium (5 percent of glucose,3% of bean cake powder, 3% of bran and Na 2 HPO 4 0.78%，KH 2 PO 4 0.05 percent), fermenting and culturing 72 h at 34 ℃ and 220 rpm, centrifuging and taking supernate, respectively measuring the protease activity in the fermented supernate, and taking the original strain as a reference.
The result shows that in 98 mutant strains obtained by the first round of ultraviolet mutagenesis screening, the protease enzyme activity of 83 mutant strains is basically equivalent to that of the original strain, and the enzyme activity of the rest 15 mutant strains is only improved by 4-9% compared with that of the original strain, so the effect is not ideal.
The applicant carries out 6 rounds of mutagenesis screening according to the method, and finally obtains 1 mutant strain with the yield of neutral protease obviously higher than that of the original strain, namely bacillus amyloliquefaciens SNP (((a) and a (b)Bacillus amyloliquefaciensSNP). 50mL of shake flask fermentation medium (glucose 5%, bean cake powder 3%, bran 3%, na) for the strain 2 HPO 4 0.78%，KH 2 PO 4 0.05 percent), performing fermentation culture at 34 ℃ and 220 rpm for 72 h, centrifuging and taking supernatant, wherein the protease activity in the supernatant is up to 9514 u/ml, which is 68 percent higher than that of the original strain; the protease activity in the crude enzyme liquid fermented in the 20L tank is as high as 40550U/mL, which is improved by 59 percent compared with the original strain, and unexpected technical effects are obtained.
Applicants have SNP of Bacillus amyloliquefaciens in 2018 at 11/28%Bacillus amyloliquefaciensSNP) is preserved in China center for type culture Collection of Wuhan university in Wuhan, china with the preservation number of CCTCC NO: M2018835.
Example 5 analysis of enzymatic Properties of neutral protease produced by mutant bacteria
5.1 pH optimum assay
The fermentation supernatant of the mutant bacillus amyloliquefaciens SNP is diluted by adopting disodium hydrogen phosphate-citric acid buffer solutions with the pH values of 5.5, 6.0, 6.5, 7.0, 7.5 and 8.0 respectively and borax-boric acid buffer solutions with the pH values of 8.5 and 9.0 respectively, substrates are prepared by using the buffer solutions with the corresponding pH values respectively, protease activity is determined at 40 ℃, relative enzyme activity is calculated by taking the highest enzyme activity as 100 percent, and a pH-relative enzyme activity curve is made. The result shows that the optimum action pH value of the protease produced by the mutant strain bacillus amyloliquefaciens SNP is 7.5, the protease is neutral protease and is consistent with the original strain. However, the relative enzyme activity of the protease produced by the mutant bacillus amyloliquefaciens SNP in the pH range of 7.0-8.0 is higher than 85%, and the protease is more suitable for playing a role under a neutral condition than the original bacterium and has a wider application prospect.
5.2 Optimum action temperature analysis
And (2) respectively carrying out protease enzyme activity determination on the fermentation supernatant of the mutant bacillus amyloliquefaciens SNP at the conditions of 30 ℃, 35 ℃,40 ℃, 45 ℃,50 ℃, 55 ℃,60 ℃ and pH7.0, calculating relative enzyme activity by taking the highest enzyme activity as 100 percent, and making a temperature-relative enzyme activity curve. The result shows that the optimal action temperature of the protease produced by the mutant bacillus amyloliquefaciens SNP is 50 ℃, and the relative enzyme activity of more than 90 percent can be kept within the range of 45-55 ℃, and is consistent with the original strain.
In conclusion, the mutant strain bacillus amyloliquefaciens SNP obtained by the ultraviolet mutagenesis method can obviously improve the yield of neutral protease, the shake flask fermentation enzyme activity is as high as 9514U/mL which is 68 percent higher than that of the original strain, the 20L tank fermentation enzyme activity is as high as 40550U/mL which is 59 percent higher than that of the original strain, and the protease produced by the mutant strain is more suitable for playing a role under a neutral condition than the original strain, thereby achieving unexpected technical effects.
Sequence listing
<110> Qingdao blue biological group Co., ltd
<120> bacillus amyloliquefaciens strain and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1623
<212> DNA
<213> Bacillus amyloliquefaciens
<400> 1
atgctggttt attataacaa tataagtttt cattattttc aaaaaggggg atttattgtg 60
ggtttaggta agaaattgtc tgttgctgtc gccgcttcct ttatgagttt aaccatcagt 120
cttccgggtg ttcaggccgc tgagaatcct cagcttaaag aaaacctgac gaactttgtg 180
ccgaagcatt ctttggtgca atctgaattg ccttcagtca gtgacaaagc aatcaagcaa 240
tacttgaaac aaaacggcaa agtcttcaaa ggcaaccctt ctgagagact gaagctaatt 300
gaccacacga ccgatgatct cggctacaag cacttccgtt atgtgcctgt cgttaacggt 360
gtgcctgtga aagactcgca agtcattatt cacgtcgata aatccaacaa tgtctatgcg 420
attaacggag aattaaacaa cgatgcttct gccaaaacgg caaacagcaa aaaattatct 480
gcaaatcaag cgctggatca tgcttttaaa gcaatcggca aatcacctga agccgtctct 540
aacggcaacg ttgcaaacaa aaacaaagcc gagctgaaag cagcggccac aaaagacggt 600
aaataccgac tcgcctatga tgtaaccatc cgctacatcg aaccggaacc agctaactgg 660
gaagtaaccg ttgatgcgga aacagggaaa gtcctgaaaa agcaaaacaa agtggagcat 720
gccgctgcaa ccggaacagg tacgactctt aaaggaaaaa cggtctcatt aaatatttct 780
tctgaaagcg gcaaatatgt aatgcgtgat ctttctaaac ctaccggaac gcaaattatt 840
acgtacgatc tgcaaaaccg acaatataac ctgccgggca cgctcgtatc aagcactaca 900
aaccagttca caacttcttc tcagcgcgct gccgttgatg cgcattacaa tctcggcaaa 960
gtgtacgatt atttctatca gacgtttaaa cgcaacagct acgacaataa aggcggcaaa 1020
atcgtatctt ccgttcatta cggcagcaaa tacaacaacg cggcctggat cggcgaccaa 1080
atgatttacg gtgacggtga cggctcattc ttctcgcctc tttccggttc aatggacgta 1140
acggcccatg aaatgacaca cggtgttaca caggaaacag ccaacctgaa ctatgaaaat 1200
caaccgggtg ctttaaacga atccttctct gatgtattcg gatacttcaa tgatactgag 1260
gactgggata tcggtgaaga tattacggtc agccagccgg ctctccgcag tttatccaat 1320
ccgacaaaat acggacagcc cgaccattac aaaaattatc gaaaccttcc gaatactgat 1380
gccggcgact acggcggcgt gcatacaaac agcggaattc cgaacaaagc cgcttacaac 1440
acgattacaa aaatcggcgt gaaaaaagcg gagcagattt actaccgtgc actgacggta 1500
tatctcactc cgtcatcaag ctttaaagat gcaaaagcag ctttgattca atcagcgcgg 1560
gacctttacg gctctcaaga cgctgcaagc gtagaagcgg cctggaatgc ggtcggcttg 1620
taa 1623
Claims (3)
1. The bacillus amyloliquefaciens mutant strain is characterized in that the preservation number of the bacillus amyloliquefaciens mutant strain is CCTCC NO. M2018835.
2. Use of the mutant strain of bacillus amyloliquefaciens of claim 1 in the production of a neutral protease.
3. A method for producing a neutral protease, which comprises producing the neutral protease by fermentation using the Bacillus amyloliquefaciens mutant strain according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811533298.7A CN111321097B (en) | 2018-12-14 | 2018-12-14 | Bacillus amyloliquefaciens strain and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811533298.7A CN111321097B (en) | 2018-12-14 | 2018-12-14 | Bacillus amyloliquefaciens strain and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111321097A CN111321097A (en) | 2020-06-23 |
| CN111321097B true CN111321097B (en) | 2022-10-28 |
Family
ID=71168322
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811533298.7A Active CN111321097B (en) | 2018-12-14 | 2018-12-14 | Bacillus amyloliquefaciens strain and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111321097B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113999800B (en) * | 2021-11-25 | 2023-05-12 | 四川省宜宾五粮液集团有限公司 | Novel strain of bacillus and use thereof |
| CN115820470B (en) * | 2022-09-28 | 2023-08-08 | 天曲生物科技有限公司 | Bacillus amyloliquefaciens ZH804 and application thereof |
| CN115786300B (en) * | 2022-11-22 | 2023-11-28 | 天曲生物科技有限公司 | Bacillus amyloliquefaciens with low yield and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087446A (en) * | 2015-09-14 | 2015-11-25 | 青岛蔚蓝生物集团有限公司 | Bacillus amyloliquefaciens for high production of neutral protease |
| CN107201354A (en) * | 2017-07-04 | 2017-09-26 | 北京科为博生物科技有限公司 | A kind of neutral proteinase and its gene and application |
-
2018
- 2018-12-14 CN CN201811533298.7A patent/CN111321097B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087446A (en) * | 2015-09-14 | 2015-11-25 | 青岛蔚蓝生物集团有限公司 | Bacillus amyloliquefaciens for high production of neutral protease |
| CN107201354A (en) * | 2017-07-04 | 2017-09-26 | 北京科为博生物科技有限公司 | A kind of neutral proteinase and its gene and application |
Non-Patent Citations (4)
| Title |
|---|
| bacillolysin [Bacillus amyloliquefaciens Y2];He,P等;《GenBank》;20140130;CDS * |
| Engineering of a Bacillus amyloliquefaciens Strain with High Neutral Protease Producing Capacity and Optimization of Its Fermentation Conditions;Hui Wang等;《PLoS One》;20160111;第11卷(第1期);摘要 * |
| Hui Wang等.Engineering of a Bacillus amyloliquefaciens Strain with High Neutral Protease Producing Capacity and Optimization of Its Fermentation Conditions.《PLoS One》.2016,第11卷(第1期), * |
| 解淀粉芽孢杆菌中性蛋白酶基因的克隆与表达;杜珊珊等;《黑龙江八一农垦大学学报》;20151231;第27卷(第1期);第1-5页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111321097A (en) | 2020-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111321097B (en) | Bacillus amyloliquefaciens strain and application thereof | |
| CN1199424A (en) | Alkaliphilic and thermophilic microorganisms and enzymes obtained therefrom | |
| US20230193215A1 (en) | Mutant glucose oxidase (god) having improved thermal stability and gene and application thereof | |
| CN107384897B (en) | Alkaline protease, gene and application thereof | |
| US20220098563A1 (en) | Special enzyme for galactooligosaccharide production as well as preparation and application thereof | |
| CN102165055A (en) | Aspergillus sp. having large-scale genome duplication | |
| CN110982807A (en) | High-efficiency stable cellulase mutant | |
| CN113430147A (en) | Bacillus villagens QH-20011 with low pH tolerance and application thereof | |
| CN109371004B (en) | Acid protease Bs2688 mutant K203E with improved thermal stability and gene and application thereof | |
| CN105087446B (en) | Bacillus amyloliquefaciens capable of producing neutral protease in high yield | |
| CN114480205A (en) | Bacillus amyloliquefaciens and application thereof in brewing of solid-state fermented vinegar | |
| CN112522125B (en) | Hyaluronidase engineering bacterium and construction method and application thereof | |
| WO1997000944A1 (en) | Transformant producing substance pf1022 and method for transforming microorganism belonging to the class hyphomycetes | |
| WO2024077702A1 (en) | Alkaline protease mutant having high activity at low temperature and use thereof | |
| CN108753631B (en) | Trichoderma reesei and application thereof in tannase production | |
| CN114736881B (en) | Glucose oxidase GoxM10 mutant A4D with improved acid stability and derivative mutant and application thereof | |
| CN113881654B (en) | AlphA-Amylase with improved pepsin resistance | |
| CN115074347A (en) | Feed additive containing keratinase mutant and bile acid and application thereof | |
| CN115029337A (en) | Additive compounded by keratinase mutant and eucommia ulmoides leaf extract and application thereof | |
| CN105420220B (en) | A kind of aspartic acid albuminoid enzyme and its encoding gene and application | |
| CN113801831B (en) | Bacillus subtilis capable of producing neutral protease with high yield and application thereof | |
| CN114774396A (en) | Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive | |
| CN109251867B (en) | High-yield strain of acid protease and application thereof | |
| CN109161489B (en) | Aspergillus niger strain with high yield of acid protease | |
| JPH0325157B2 (en) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |